miRTarBase - #MIRT526652


—
pre-miRNA Information
pre-miRNA hsa-mir-7110   
Genomic Coordinates chr3: 123161794 - 123161879
Description Homo sapiens miR-7110 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-7110-3p
Sequence 65| UCUCUCUCCCACUUCCCUGCAG |86
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30629632 7 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs933023636 4 dbSNP
rs529799363 6 dbSNP
rs57948168 7 dbSNP
rs1172032316 9 dbSNP
rs566496167 10 dbSNP
rs903348975 11 dbSNP
rs532110591 12 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C17orf105   
Synonyms -
Description chromosome 17 open reading frame 105
Transcript NM_001136483   
Expression
Putative miRNA Targets on C17orf105
3'UTR of C17orf105
(miRNA target sites are highlighted)		 
>C17orf105|NM_001136483|3'UTR
   1 GTTACTCACCATGGAAAAGATACAAGAGAAGGCCCTAGGATTTCTTGGCTGCTCAGGATCTCAAGACACTCCCGACTGGC
  81 TGAATGCTCCATCTTCAGATGCTTCAATAAAGCTTGGAACATAAAATGCGTAAGTTACATTTAGGGGACCCAAAGGCTTT
 161 ATGTTCTCATTCCAAAATGGGGCAGGCAGAAGGAAAGATGCAATGAGCATTTTTATTTGGGGCTATGAAAAGAAGTTTTA
 241 ACGAGAGAGAGAGAGAGAAATCTGAGAGAACTCTTTAAAACATACACCATCATCACCATCCCGTGGAAGAAGAAAAGCTG
 321 GGGTGAGATCATCCAGCCACAAGTACAGCACTGTCAAAATGGAAAACGAAATCACATGACAACATCAAGGTTCAGAAAAC
 401 ACAAGGAACAAATGCCATTAGTTCCTCTGTGAATACACACGATCG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacgUCCCUUCACCCUCUCUCu 5'
              | | :|| | ||||||| 
Target 5' tttaACGAGAGAGAGAGAGAGa 3'
 237 - 258 154.00 -13.60
2 
miRNA  3' gaCGUCCCUUCACCCUCUCUCu 5'
            | ||  |||  ||:| ||| 
Target 5' aaGAAGAAAAGCTGGGGTGAGa 3'
 307 - 328 112.00 -12.90
3 
miRNA  3' gaCGUCCCUUCACCCUCUCUcu 5'
            ||| || ||  ||| |||  
Target 5' ggGCA-GGCAGAAGGAAAGAtg 3'
 180 - 200 111.00 -13.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN15667632 71 COSMIC
COSN15359197 221 COSMIC
COSN7435764 462 COSMIC
COSN23124500 747 COSMIC
COSN16845448 1026 COSMIC
COSN29810163 1132 COSMIC
COSN24518373 1147 COSMIC
COSN16783710 1169 COSMIC
COSN32012180 1370 COSMIC
COSN29742848 1409 COSMIC
COSN24869109 1463 COSMIC
COSN18759845 1549 COSMIC
COSN23672159 1594 COSMIC
COSN14858321 1786 COSMIC
COSN26330010 2187 COSMIC
COSN8836968 2199 COSMIC
COSN23742454 2383 COSMIC
COSN15017687 2581 COSMIC
COSN17764408 2937 COSMIC
COSN27250519 3090 COSMIC
COSN27297372 3090 COSMIC
COSN27582663 3090 COSMIC
COSN21556042 3108 COSMIC
COSN23027255 3235 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1052935707 1 dbSNP
rs1263133286 4 dbSNP
rs148379784 5 dbSNP
rs998098025 6 dbSNP
rs567974747 10 dbSNP
rs754999825 14 dbSNP
rs756060150 18 dbSNP
rs1437600615 21 dbSNP
rs766347147 27 dbSNP
rs1164192424 28 dbSNP
rs753808914 30 dbSNP
rs1425508553 33 dbSNP
rs1164218249 35 dbSNP
rs1005180822 50 dbSNP
rs1468810460 52 dbSNP
rs1047620613 58 dbSNP
rs1483399507 71 dbSNP
rs1016617831 72 dbSNP
rs1219572950 78 dbSNP
rs571483985 79 dbSNP
rs1453539690 84 dbSNP
rs961124910 97 dbSNP
rs55705160 98 dbSNP
rs1328248998 100 dbSNP
rs1286342907 102 dbSNP
rs1244535005 107 dbSNP
rs1024947622 113 dbSNP
rs1273722221 114 dbSNP
rs1433758253 118 dbSNP
rs919421470 119 dbSNP
rs960520256 120 dbSNP
rs1413684770 129 dbSNP
rs1471832104 131 dbSNP
rs905195867 138 dbSNP
rs753173018 139 dbSNP
rs556906600 145 dbSNP
rs1161918007 146 dbSNP
rs1419225573 150 dbSNP
rs1473211874 151 dbSNP
rs758357257 160 dbSNP
rs758812039 161 dbSNP
rs1479077026 163 dbSNP
rs1349408241 173 dbSNP
rs1247461429 175 dbSNP
rs781246684 177 dbSNP
rs1464221908 180 dbSNP
rs1310109800 185 dbSNP
rs115014002 187 dbSNP
rs1317444446 195 dbSNP
rs538394349 205 dbSNP
rs1277876761 213 dbSNP
rs1021096280 221 dbSNP
rs934745737 221 dbSNP
rs865932023 229 dbSNP
rs1356776191 235 dbSNP
rs1363396273 244 dbSNP
rs778100538 250 dbSNP
rs1458134426 258 dbSNP
rs987188987 262 dbSNP
rs553810813 264 dbSNP
rs571979293 268 dbSNP
rs1174601680 275 dbSNP
rs1416205717 276 dbSNP
rs1314332114 277 dbSNP
rs1425969575 291 dbSNP
rs1287605583 297 dbSNP
rs943044226 301 dbSNP
rs536259146 312 dbSNP
rs973510891 313 dbSNP
rs1250211132 316 dbSNP
rs1320645223 321 dbSNP
rs998463656 326 dbSNP
rs920508761 336 dbSNP
rs1049588677 360 dbSNP
rs554238948 370 dbSNP
rs929234257 372 dbSNP
rs889673209 374 dbSNP
rs1313372409 377 dbSNP
rs1047568884 380 dbSNP
rs1227105317 382 dbSNP
rs1280436561 382 dbSNP
rs576288109 386 dbSNP
rs1299429215 388 dbSNP
rs115872287 390 dbSNP
rs1180989384 394 dbSNP
rs1301535842 421 dbSNP
rs7215012 424 dbSNP
rs993925881 428 dbSNP
rs905311119 429 dbSNP
rs1427954410 434 dbSNP
rs769464839 440 dbSNP
rs755663729 443 dbSNP
rs1456662991 445 dbSNP
rs1169487382 452 dbSNP
rs1428848728 453 dbSNP
rs1032780509 456 dbSNP
rs960490733 457 dbSNP
rs992923191 459 dbSNP
rs916095695 460 dbSNP
rs577107912 465 dbSNP
rs1258218303 472 dbSNP
rs1203785454 475 dbSNP
rs1481800702 476 dbSNP
rs970262624 481 dbSNP
rs979008640 484 dbSNP
rs925965647 494 dbSNP
rs1321441418 499 dbSNP
rs1429420146 501 dbSNP
rs934690899 507 dbSNP
rs779636779 508 dbSNP
rs545544191 511 dbSNP
rs922636267 520 dbSNP
rs1408020464 521 dbSNP
rs894032831 522 dbSNP
rs560653340 526 dbSNP
rs1282379497 530 dbSNP
rs1049561151 539 dbSNP
rs748898610 541 dbSNP
rs555081425 543 dbSNP
rs1425375094 556 dbSNP
rs527758132 564 dbSNP
rs754478913 569 dbSNP
rs1021044094 581 dbSNP
rs1228513587 596 dbSNP
rs1471286151 597 dbSNP
rs1038330709 604 dbSNP
rs896817416 614 dbSNP
rs779284614 619 dbSNP
rs543014121 620 dbSNP
rs73985105 629 dbSNP
rs1017298833 630 dbSNP
rs1278860528 636 dbSNP
rs964844565 640 dbSNP
rs1227093438 646 dbSNP
rs1352348398 653 dbSNP
rs1307779827 657 dbSNP
rs973071488 664 dbSNP
rs1388806901 681 dbSNP
rs74371596 686 dbSNP
rs929207342 694 dbSNP
rs1237417545 707 dbSNP
rs1023072632 710 dbSNP
rs1475996032 712 dbSNP
rs1414185202 715 dbSNP
rs983372590 716 dbSNP
rs746273719 719 dbSNP
rs1033717046 732 dbSNP
rs1264762130 732 dbSNP
rs1267903250 732 dbSNP
rs137968559 732 dbSNP
rs762446575 732 dbSNP
rs978974193 732 dbSNP
rs1388476340 733 dbSNP
rs1331834344 735 dbSNP
rs1261864808 744 dbSNP
rs550059798 747 dbSNP
rs949856479 749 dbSNP
rs574959045 750 dbSNP
rs1044281042 752 dbSNP
rs748081458 766 dbSNP
rs1404558521 772 dbSNP
rs905258351 782 dbSNP
rs1319642821 792 dbSNP
rs141559382 793 dbSNP
rs1387022389 798 dbSNP
rs1001251253 799 dbSNP
rs1465071872 805 dbSNP
rs1375431177 807 dbSNP
rs75436311 813 dbSNP
rs117962974 815 dbSNP
rs1247100576 827 dbSNP
rs1187032435 834 dbSNP
rs565790204 853 dbSNP
rs1262997407 857 dbSNP
rs535919927 858 dbSNP
rs1299693429 866 dbSNP
rs911044918 870 dbSNP
rs941214873 897 dbSNP
rs1009735554 900 dbSNP
rs1038209776 907 dbSNP
rs1328009028 915 dbSNP
rs897029937 916 dbSNP
rs1395394664 917 dbSNP
rs1042614993 918 dbSNP
rs890739808 928 dbSNP
rs1314171364 930 dbSNP
rs1434840943 931 dbSNP
rs572829844 934 dbSNP
rs1009006134 935 dbSNP
rs1476556522 940 dbSNP
rs1374007312 945 dbSNP
rs1187356689 947 dbSNP
rs771014191 955 dbSNP
rs1441190101 962 dbSNP
rs964465938 963 dbSNP
rs554556537 970 dbSNP
rs1346606134 975 dbSNP
rs929923925 977 dbSNP
rs1272709691 987 dbSNP
rs569656302 992 dbSNP
rs187741616 1013 dbSNP
rs368384439 1016 dbSNP
rs34814687 1017 dbSNP
rs1338593580 1021 dbSNP
rs116541278 1024 dbSNP
rs78364015 1026 dbSNP
rs41455049 1031 dbSNP
rs572514175 1041 dbSNP
rs1163010218 1042 dbSNP
rs927131353 1043 dbSNP
rs1379598778 1050 dbSNP
rs372615811 1052 dbSNP
rs938075389 1058 dbSNP
rs1189313978 1067 dbSNP
rs989095229 1072 dbSNP
rs542746731 1073 dbSNP
rs1207451449 1075 dbSNP
rs915365151 1076 dbSNP
rs1289480573 1084 dbSNP
rs1424247026 1085 dbSNP
rs1457553169 1102 dbSNP
rs538816177 1108 dbSNP
rs112634663 1110 dbSNP
rs1166207561 1110 dbSNP
rs1354020984 1110 dbSNP
rs1397153162 1110 dbSNP
rs1403918248 1110 dbSNP
rs144276030 1110 dbSNP
rs545561689 1110 dbSNP
rs985534051 1110 dbSNP
rs1322493080 1111 dbSNP
rs1386311842 1113 dbSNP
rs1457161155 1114 dbSNP
rs1433716387 1120 dbSNP
rs1323581159 1122 dbSNP
rs1332307615 1124 dbSNP
rs1042397812 1125 dbSNP
rs1230693105 1127 dbSNP
rs1178990198 1128 dbSNP
rs1470581102 1129 dbSNP
rs1197063678 1132 dbSNP
rs1246292914 1132 dbSNP
rs1274798611 1134 dbSNP
rs62078651 1134 dbSNP
rs769030844 1139 dbSNP
rs1328351997 1142 dbSNP
rs546067510 1143 dbSNP
rs1224921480 1145 dbSNP
rs1273815182 1147 dbSNP
rs890687630 1147 dbSNP
rs974284796 1150 dbSNP
rs1372792019 1152 dbSNP
rs1161939806 1154 dbSNP
rs1466871788 1154 dbSNP
rs57998013 1154 dbSNP
rs762276596 1154 dbSNP
rs771354077 1154 dbSNP
rs531577812 1159 dbSNP
rs929866622 1162 dbSNP
rs1039170553 1164 dbSNP
rs397944365 1167 dbSNP
rs1056414467 1169 dbSNP
rs1194008940 1169 dbSNP
rs1253912957 1169 dbSNP
rs1455743289 1169 dbSNP
rs1240246150 1171 dbSNP
rs75723816 1173 dbSNP
rs1464790768 1177 dbSNP
rs1316931679 1210 dbSNP
rs995058410 1214 dbSNP
rs1027809683 1216 dbSNP
rs1210942074 1219 dbSNP
rs950476467 1232 dbSNP
rs1004534527 1236 dbSNP
rs1023996943 1251 dbSNP
rs1231522964 1252 dbSNP
rs1449903653 1258 dbSNP
rs1349558534 1263 dbSNP
rs971273658 1275 dbSNP
rs763448139 1276 dbSNP
rs867028132 1285 dbSNP
rs1363502711 1291 dbSNP
rs980433889 1311 dbSNP
rs565251871 1312 dbSNP
rs1359164041 1329 dbSNP
rs547950858 1342 dbSNP
rs1436717467 1348 dbSNP
rs1395870617 1353 dbSNP
rs1168235089 1356 dbSNP
rs990030484 1362 dbSNP
rs1472813488 1363 dbSNP
rs903576639 1365 dbSNP
rs1409679568 1367 dbSNP
rs760102260 1371 dbSNP
rs1163768154 1373 dbSNP
rs915296603 1374 dbSNP
rs1392308487 1383 dbSNP
rs945485677 1395 dbSNP
rs547972450 1397 dbSNP
rs911902272 1399 dbSNP
rs944922402 1402 dbSNP
rs12601060 1403 dbSNP
rs1486378797 1408 dbSNP
rs900787755 1408 dbSNP
rs891986709 1409 dbSNP
rs1204006109 1410 dbSNP
rs930794141 1415 dbSNP
rs139270720 1418 dbSNP
rs1215565776 1423 dbSNP
rs886167881 1424 dbSNP
rs192735557 1441 dbSNP
rs1416659041 1442 dbSNP
rs1023942870 1459 dbSNP
rs962764427 1462 dbSNP
rs1428055379 1468 dbSNP
rs1356559804 1470 dbSNP
rs1172223362 1475 dbSNP
rs1428947405 1481 dbSNP
rs1412914802 1483 dbSNP
rs12601085 1498 dbSNP
rs537026677 1499 dbSNP
rs1475862986 1502 dbSNP
rs558561733 1507 dbSNP
rs1257616145 1519 dbSNP
rs1203889120 1530 dbSNP
rs1479436264 1531 dbSNP
rs1235696541 1532 dbSNP
rs1252754058 1532 dbSNP
rs1271751552 1532 dbSNP
rs35586550 1532 dbSNP
rs35787597 1532 dbSNP
rs397858023 1532 dbSNP
rs1354358969 1533 dbSNP
rs918405436 1535 dbSNP
rs570765292 1536 dbSNP
rs1389782443 1549 dbSNP
rs1252817614 1550 dbSNP
rs1484124946 1551 dbSNP
rs1180273053 1558 dbSNP
rs1034670231 1570 dbSNP
rs534575910 1571 dbSNP
rs1162632103 1579 dbSNP
rs868491680 1586 dbSNP
rs1180798581 1587 dbSNP
rs1020092147 1593 dbSNP
rs966732597 1594 dbSNP
rs755088003 1595 dbSNP
rs1488328594 1596 dbSNP
rs1251512371 1597 dbSNP
rs1455964382 1601 dbSNP
rs553175903 1613 dbSNP
rs912018569 1618 dbSNP
rs944699523 1619 dbSNP
rs974800258 1620 dbSNP
rs922159423 1623 dbSNP
rs376659418 1635 dbSNP
rs1162307148 1636 dbSNP
rs574543395 1638 dbSNP
rs1049667780 1640 dbSNP
rs886613222 1659 dbSNP
rs1307889892 1666 dbSNP
rs1431319380 1667 dbSNP
rs940381882 1669 dbSNP
rs536781586 1675 dbSNP
rs906985034 1677 dbSNP
rs554629611 1681 dbSNP
rs753503616 1682 dbSNP
rs1442895327 1689 dbSNP
rs1339155071 1690 dbSNP
rs754588326 1699 dbSNP
rs893017687 1716 dbSNP
rs1450917272 1717 dbSNP
rs1344406034 1721 dbSNP
rs1203331081 1730 dbSNP
rs947979434 1734 dbSNP
rs1432234876 1735 dbSNP
rs1274163314 1740 dbSNP
rs1480202287 1755 dbSNP
rs576092366 1757 dbSNP
rs986753916 1762 dbSNP
rs1195865341 1767 dbSNP
rs1044680182 1770 dbSNP
rs912526928 1771 dbSNP
rs1020038124 1773 dbSNP
rs543432299 1774 dbSNP
rs1421929083 1777 dbSNP
rs564888566 1778 dbSNP
rs1390291888 1782 dbSNP
rs781251408 1783 dbSNP
rs577474618 1789 dbSNP
rs1236173971 1790 dbSNP
rs986632722 1809 dbSNP
rs1317484734 1810 dbSNP
rs541348894 1811 dbSNP
rs1387138264 1817 dbSNP
rs1288915911 1819 dbSNP
rs1018975072 1822 dbSNP
rs1392821142 1823 dbSNP
rs778560011 1826 dbSNP
rs559940982 1827 dbSNP
rs748098394 1828 dbSNP
rs758357029 1831 dbSNP
rs530208186 1832 dbSNP
rs1304897641 1837 dbSNP
rs548298388 1840 dbSNP
rs1263095985 1843 dbSNP
rs891355058 1851 dbSNP
rs921970560 1854 dbSNP
rs777735459 1867 dbSNP
rs1396032025 1886 dbSNP
rs1484749351 1890 dbSNP
rs1282655175 1895 dbSNP
rs985042707 1897 dbSNP
rs1007167195 1903 dbSNP
rs147284628 1905 dbSNP
rs1225014377 1906 dbSNP
rs748031944 1906 dbSNP
rs1296238849 1907 dbSNP
rs1413591866 1910 dbSNP
rs1373102541 1912 dbSNP
rs940831960 1922 dbSNP
rs1226212288 1924 dbSNP
rs1045958215 1927 dbSNP
rs928353518 1928 dbSNP
rs1297189048 1939 dbSNP
rs1314271945 1941 dbSNP
rs995990038 1942 dbSNP
rs1395411126 1944 dbSNP
rs547078189 1958 dbSNP
rs1210577358 1968 dbSNP
rs1055838114 1983 dbSNP
rs570426333 1992 dbSNP
rs991970213 1993 dbSNP
rs1024774466 2012 dbSNP
rs969252132 2014 dbSNP
rs1188827380 2015 dbSNP
rs1482831936 2023 dbSNP
rs892807380 2025 dbSNP
rs539006257 2026 dbSNP
rs552213763 2038 dbSNP
rs1341251961 2042 dbSNP
rs1251752661 2047 dbSNP
rs1041610629 2051 dbSNP
rs1353552178 2064 dbSNP
rs1294591599 2067 dbSNP
rs1414912462 2079 dbSNP
rs1418366242 2080 dbSNP
rs570456620 2081 dbSNP
rs936383076 2095 dbSNP
rs1326480205 2110 dbSNP
rs1433467672 2116 dbSNP
rs988292248 2123 dbSNP
rs1164726955 2127 dbSNP
rs1007997077 2128 dbSNP
rs913617778 2134 dbSNP
rs933079570 2141 dbSNP
rs1051242396 2147 dbSNP
rs559190861 2150 dbSNP
rs1439282989 2153 dbSNP
rs1212909800 2154 dbSNP
rs942919375 2154 dbSNP
rs140766602 2156 dbSNP
rs996284120 2160 dbSNP
rs1275027335 2182 dbSNP
rs1029369024 2183 dbSNP
rs546556964 2192 dbSNP
rs898489819 2198 dbSNP
rs984823668 2205 dbSNP
rs1336048277 2213 dbSNP
rs1325608217 2215 dbSNP
rs908111388 2219 dbSNP
rs1299436129 2232 dbSNP
rs1026071159 2233 dbSNP
rs962309671 2243 dbSNP
rs981582334 2267 dbSNP
rs564134222 2272 dbSNP
rs569503695 2272 dbSNP
rs1310236830 2280 dbSNP
rs1160431131 2296 dbSNP
rs1470633785 2303 dbSNP
rs1394750524 2312 dbSNP
rs568281062 2330 dbSNP
rs969221847 2333 dbSNP
rs1254740748 2339 dbSNP
rs1268695750 2340 dbSNP
rs535307605 2348 dbSNP
rs1206726144 2356 dbSNP
rs1281517882 2362 dbSNP
rs1032258828 2364 dbSNP
rs1350912117 2367 dbSNP
rs1055547789 2371 dbSNP
rs958196814 2399 dbSNP
rs1192620142 2406 dbSNP
rs769930241 2412 dbSNP
rs1373656688 2413 dbSNP
rs556708786 2414 dbSNP
rs947043240 2429 dbSNP
rs1344018004 2440 dbSNP
rs570834167 2441 dbSNP
rs1401409746 2443 dbSNP
rs1375022444 2447 dbSNP
rs749043064 2449 dbSNP
rs775483831 2450 dbSNP
rs913578101 2458 dbSNP
rs1456171296 2461 dbSNP
rs1191624041 2462 dbSNP
rs942787767 2464 dbSNP
rs1475023880 2470 dbSNP
rs1240331904 2484 dbSNP
rs1217244386 2491 dbSNP
rs1488347196 2506 dbSNP
rs933066818 2509 dbSNP
rs987250604 2525 dbSNP
rs1159015646 2530 dbSNP
rs1349677250 2534 dbSNP
rs903084852 2536 dbSNP
rs1008112958 2542 dbSNP
rs942886643 2544 dbSNP
rs114803856 2552 dbSNP
rs1438639528 2556 dbSNP
rs1292030458 2561 dbSNP
rs931568046 2566 dbSNP
rs1345042495 2567 dbSNP
rs899666610 2574 dbSNP
rs997121767 2576 dbSNP
rs7213802 2580 dbSNP
rs1176489493 2581 dbSNP
rs1409175521 2592 dbSNP
rs1330941663 2599 dbSNP
rs952256121 2620 dbSNP
rs1188213613 2622 dbSNP
rs764543872 2630 dbSNP
rs1006204786 2633 dbSNP
rs1256181842 2645 dbSNP
rs1185251805 2659 dbSNP
rs1321818102 2661 dbSNP
rs1486431896 2664 dbSNP
rs1223076897 2666 dbSNP
rs144419704 2675 dbSNP
rs1306158463 2681 dbSNP
rs1275651339 2684 dbSNP
rs1490069101 2684 dbSNP
rs1355456353 2685 dbSNP
rs905032606 2690 dbSNP
rs962258830 2691 dbSNP
rs981697037 2698 dbSNP
rs928922292 2699 dbSNP
rs1177156623 2705 dbSNP
rs1415103743 2710 dbSNP
rs957957747 2712 dbSNP
rs1168159478 2719 dbSNP
rs138113656 2726 dbSNP
rs1009922541 2733 dbSNP
rs142639187 2733 dbSNP
rs958895203 2736 dbSNP
rs954396617 2737 dbSNP
rs1365022644 2755 dbSNP
rs1256374403 2758 dbSNP
rs9899746 2759 dbSNP
rs910266119 2761 dbSNP
rs1234956875 2769 dbSNP
rs964466766 2784 dbSNP
rs1199704106 2794 dbSNP
rs574997400 2799 dbSNP
rs1334739960 2806 dbSNP
rs947159372 2810 dbSNP
rs559778054 2823 dbSNP
rs575041419 2825 dbSNP
rs542446512 2828 dbSNP
rs1322406734 2831 dbSNP
rs977030176 2833 dbSNP
rs1352155779 2834 dbSNP
rs1222272944 2836 dbSNP
rs879003127 2836 dbSNP
rs148487685 2847 dbSNP
rs530666345 2853 dbSNP
rs924290407 2854 dbSNP
rs1333085879 2856 dbSNP
rs552301061 2870 dbSNP
rs568195315 2871 dbSNP
rs540676848 2879 dbSNP
rs553917395 2880 dbSNP
rs1229555187 2883 dbSNP
rs1368525906 2884 dbSNP
rs376668144 2887 dbSNP
rs1416904081 2889 dbSNP
rs932486777 2890 dbSNP
rs1179594820 2894 dbSNP
rs949425295 2902 dbSNP
rs546542945 2910 dbSNP
rs1251601863 2914 dbSNP
rs905252002 2925 dbSNP
rs1489128943 2930 dbSNP
rs1260219918 2937 dbSNP
rs76458117 2938 dbSNP
rs1482295190 2940 dbSNP
rs767906674 2941 dbSNP
rs142720395 2956 dbSNP
rs753497114 2958 dbSNP
rs897831004 2960 dbSNP
rs1002910075 2965 dbSNP
rs1474092077 2967 dbSNP
rs893660481 2969 dbSNP
rs1301088167 2973 dbSNP
rs1388441941 2976 dbSNP
rs12602800 2977 dbSNP
rs73985106 2978 dbSNP
rs1451020667 2981 dbSNP
rs991648407 2983 dbSNP
rs1158876220 2990 dbSNP
rs1454060454 2991 dbSNP
rs568702441 2992 dbSNP
rs1008536034 2993 dbSNP
rs1408005589 2997 dbSNP
rs1327875245 3016 dbSNP
rs1434230493 3017 dbSNP
rs1359516310 3020 dbSNP
rs1450210047 3022 dbSNP
rs1203416305 3027 dbSNP
rs1312796665 3029 dbSNP
rs1017291982 3033 dbSNP
rs1286927221 3034 dbSNP
rs1210456445 3043 dbSNP
rs1346071295 3048 dbSNP
rs1381431299 3057 dbSNP
rs112085164 3063 dbSNP
rs1191670457 3063 dbSNP
rs144506245 3063 dbSNP
rs540398855 3063 dbSNP
rs1263984033 3069 dbSNP
rs1430324189 3069 dbSNP
rs964431177 3071 dbSNP
rs1228437716 3076 dbSNP
rs973582851 3076 dbSNP
rs1022226685 3078 dbSNP
rs1201923196 3079 dbSNP
rs968407341 3079 dbSNP
rs977144884 3086 dbSNP
rs548081491 3099 dbSNP
rs764850865 3102 dbSNP
rs943697832 3103 dbSNP
rs1279863273 3105 dbSNP
rs953025756 3109 dbSNP
rs1225132707 3114 dbSNP
rs1319998583 3120 dbSNP
rs1278246979 3127 dbSNP
rs796609922 3134 dbSNP
rs976851393 3137 dbSNP
rs558602249 3138 dbSNP
rs932579044 3148 dbSNP
rs908748831 3150 dbSNP
rs1396246905 3151 dbSNP
rs1166579381 3155 dbSNP
rs1467615073 3161 dbSNP
rs949645305 3164 dbSNP
rs1048196867 3165 dbSNP
rs752208702 3168 dbSNP
rs570856564 3173 dbSNP
rs1036441965 3175 dbSNP
rs1188518878 3176 dbSNP
rs534722202 3178 dbSNP
rs1002858277 3179 dbSNP
rs545806675 3180 dbSNP
rs1388565690 3196 dbSNP
rs1459018886 3201 dbSNP
rs1475244084 3201 dbSNP
rs1036119344 3209 dbSNP
rs1232112230 3215 dbSNP
rs1332040766 3220 dbSNP
rs1285531819 3221 dbSNP
rs1054315138 3232 dbSNP
rs893639721 3235 dbSNP
rs553286459 3236 dbSNP
rs1449491063 3237 dbSNP
rs1401609504 3242 dbSNP
rs758443769 3249 dbSNP
rs1415942821 3254 dbSNP
rs1009777203 3257 dbSNP
rs189905187 3258 dbSNP
rs1163974789 3261 dbSNP
rs1469787306 3267 dbSNP
rs1334644099 3273 dbSNP
rs542534169 3275 dbSNP
rs1362331200 3276 dbSNP
rs777615917 3278 dbSNP
rs1042233607 3282 dbSNP
rs1213006138 3283 dbSNP
rs1013596065 3284 dbSNP
rs1021710822 3285 dbSNP
rs557638181 3292 dbSNP
rs1325027593 3303 dbSNP
rs977591509 3306 dbSNP
rs1031367706 3312 dbSNP
rs1209964111 3315 dbSNP
rs1324168024 3322 dbSNP
rs1429639842 3326 dbSNP
rs151006328 3327 dbSNP
rs1378123610 3328 dbSNP
rs976418928 3329 dbSNP
rs1017260579 3334 dbSNP
rs191720482 3335 dbSNP
rs1222024643 3341 dbSNP
rs953952927 3344 dbSNP
rs1324260923 3366 dbSNP
rs900196688 3370 dbSNP
rs564042413 3374 dbSNP
rs909839343 3376 dbSNP
rs1211113049 3394 dbSNP
rs1380669272 3403 dbSNP
rs1406109368 3411 dbSNP
rs994585980 3419 dbSNP
rs939824234 3436 dbSNP
rs1036890432 3440 dbSNP
rs1198902269 3442 dbSNP
rs562464291 3443 dbSNP
rs938778520 3444 dbSNP
rs1057101292 3449 dbSNP
rs1354051156 3451 dbSNP
rs1280019719 3453 dbSNP
rs1232617333 3459 dbSNP
rs894471658 3462 dbSNP
rs1275996845 3470 dbSNP
rs1338945936 3473 dbSNP
rs1173912478 3482 dbSNP
rs1428317625 3485 dbSNP
rs1300178945 3488 dbSNP
rs1420535928 3491 dbSNP
rs1375113557 3494 dbSNP
rs1457766867 3496 dbSNP
rs1412574213 3498 dbSNP
rs1161243091 3519 dbSNP
rs757058517 3522 dbSNP
rs982358396 3523 dbSNP
rs926619333 3529 dbSNP
rs184638018 3533 dbSNP
rs1260395737 3535 dbSNP
rs1195259461 3536 dbSNP
rs531465029 3544 dbSNP
rs989500679 3553 dbSNP
rs140843886 3555 dbSNP
rs189051336 3564 dbSNP
rs915280320 3569 dbSNP
rs746084193 3570 dbSNP
rs1214483293 3576 dbSNP
rs1338091570 3588 dbSNP
rs769952552 3601 dbSNP
rs998958152 3602 dbSNP
rs1230817675 3627 dbSNP
rs1280140046 3629 dbSNP
rs1259469481 3633 dbSNP
rs1031816032 3635 dbSNP
rs1042587852 3642 dbSNP
rs890314645 3644 dbSNP
rs1350078672 3652 dbSNP
rs1445465349 3657 dbSNP
rs529191356 3661 dbSNP
rs780138428 3663 dbSNP
rs1409265875 3682 dbSNP
rs944591006 3683 dbSNP
rs1172130386 3704 dbSNP
rs182042807 3719 dbSNP
rs546150199 3720 dbSNP
rs900165671 3720 dbSNP
rs1292303844 3728 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 284067.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacGUCCCUUCACCCUCUCUCu 5'
             :||| :|| | ||||||| 
Target 5' --aUAGGAGAGAGAGAGAGAGa 3'
 		1 - 20
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084045. RNA binding protein: AGO2. Condition:CLIP_arsenite_rep3 HITS-CLIP data was present in GSM1084064. RNA binding protein: AGO2. Condition:CLIP_noemetine_AbnovaAb HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb HITS-CLIP data was present in GSM1084066. RNA binding protein: AGO2. Condition:CLIP_noemetine_SantaCruzAb HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb HITS-CLIP data was present in GSM1084077. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep1_SigmaAb HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb HITS-CLIP data was present in GSM1084082. RNA binding protein: AGO2. Condition:CLIP_nohippuristanol_rep2_SigmaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions MDA-MB-231
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1395169. RNA binding protein: AGO. Condition:MDA-MB-231 AGO HITS-CLIP Replicate 1 ...

- Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al., 2014, Breast cancer research and treatment.

Article - Pillai MM; Gillen AE; Yamamoto TM; Kline E; et al.
- Breast cancer research and treatment, 2014
miRNAs regulate the expression of genes in both normal physiology and disease. While miRNAs have been demonstrated to play a pivotal role in aspects of cancer biology, these reports have generally focused on the regulation of single genes. Such single-gene approaches have significant limitations, relying on miRNA expression levels and heuristic predictions of mRNA-binding sites. This results in only circumstantial evidence of miRNA-target interaction and typically leads to large numbers of false positive predictions. Here, we used a genome-wide approach (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation, HITS-CLIP) to define direct miRNA-mRNA interactions in three breast cancer subtypes (estrogen receptor positive, Her2 amplified, and triple negative). Focusing on steroid receptor signaling, we identified two novel regulators of the ER pathway (miR-9-5p and miR-193a/b-3p), which together target multiple genes involved in ER signaling. Moreover, this approach enabled the definition of miR-9-5p as a global regulator of steroid receptor signaling in breast cancer. We show that miRNA targets and networks defined by HITS-CLIP under physiologic conditions are predictive of patient outcomes and provide global insight into miRNA regulation in breast cancer.
LinkOut: [PMID: 24906430]
CLIP-seq Support 1 for dataset GSM1084045
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_arsenite_rep3
Location of target site ENST00000449302.3 | 3UTR | AAUAGGAGAGAGAGAGAGAGAGAGAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1084064
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_AbnovaAb
Location of target site ENST00000449302.3 | 3UTR | UUAACGAGAGAGAGAGAGAGAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084065
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_emetine_AbnovaAb
Location of target site ENST00000449302.3 | 3UTR | UAACGAGAGAGAGAGAGAGAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084066
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SantaCruzAb
Location of target site ENST00000449302.3 | 3UTR | AGGAGAGAGAGAGAGAGAGAGAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1084068
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noemetine_SigmaAb
Location of target site ENST00000449302.3 | 3UTR | GAGAGAGAGAGAGAAAGAGAGAGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1084077
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep1_SigmaAb
Location of target site ENST00000449302.3 | 3UTR | AAUAGGAGAGAGAGAGAGAGAGAGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000449302.3 | 3UTR | UUAACGAGAGAGAGAGAGAGAAAUCUGAGAGAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000449302.3 | 3UTR | AUAGGAGAGAGAGAGAGAGAGAGAGAGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1084082
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_nohippuristanol_rep2_SigmaAb
Location of target site ENST00000449302.3 | 3UTR | AGGAGAGAGAGAGAGAGAGAGAGAGUGAGAGAGAUAGAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1395169
Method / RBP HITS-CLIP / AGO
Cell line / Condition MDA-MB-231 / MDA-MB-231 AGO HITS-CLIP Replicate 1
Location of target site ENST00000449302.3 | 3UTR | GGAGAGAGAGAGAGAGAGAGAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24906430 / GSE57855
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000449302.3 | 3UTR | AUAGGAGAGAGAGAGAGAGAGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
342 hsa-miR-7110-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT082983 KHSRP KH-type splicing regulatory protein 2 2
MIRT234314 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT287120 SMARCE1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 2 2
MIRT292290 TGFBR3 transforming growth factor beta receptor 3 2 2
MIRT312255 DIAPH1 diaphanous related formin 1 2 2
MIRT384907 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT390883 ANTXR2 anthrax toxin receptor 2 2 2
MIRT395373 CDC42EP4 CDC42 effector protein 4 2 2
MIRT396751 RDX radixin 2 4
MIRT442600 SIX1 SIX homeobox 1 2 2
MIRT443088 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT448987 ARL15 ADP ribosylation factor like GTPase 15 2 2
MIRT483987 PANK1 pantothenate kinase 1 2 4
MIRT499233 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT506650 MAPK1 mitogen-activated protein kinase 1 2 6
MIRT512272 ARHGDIA Rho GDP dissociation inhibitor alpha 2 6
MIRT515228 GPATCH11 G-patch domain containing 11 2 6
MIRT520713 TMCO1 transmembrane and coiled-coil domains 1 2 8
MIRT526527 MDM2 MDM2 proto-oncogene 2 6
MIRT526652 C17orf105 chromosome 17 open reading frame 105 2 6
MIRT526668 IL5RA interleukin 5 receptor subunit alpha 2 6
MIRT536723 IGF1R insulin like growth factor 1 receptor 2 2
MIRT537027 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT539905 MTA3 metastasis associated 1 family member 3 2 11
MIRT540192 SH3PXD2A SH3 and PX domains 2A 2 8
MIRT540469 MC2R melanocortin 2 receptor 2 9
MIRT540586 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 4
MIRT541343 FRMD3 FERM domain containing 3 2 4
MIRT542703 RPS15A ribosomal protein S15a 2 2
MIRT543153 AKT1 AKT serine/threonine kinase 1 2 2
MIRT543264 ZNF662 zinc finger protein 662 2 2
MIRT551388 EHD3 EH domain containing 3 2 2
MIRT569346 EFHC1 EF-hand domain containing 1 2 2
MIRT571949 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT575098 Mta3 metastasis associated 3 2 7
MIRT575106 Mc2r melanocortin 2 receptor 2 6
MIRT575132 Myo1f myosin IF 2 4
MIRT575397 Zdhhc22 zinc finger, DHHC-type containing 22 2 3
MIRT575405 Rnf152 ring finger protein 152 2 4
MIRT576209 Baz2a bromodomain adjacent to zinc finger domain, 2A 2 4
MIRT576245 Asah2 N-acylsphingosine amidohydrolase 2 2 5
MIRT606791 RREB1 ras responsive element binding protein 1 2 8
MIRT606862 YAE1D1 Yae1 domain containing 1 2 6
MIRT607087 RNF152 ring finger protein 152 2 5
MIRT607210 ASAH2 N-acylsphingosine amidohydrolase 2 2 7
MIRT607224 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 4
MIRT607235 LINS lines homolog 1 2 4
MIRT607263 GRAMD1B GRAM domain containing 1B 2 6
MIRT607279 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT607299 CD300E CD300e molecule 2 6
MIRT607363 TNS1 tensin 1 2 4
MIRT609543 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT609568 CATSPER4 cation channel sperm associated 4 2 2
MIRT609691 EMX2 empty spiracles homeobox 2 2 2
MIRT609848 ZNF557 zinc finger protein 557 2 2
MIRT610227 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 5
MIRT610389 FOXE1 forkhead box E1 2 2
MIRT610431 ASAH2B N-acylsphingosine amidohydrolase 2B 2 2
MIRT610765 ARNT aryl hydrocarbon receptor nuclear translocator 2 2
MIRT611103 MYO1F myosin IF 2 5
MIRT611128 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT611287 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT611758 PLA2G7 phospholipase A2 group VII 2 6
MIRT612409 STRN striatin 2 6
MIRT612682 PLXNA4 plexin A4 2 2
MIRT613175 CYLD CYLD lysine 63 deubiquitinase 2 2
MIRT613696 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613741 GK5 glycerol kinase 5 (putative) 2 4
MIRT613916 POU3F1 POU class 3 homeobox 1 2 2
MIRT614281 WSCD2 WSC domain containing 2 2 2
MIRT614289 NPAP1 nuclear pore associated protein 1 2 2
MIRT614664 ZNF280B zinc finger protein 280B 2 2
MIRT614771 SLC41A2 solute carrier family 41 member 2 2 2
MIRT614854 PLEKHA6 pleckstrin homology domain containing A6 2 4
MIRT614887 PARD3B par-3 family cell polarity regulator beta 2 2
MIRT615052 DCAF12 DDB1 and CUL4 associated factor 12 2 2
MIRT615195 CLUAP1 clusterin associated protein 1 2 2
MIRT615337 ABCC12 ATP binding cassette subfamily C member 12 2 2
MIRT615344 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT615685 NAV2 neuron navigator 2 2 2
MIRT615767 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT615844 ZDHHC22 zinc finger DHHC-type containing 22 2 3
MIRT615866 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT615999 WDR59 WD repeat domain 59 2 2
MIRT616246 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 4
MIRT616342 DPF3 double PHD fingers 3 2 2
MIRT617185 GOSR2 golgi SNAP receptor complex member 2 2 4
MIRT617244 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT617524 SORCS2 sortilin related VPS10 domain containing receptor 2 2 2
MIRT617656 RWDD1 RWD domain containing 1 2 2
MIRT618017 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618116 OPRM1 opioid receptor mu 1 2 2
MIRT618226 CST3 cystatin C 2 2
MIRT618407 AGPAT1 1-acylglycerol-3-phosphate O-acyltransferase 1 2 2
MIRT618483 SIGLEC15 sialic acid binding Ig like lectin 15 2 2
MIRT618612 SHOX short stature homeobox 2 2
MIRT618641 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT619069 BSND barttin CLCNK type accessory beta subunit 2 4
MIRT619105 IFI44L interferon induced protein 44 like 2 2
MIRT619268 QRSL1 glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 2 4
MIRT619286 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619365 CFHR5 complement factor H related 5 2 2
MIRT619379 KLHL12 kelch like family member 12 2 2
MIRT619471 PRDM10 PR/SET domain 10 2 4
MIRT619488 QSOX2 quiescin sulfhydryl oxidase 2 2 2
MIRT619509 TXLNB taxilin beta 2 2
MIRT619549 GABRG2 gamma-aminobutyric acid type A receptor gamma2 subunit 2 2
MIRT619941 C8orf33 chromosome 8 open reading frame 33 2 2
MIRT620021 NFAM1 NFAT activating protein with ITAM motif 1 2 2
MIRT620178 EGFLAM EGF like, fibronectin type III and laminin G domains 2 2
MIRT620552 C10orf10 chromosome 10 open reading frame 10 2 4
MIRT620639 RFT1 RFT1 homolog 2 2
MIRT620706 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT620733 CCL16 C-C motif chemokine ligand 16 2 2
MIRT620746 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT620836 ZNF551 zinc finger protein 551 2 2
MIRT620848 ATG10 autophagy related 10 2 2
MIRT620925 LRRTM2 leucine rich repeat transmembrane neuronal 2 2 2
MIRT621407 VPS18 VPS18, CORVET/HOPS core subunit 2 2
MIRT621435 CABP7 calcium binding protein 7 2 2
MIRT621560 ZFP1 ZFP1 zinc finger protein 2 2
MIRT621911 TAB1 TGF-beta activated kinase 1 (MAP3K7) binding protein 1 2 2
MIRT622036 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT622066 SS18 SS18, nBAF chromatin remodeling complex subunit 2 2
MIRT622119 SPRY3 sprouty RTK signaling antagonist 3 2 2
MIRT622270 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT622511 RBM20 RNA binding motif protein 20 2 2
MIRT622606 PROM1 prominin 1 2 2
MIRT622636 PPAP2B phospholipid phosphatase 3 2 2
MIRT622692 PLSCR1 phospholipid scramblase 1 2 2
MIRT622732 PITPNM3 PITPNM family member 3 2 4
MIRT622776 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT622855 PDGFA platelet derived growth factor subunit A 2 2
MIRT622911 PCDH17 protocadherin 17 2 2
MIRT622998 ONECUT3 one cut homeobox 3 2 2
MIRT623104 NLGN4X neuroligin 4, X-linked 2 2
MIRT623123 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT623537 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT623706 HHAT hedgehog acyltransferase 2 2
MIRT623757 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT623770 GPR37L1 G protein-coupled receptor 37 like 1 2 2
MIRT623960 FBXL16 F-box and leucine rich repeat protein 16 2 2
MIRT624045 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT624120 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT624261 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT624460 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT624470 CADM2 cell adhesion molecule 2 2 2
MIRT624495 CABP4 calcium binding protein 4 2 2
MIRT624742 ANKRD28 ankyrin repeat domain 28 2 2
MIRT625305 SHISA6 shisa family member 6 2 2
MIRT625454 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT625951 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT626507 ATP1A3 ATPase Na+/K+ transporting subunit alpha 3 2 2
MIRT626523 TSC1 TSC complex subunit 1 2 2
MIRT626909 NRN1 neuritin 1 2 2
MIRT627927 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT628036 LSAMP limbic system-associated membrane protein 2 4
MIRT628121 HRK harakiri, BCL2 interacting protein 2 2
MIRT628154 HIP1 huntingtin interacting protein 1 2 2
MIRT628205 FREM2 FRAS1 related extracellular matrix protein 2 2 2
MIRT628762 MX2 MX dynamin like GTPase 2 2 4
MIRT628943 AICDA activation induced cytidine deaminase 2 2
MIRT629759 STK17A serine/threonine kinase 17a 2 2
MIRT629935 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT630149 ZDHHC9 zinc finger DHHC-type containing 9 2 2
MIRT630434 LHX9 LIM homeobox 9 2 2
MIRT632932 FGF9 fibroblast growth factor 9 2 2
MIRT635075 MICA MHC class I polypeptide-related sequence A 2 2
MIRT635101 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT635195 NFKBID NFKB inhibitor delta 2 2
MIRT635815 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT636506 GDAP1L1 ganglioside induced differentiation associated protein 1 like 1 2 2
MIRT637301 ACTN2 actinin alpha 2 2 2
MIRT638307 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT638340 RCAN1 regulator of calcineurin 1 2 2
MIRT638955 BHLHB9 basic helix-loop-helix family member b9 2 2
MIRT639271 SLC5A12 solute carrier family 5 member 12 2 4
MIRT639355 TBXA2R thromboxane A2 receptor 2 2
MIRT639534 CD86 CD86 molecule 2 2
MIRT640147 CEP104 centrosomal protein 104 2 2
MIRT640425 COG6 component of oligomeric golgi complex 6 2 2
MIRT641232 SEMA3E semaphorin 3E 2 2
MIRT641417 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT641796 USP32 ubiquitin specific peptidase 32 2 2
MIRT642048 KIAA1161 myogenesis regulating glycosidase (putative) 2 2
MIRT642427 STAT3 signal transducer and activator of transcription 3 2 2
MIRT642482 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT642737 TDRD6 tudor domain containing 6 2 2
MIRT643103 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT643311 TMEM151B transmembrane protein 151B 2 2
MIRT643622 ABCF3 ATP binding cassette subfamily F member 3 2 2
MIRT643734 CTU1 cytosolic thiouridylase subunit 1 2 2
MIRT644061 IQCE IQ motif containing E 2 2
MIRT644162 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644376 ZNF286A zinc finger protein 286A 2 2
MIRT644519 TADA2A transcriptional adaptor 2A 2 2
MIRT644566 SPOP speckle type BTB/POZ protein 2 2
MIRT645046 ID4 inhibitor of DNA binding 4, HLH protein 2 2
MIRT645311 AGTRAP angiotensin II receptor associated protein 2 2
MIRT645329 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT645337 DHRS3 dehydrogenase/reductase 3 2 2
MIRT645410 FAM110A family with sequence similarity 110 member A 2 2
MIRT645922 PLXNA3 plexin A3 2 2
MIRT645957 TTF2 transcription termination factor 2 2 2
MIRT646210 DUSP10 dual specificity phosphatase 10 2 2
MIRT646553 TMCC2 transmembrane and coiled-coil domain family 2 2 2
MIRT646799 EVC2 EvC ciliary complex subunit 2 2 2
MIRT647231 OR6A2 olfactory receptor family 6 subfamily A member 2 2 2
MIRT647256 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT647618 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT647659 FOXL1 forkhead box L1 2 2
MIRT648009 ZNF431 zinc finger protein 431 2 2
MIRT648490 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT649372 ASCL1 achaete-scute family bHLH transcription factor 1 2 2
MIRT649443 HIBADH 3-hydroxyisobutyrate dehydrogenase 2 2
MIRT649458 WDR70 WD repeat domain 70 2 2
MIRT649543 VAMP8 vesicle associated membrane protein 8 2 2
MIRT649554 FAM20B FAM20B, glycosaminoglycan xylosylkinase 2 2
MIRT650273 KLF2 Kruppel like factor 2 2 4
MIRT650443 CPXM2 carboxypeptidase X, M14 family member 2 2 2
MIRT650640 LTF lactotransferrin 2 2
MIRT650825 LZTR1 leucine zipper like transcription regulator 1 2 2
MIRT650951 INMT indolethylamine N-methyltransferase 2 2
MIRT651089 ZNF516 zinc finger protein 516 2 2
MIRT651329 ZCCHC2 zinc finger CCHC-type containing 2 2 2
MIRT651406 ZBTB12 zinc finger and BTB domain containing 12 2 2
MIRT651514 WNT4 Wnt family member 4 2 4
MIRT651571 WDR77 WD repeat domain 77 2 2
MIRT651987 UBE2H ubiquitin conjugating enzyme E2 H 2 4
MIRT652091 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT652388 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT652426 TMEM239 transmembrane protein 239 2 2
MIRT652606 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT652747 TGFA transforming growth factor alpha 2 4
MIRT652810 TBL2 transducin beta like 2 2 2
MIRT653253 SORD sorbitol dehydrogenase 2 2
MIRT653298 SMUG1 single-strand-selective monofunctional uracil-DNA glycosylase 1 2 2
MIRT653344 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653402 SLCO5A1 solute carrier organic anion transporter family member 5A1 2 2
MIRT653508 SLC43A2 solute carrier family 43 member 2 2 2
MIRT653582 SLC35B3 solute carrier family 35 member B3 2 2
MIRT653774 SIX4 SIX homeobox 4 2 2
MIRT653909 SERTAD4 SERTA domain containing 4 2 2
MIRT653937 SERPINC1 serpin family C member 1 2 2
MIRT654248 RIMS4 regulating synaptic membrane exocytosis 4 2 2
MIRT654684 PSMB5 proteasome subunit beta 5 2 2
MIRT654734 PRLR prolactin receptor 2 2
MIRT655437 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 2
MIRT655855 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT656077 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT656663 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT657297 HOXB5 homeobox B5 2 2
MIRT657410 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT657438 HHIP hedgehog interacting protein 2 2
MIRT657633 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT657864 GJD2 gap junction protein delta 2 2 2
MIRT657952 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658494 EXOC7 exocyst complex component 7 2 2
MIRT658682 EMP2 epithelial membrane protein 2 2 2
MIRT659026 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659087 DENR density regulated re-initiation and release factor 2 2
MIRT659127 DENND5B DENN domain containing 5B 2 2
MIRT659419 COL4A4 collagen type IV alpha 4 chain 2 2
MIRT660014 C1orf115 chromosome 1 open reading frame 115 2 4
MIRT660297 BICC1 BicC family RNA binding protein 1 2 2
MIRT660782 AKAP2 A-kinase anchoring protein 2 2 2
MIRT660801 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT661570 EPHX2 epoxide hydrolase 2 2 2
MIRT662198 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT662606 MAGEB4 MAGE family member B4 2 2
MIRT663443 FBXO2 F-box protein 2 2 2
MIRT663794 DDX53 DEAD-box helicase 53 2 2
MIRT664336 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT664751 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT665495 VAPA VAMP associated protein A 2 2
MIRT666450 SETBP1 SET binding protein 1 2 4
MIRT666741 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT666827 PRCP prolylcarboxypeptidase 2 2
MIRT667502 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT667624 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT668226 GABRA1 gamma-aminobutyric acid type A receptor alpha1 subunit 2 2
MIRT669054 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT669142 CD200 CD200 molecule 2 2
MIRT669414 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT671525 SEPT3 septin 3 2 4
MIRT671846 PDE3A phosphodiesterase 3A 2 2
MIRT675441 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT698694 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT700023 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT700227 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT707380 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT708303 MPPE1 metallophosphoesterase 1 2 2
MIRT708310 CDH8 cadherin 8 2 2
MIRT709297 LDLRAD4 low density lipoprotein receptor class A domain containing 4 2 2
MIRT710969 CMKLR1 chemerin chemokine-like receptor 1 2 2
MIRT711207 SMIM14 small integral membrane protein 14 2 2
MIRT711606 LHX5 LIM homeobox 5 2 2
MIRT712464 KCNC3 potassium voltage-gated channel subfamily C member 3 2 2
MIRT712763 SLC35F2 solute carrier family 35 member F2 2 2
MIRT712838 RHOA ras homolog family member A 2 2
MIRT713259 ZFP30 ZFP30 zinc finger protein 2 2
MIRT713386 NLN neurolysin 2 2
MIRT713548 GJB1 gap junction protein beta 1 2 2
MIRT714532 ZBTB39 zinc finger and BTB domain containing 39 2 2
MIRT714568 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT714608 EXO5 exonuclease 5 2 2
MIRT715130 ACADL acyl-CoA dehydrogenase, long chain 2 2
MIRT715225 NPVF neuropeptide VF precursor 2 2
MIRT715346 VMP1 vacuole membrane protein 1 2 2
MIRT715920 ACVRL1 activin A receptor like type 1 2 2
MIRT716016 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT716670 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT716805 TMEM196 transmembrane protein 196 2 2
MIRT716881 PHF16 jade family PHD finger 3 1 1
MIRT717303 RNF8 ring finger protein 8 2 2
MIRT717470 ZNF292 zinc finger protein 292 2 2
MIRT718048 GPT2 glutamic--pyruvic transaminase 2 2 2
MIRT718139 PALM paralemmin 2 2
MIRT718501 GYS1 glycogen synthase 1 2 2
MIRT718631 DIP2A disco interacting protein 2 homolog A 2 2
MIRT718719 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718844 SNX20 sorting nexin 20 2 2
MIRT718909 GALR1 galanin receptor 1 2 2
MIRT718920 TRIM66 tripartite motif containing 66 2 2
MIRT719141 DPYSL5 dihydropyrimidinase like 5 2 2
MIRT719407 B4GALNT3 beta-1,4-N-acetyl-galactosaminyltransferase 3 2 2
MIRT719552 CBLB Cbl proto-oncogene B 2 2
MIRT719642 AP5M1 adaptor related protein complex 5 mu 1 subunit 2 2
MIRT720186 CMC4 C-X9-C motif containing 4 2 2
MIRT720251 FAM83F family with sequence similarity 83 member F 2 2
MIRT720660 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT720939 PPP1R3E protein phosphatase 1 regulatory subunit 3E 2 2
MIRT721090 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT721137 SNRK SNF related kinase 2 2
MIRT721656 RPL34 ribosomal protein L34 2 2
MIRT721782 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT721873 RHOH ras homolog family member H 2 2
MIRT722131 TTLL11 tubulin tyrosine ligase like 11 2 2
MIRT722332 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT724319 CGN cingulin 2 2
MIRT724637 PKDREJ polycystin family receptor for egg jelly 2 2
MIRT725276 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-7110-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission