miRTarBase - #MIRT526560


—
pre-miRNA Information
pre-miRNA hsa-mir-6509   
Genomic Coordinates chr7: 135206994 - 135207078
Description Homo sapiens miR-6509 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6509-3p
Sequence 52| UUCCACUGCCACUACCUAAUUU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs778601614 1 dbSNP
rs754554776 3 dbSNP
rs767798995 3 dbSNP
rs145322812 4 dbSNP
rs773941257 5 dbSNP
rs768273593 9 dbSNP
rs984565062 12 dbSNP
rs748872915 13 dbSNP
rs774861125 14 dbSNP
rs13241975 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UGT2A2   
Synonyms -
Description UDP glucuronosyltransferase family 2 member A2
Transcript NM_001105677   
Expression
Putative miRNA Targets on UGT2A2
3'UTR of UGT2A2
(miRNA target sites are highlighted)		 
>UGT2A2|NM_001105677|3'UTR
   1 GTCAAGAAAAAGAGGAAATATATATATTTTTAAGTTTGGCAAAATCCTGAGTAGTGTAGTCCTATTAATTCCAGACAAAA
  81 GGAGTTTAACAAAAACACGTCTCCCATCCTGTTTCCAAATTTTCTATTTCTCTACCTGCGATAAGCCTACTGATAAAGCC
 161 TAGATTTTGGCATGATTATTATTAACTTGTGAGTTATAGTCTTCTATTTTTCCTTTGTCTCTCCCTGCTGACTATACCCT
 241 CTTCCTGTCACTTTTCTGACACAAGGATACTACCTAATTTTAAATATGTTCTATTCATAGTATCAAATTATTTTATCGTT
 321 AACCTTAATTAATGATTAACAATATGCTGAATCCTGGTAATGCATACAGTGTAGATGGAATTTGATAGGTGTAAGGAAGA
 401 GTCAAATTCACAAATTTCCATATACCAAACAAATCAGGGAGCCACCGTAGGAGAGTAGTGTGTTATGAGAAAGGTAATGA
 481 TTTCCTTTTTTAATAAAAACAAACTCTTCTGCTTGCTCAATGTTTCAGGAGTTAGAGAATGAATTTTAAGTGTGACGTGC
 561 GTCCCTATTAAATGTCTACAAAATTTTCATTAAGCATATCTAGAAAATCACGGCATAACTTGCCTGCCTTTCTTCAACAT
 641 ATATTCTTATATAACCTGTAGTGGAAGATTTGGGTACTGTCTTTAATAAATCAATCAATCGACTCTTTTATTTCAAGGAG
 721 AAAGTTCTATGTTATATGTTGAAGGTGAACAGATCATATTTAGAGGATATAACAATTAGAAATCTAGAAAATAATTATCA
 801 TTTTTATAAAATTTTTAGTCAACTGTACAAATAATTACATAAAACATCAATTAATTATGCTTAAAAATCACTAATGTTCA
 881 TAATATATAATCACTATTTGTAATCAAAAGTTTAATTTTATGCCAAAAAATAAAAAATGCTTACTTGGAATTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuuAAUCCAU--CACCGUCACCUu 5'
             |||  ||   | |:|||||| 
Target 5' ttcTTATATAACCT-GTAGTGGAa 3'
 644 - 666 132.00 -11.50
2 
miRNA  3' uuuaauCCAUCAC---CGUCACCUu 5'
                |||| ||    ||||| | 
Target 5' aatcctGGTAATGCATACAGTGTAg 3'
 350 - 374 120.00 -7.90
3 
miRNA  3' uuuaAUCCAUCACCGUCACcuu 5'
              |||| ||  |:||||   
Target 5' accgTAGG-AG-AGTAGTGtgt 3'
 444 - 463 100.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30465160 9 COSMIC
COSN31548190 9 COSMIC
COSN19706689 14 COSMIC
COSN14121364 15 COSMIC
COSN31509187 20 COSMIC
COSN30124727 21 COSMIC
COSN31573069 27 COSMIC
COSN30122111 45 COSMIC
COSN9051499 58 COSMIC
COSN31525763 81 COSMIC
COSN5865673 92 COSMIC
COSN31598591 139 COSMIC
COSN32064165 158 COSMIC
COSN20075117 160 COSMIC
COSN9051498 522 COSMIC
COSN27711311 556 COSMIC
COSN4838743 611 COSMIC
COSN27916137 791 COSMIC
COSN4838742 864 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1411320571 1 dbSNP
rs1224675475 9 dbSNP
rs767385475 12 dbSNP
rs761881572 15 dbSNP
rs976471834 17 dbSNP
rs751377081 20 dbSNP
rs1275259805 21 dbSNP
rs764039351 24 dbSNP
rs994624184 27 dbSNP
rs1483744914 28 dbSNP
rs961495032 28 dbSNP
rs150470223 32 dbSNP
rs1207373012 39 dbSNP
rs1329123855 43 dbSNP
rs1017633360 73 dbSNP
rs1191990870 77 dbSNP
rs1371756432 81 dbSNP
rs539436729 82 dbSNP
rs187159615 92 dbSNP
rs4148311 99 dbSNP
rs536799448 100 dbSNP
rs552469106 101 dbSNP
rs796134063 102 dbSNP
rs1024602196 103 dbSNP
rs1275886988 105 dbSNP
rs1324537401 109 dbSNP
rs1013250534 114 dbSNP
rs945091240 126 dbSNP
rs1222363727 130 dbSNP
rs776929809 134 dbSNP
rs1053563082 138 dbSNP
rs547983026 139 dbSNP
rs866694061 140 dbSNP
rs1357992023 150 dbSNP
rs1294617098 154 dbSNP
rs1259224393 160 dbSNP
rs926315194 162 dbSNP
rs981985016 164 dbSNP
rs1245564941 170 dbSNP
rs1443359163 171 dbSNP
rs368030038 174 dbSNP
rs1385991559 175 dbSNP
rs919055197 176 dbSNP
rs771317023 178 dbSNP
rs559611402 181 dbSNP
rs1393417153 193 dbSNP
rs1387434901 200 dbSNP
rs1049355613 207 dbSNP
rs1352064254 214 dbSNP
rs929179141 218 dbSNP
rs1308460505 219 dbSNP
rs919163323 230 dbSNP
rs1016963439 232 dbSNP
rs552222344 237 dbSNP
rs976003338 241 dbSNP
rs182465488 247 dbSNP
rs566089567 250 dbSNP
rs1028284292 255 dbSNP
rs1208920477 256 dbSNP
rs35000204 267 dbSNP
rs1188705033 285 dbSNP
rs1362766828 287 dbSNP
rs151238794 289 dbSNP
rs1460241646 302 dbSNP
rs901440016 306 dbSNP
rs957440720 307 dbSNP
rs1418947879 311 dbSNP
rs1252966432 316 dbSNP
rs189817236 317 dbSNP
rs1033123841 318 dbSNP
rs1175951884 324 dbSNP
rs1405160032 328 dbSNP
rs1468036964 329 dbSNP
rs1338376900 331 dbSNP
rs114269062 332 dbSNP
rs1489971469 334 dbSNP
rs778394813 335 dbSNP
rs541633653 342 dbSNP
rs866753934 353 dbSNP
rs1336985530 354 dbSNP
rs187751756 356 dbSNP
rs1241425634 357 dbSNP
rs1330031732 360 dbSNP
rs1014476575 362 dbSNP
rs115247793 366 dbSNP
rs538994259 376 dbSNP
rs1480609111 378 dbSNP
rs1001898556 380 dbSNP
rs1252808969 386 dbSNP
rs887504780 392 dbSNP
rs1325425679 395 dbSNP
rs1387345735 396 dbSNP
rs1383582346 400 dbSNP
rs1199049729 403 dbSNP
rs754567753 407 dbSNP
rs1481510861 408 dbSNP
rs1458382070 409 dbSNP
rs1177996843 425 dbSNP
rs949302072 433 dbSNP
rs538092725 435 dbSNP
rs146405932 437 dbSNP
rs972422746 442 dbSNP
rs556581310 447 dbSNP
rs536699946 450 dbSNP
rs897621992 455 dbSNP
rs1343279831 457 dbSNP
rs1040183727 462 dbSNP
rs1200196024 467 dbSNP
rs866277428 469 dbSNP
rs984132821 483 dbSNP
rs1446982057 504 dbSNP
rs954138356 506 dbSNP
rs944600445 528 dbSNP
rs575789943 534 dbSNP
rs976798299 537 dbSNP
rs910499237 541 dbSNP
rs1050369386 549 dbSNP
rs1191962827 552 dbSNP
rs936057890 556 dbSNP
rs926025464 557 dbSNP
rs567835738 558 dbSNP
rs977499148 560 dbSNP
rs142355774 561 dbSNP
rs1276443552 566 dbSNP
rs534800694 567 dbSNP
rs1001923411 572 dbSNP
rs917402051 574 dbSNP
rs1293736766 581 dbSNP
rs1361776280 582 dbSNP
rs868827887 588 dbSNP
rs559144853 589 dbSNP
rs530745643 590 dbSNP
rs1298114477 596 dbSNP
rs1325738095 600 dbSNP
rs958928925 602 dbSNP
rs183943119 608 dbSNP
rs897522568 609 dbSNP
rs76814701 611 dbSNP
rs1467969772 612 dbSNP
rs941957269 613 dbSNP
rs909018003 614 dbSNP
rs1249621025 616 dbSNP
rs1475308707 618 dbSNP
rs1212208416 622 dbSNP
rs951777641 626 dbSNP
rs532343123 627 dbSNP
rs1164782525 628 dbSNP
rs186768006 633 dbSNP
rs769894294 639 dbSNP
rs550203824 643 dbSNP
rs1191066354 650 dbSNP
rs547903289 655 dbSNP
rs993221086 657 dbSNP
rs921330555 664 dbSNP
rs897586684 667 dbSNP
rs1361767461 671 dbSNP
rs1228968862 674 dbSNP
rs147689040 690 dbSNP
rs1315385385 691 dbSNP
rs561383255 693 dbSNP
rs1008710041 698 dbSNP
rs889029642 699 dbSNP
rs988374877 700 dbSNP
rs541204039 701 dbSNP
rs183196074 703 dbSNP
rs1406563357 705 dbSNP
rs1398637843 706 dbSNP
rs538745307 710 dbSNP
rs565388058 710 dbSNP
rs1469609418 715 dbSNP
rs1335062788 719 dbSNP
rs1002353487 720 dbSNP
rs1449346493 723 dbSNP
rs1279077220 727 dbSNP
rs1338513393 729 dbSNP
rs969571414 730 dbSNP
rs1289212129 731 dbSNP
rs1323014760 736 dbSNP
rs1295240024 739 dbSNP
rs1260965540 749 dbSNP
rs190577005 752 dbSNP
rs925939617 755 dbSNP
rs1210694236 772 dbSNP
rs866866578 776 dbSNP
rs1365286614 783 dbSNP
rs11939884 784 dbSNP
rs946125683 792 dbSNP
rs1449862210 793 dbSNP
rs917365889 796 dbSNP
rs4148312 801 dbSNP
rs1409689683 802 dbSNP
rs1036447390 804 dbSNP
rs546638333 805 dbSNP
rs185812401 811 dbSNP
rs1352903480 813 dbSNP
rs927520669 815 dbSNP
rs1171025357 816 dbSNP
rs1288999985 817 dbSNP
rs1345136728 820 dbSNP
rs1221876275 822 dbSNP
rs1272904041 827 dbSNP
rs984354811 831 dbSNP
rs953078218 841 dbSNP
rs549237261 848 dbSNP
rs1272199750 854 dbSNP
rs1310773976 855 dbSNP
rs1430990638 858 dbSNP
rs757052507 859 dbSNP
rs751488861 860 dbSNP
rs1181783948 868 dbSNP
rs145487721 869 dbSNP
rs961804323 887 dbSNP
rs1308253376 890 dbSNP
rs1478557934 891 dbSNP
rs1167630746 892 dbSNP
rs1018690177 896 dbSNP
rs1418005929 904 dbSNP
rs1432111543 910 dbSNP
rs1308743700 918 dbSNP
rs543997228 920 dbSNP
rs1041096716 923 dbSNP
rs1181379324 924 dbSNP
rs1403394074 927 dbSNP
rs1437004353 933 dbSNP
rs763975351 937 dbSNP
rs913874438 938 dbSNP
rs1207175162 940 dbSNP
rs1269320569 952 dbSNP
rs373382650 956 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 574537.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000457664.2 | 3UTR | AAGAUUUGGGUACUGUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055374 PDCD4 programmed cell death 4 2 4
MIRT378341 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT444668 CDKL2 cyclin dependent kinase like 2 2 2
MIRT446953 CD248 CD248 molecule 2 2
MIRT460332 CAMK4 calcium/calmodulin dependent protein kinase IV 2 6
MIRT464078 VPS4A vacuolar protein sorting 4 homolog A 2 2
MIRT464586 UBN2 ubinuclein 2 2 2
MIRT468482 SESN3 sestrin 3 2 2
MIRT468962 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT475455 HSPA8 heat shock protein family A (Hsp70) member 8 2 2
MIRT482403 ADRB1 adrenoceptor beta 1 2 10
MIRT486992 ZFAND2B zinc finger AN1-type containing 2B 2 2
MIRT489397 TUBB2A tubulin beta 2A class IIa 2 2
MIRT526319 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526560 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT526732 ZNF138 zinc finger protein 138 2 8
MIRT531581 STXBP5L syntaxin binding protein 5 like 2 2
MIRT532011 NOX5 NADPH oxidase 5 2 2
MIRT533407 TXLNG taxilin gamma 2 2
MIRT533436 TRPC5 transient receptor potential cation channel subfamily C member 5 2 2
MIRT533866 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT539254 ANKRD50 ankyrin repeat domain 50 2 2
MIRT541451 C15orf48 chromosome 15 open reading frame 48 2 2
MIRT566794 MIER3 MIER family member 3 2 2
MIRT569294 SURF6 surfeit 6 2 2
MIRT571336 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT572802 PPP3CB protein phosphatase 3 catalytic subunit beta 2 2
MIRT572813 MYO1C myosin IC 2 2
MIRT574219 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT607259 GRAMD1B GRAM domain containing 1B 2 4
MIRT609307 CHD4 chromodomain helicase DNA binding protein 4 2 2
MIRT615459 REPS1 RALBP1 associated Eps domain containing 1 2 2
MIRT616861 RPLP1 ribosomal protein lateral stalk subunit P1 2 2
MIRT619415 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT619652 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT625325 TNFRSF13B TNF receptor superfamily member 13B 2 2
MIRT638980 ARFIP2 ADP ribosylation factor interacting protein 2 2 2
MIRT639458 ZNF429 zinc finger protein 429 2 2
MIRT640550 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT641473 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT642720 ATXN3 ataxin 3 2 2
MIRT643048 SMN1 survival of motor neuron 1, telomeric 2 2
MIRT644921 SMN2 survival of motor neuron 2, centromeric 2 2
MIRT645875 ZNF275 zinc finger protein 275 2 2
MIRT649824 LIPG lipase G, endothelial type 2 2
MIRT649851 GYS2 glycogen synthase 2 2 2
MIRT649972 TRAFD1 TRAF-type zinc finger domain containing 1 2 2
MIRT650675 ZNF259 ZPR1 zinc finger 1 1
MIRT651319 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT652876 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT652881 SYVN1 synoviolin 1 2 2
MIRT654144 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT657080 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT657181 INO80C INO80 complex subunit C 2 2
MIRT657830 GJD3 gap junction protein delta 3 2 2
MIRT657897 GDF7 growth differentiation factor 7 2 2
MIRT659631 CDKN2AIP CDKN2A interacting protein 2 2
MIRT663115 SPTA1 spectrin alpha, erythrocytic 1 2 2
MIRT664739 METTL16 methyltransferase like 16 2 2
MIRT667551 LRAT lecithin retinol acyltransferase 2 2
MIRT668552 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT682893 XIAP X-linked inhibitor of apoptosis 2 2
MIRT683092 PRRG4 proline rich and Gla domain 4 2 2
MIRT683102 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT697648 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT709158 ZNF419 zinc finger protein 419 2 2
MIRT713220 RCAN2 regulator of calcineurin 2 2 2
MIRT713277 LAIR1 leukocyte associated immunoglobulin like receptor 1 2 2
MIRT715008 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT715051 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT715696 PNMAL2 paraneoplastic Ma antigen family member 8B 2 2
MIRT717250 TMEM246 transmembrane protein 246 2 2
MIRT717322 PGK1 phosphoglycerate kinase 1 2 2
MIRT717587 MTHFD1L methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like 2 2
MIRT718122 CHST4 carbohydrate sulfotransferase 4 2 2
MIRT718418 CALN1 calneuron 1 2 2
MIRT718750 ZNF490 zinc finger protein 490 2 2
MIRT720048 PPP1R3F protein phosphatase 1 regulatory subunit 3F 2 2
MIRT721497 THRB thyroid hormone receptor beta 2 2
MIRT722531 EPRS glutamyl-prolyl-tRNA synthetase 2 2
MIRT723279 KRTAP21-2 keratin associated protein 21-2 2 2
MIRT724813 MSX2 msh homeobox 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6509-3p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-6509-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-6509-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6509-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6509-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission