| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-6509 |
| Genomic Coordinates | chr7: 135206994 - 135207078 |
| Description | Homo sapiens miR-6509 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-6509-3p | |||||||||||||||||||||||||||||||||
| Sequence | 52| UUCCACUGCCACUACCUAAUUU |73 | |||||||||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||||||||
| Experiments | Illumina | |||||||||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | ZNF138 | ||||||||||||||||||||
| Synonyms | pHZ-32 | ||||||||||||||||||||
| Description | zinc finger protein 138 | ||||||||||||||||||||
| Transcript | NM_001160183 | ||||||||||||||||||||
| Other Transcripts | NM_006524 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on ZNF138 | |||||||||||||||||||||
| 3'UTR of ZNF138 (miRNA target sites are highlighted) |
>ZNF138|NM_001160183|3'UTR 1 AGCAGAACATAAAAGATTCTTTCCAAAAAGTGACACTGAGCAGATATGGAAAATATGGACATAAGAATTTACAGTTAAGA 81 AAAGGCTGTAAAAGTGTGGATGAGTGTAAGGGACACCAAGGAGGTTATAATGGACTTAACCAATGTTTGAAAATTACCAC 161 AAGCAAAATATTTCAATGTAATAAATATGTAAAAGTCATGCATAAATTTTCAAATTCAAATAGACACAAGATAAGACATA 241 CTGAAAATAAACATTTCAGATGTAAAGAATGTGACAAATCACTTTGCATGCTTTCACGCCTAACTCAACATAAAAAAATT 321 CATACTAGAGAGAATTTCTACAAATGTGAAGAGTGTGGAAAAACCTTTAACTGGTCCACAAACCTTTCTAAACCTAAGAA 401 AATTCATACTGGAGAAAAACCCTACAAATGTGAAGTATGTGGAAAAGCCTTTCACCAATCCTCAATCCTTACTAAACATA 481 AGATAATTCGTACTGGAGAAAAACCCTATAAATGTGCACACTGTGGCAAAGCCTTTAAACAGTCCTCACACCTTACTAGA 561 CATAAGATAATTCATACTGAAGAGAAACCCTACAAATGTGAACAATGTGGCAAGGTCTTTAAGCAGTCCCCAACCCTTAC 641 TAAACATCAGATAATTTATACTGGAGAGGAACCATACAAATGTGAGGAATGTGGCAAAGCTTTTAACCTATCTTAACAAC 721 TTACTGAACATAAGAAAATTTACACTAGAGAGAAAGCCTACAAATGTGAAGAATGTGGCAAAGCCTTTAACCAGTTTTCA 801 ACCCTTATTACACATAAGATAATTCATAGCGGAGAGAAACCCCACAAATGTGAAGAATGTGGCAGAGCTTTTAACCAGTC 881 CGCAAAGCTCACTGAACATAAGTTAATTCATACTGGAGAAAAACCCTACAAATGTAAAGAATGTGGAAAAGCTTTTCACC 961 GATACTCAATCCTTAGTACACATAAGAAAATTCATACTGGGGAGAAACCCCACAAATGTGGAGAATGCGGAAAAGCCTTT 1041 AACTGGTCCTCAACTCTTATTACACATAAGATAATTCACAGTGGAGAAAAACCCTACAAATGTGAAGAATGTGGCAAAGC 1121 TTTTAACCAGTCCTCACACCTTATGAGACATAAGAAAATTCATAGTAAAGAGAAACCCTACAAATGTGAACAGTGTGGCA 1201 AGGTCTTTAAGAAGTCCTCAACTCTTACTGCACATAAGATCATTCATACTGGAGAGAAACCTTACAAATGTGAGGAATGT 1281 GGCAAAGGTTTTAGCCAACTCTCAAACCTTACTAAACACAAGAAGATTCATACTAGAGAGAAACCCTACAAATGTGAAGA 1361 ATGTGGCATATCTTTTAACCAGTTCTCACAACTTGCTATACATAAGATGATTCACACTTGAATGAAACCCTACAAATGTG 1441 AACGATGTGGCAGTTGTTTTAACTAGTTCTCGAACTTTACTATGCATAAGAAAATTCAAACTGGAGAGAAACTCTACAAA 1521 TGTGAAGAATGTGGCAAAGCTTTTAACCAAGTCTCAACACTTACTATACATAAGATAATTTATACTGGAGCAAAACCTTG 1601 GAAATTCAAAGAATGTGGTAAAACTTACAATCCTCAAAACTTCTTACACCTAAAATTCATGCAGGAGAGAAACACCACAA 1681 ATGTGAAAAATTTGGTAAATTCTTTAACAAGTCTTCAACCCTTTCTGCACATAATATAATTCATACTGGAGAGAAACCCC 1761 ACAAATATGAAGAATGTGGTAATGCTTTTAACCAATTCTCAAATCTTACTAAACAAAATTAATACTGAAAATGTTACAAA 1841 CCAGAAAAATGTGAAAATGATTTTAACAAAACCTTCAAATTTTTCTAAACATAAAGGAAATCATACTGGTAAGAAATTAT 1921 AAAAATGTGAAGAATGTGACAAAGCCTTTAAATGGTTGTCACACTTGATTGTAGGTAAGATAATTCATACTGGCAGAAAC 2001 TCCCAGAAGTGTGAAGAATATGGCAAAACTTTAATTCCTATACCTTATTGCACAGGAAAGCATTTATACTTCAGAAAATG 2081 TTGTACTGATATAAAGAATGTAGAAAAGCCATTAATATGTGCTTACATCTTATTCAACATTAGAGAGTTAGTACTTAATA 2161 AAAGCATTATAAATGCAATTACTGTCAAAACTCAG Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Disease | 7697.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
||||||
| Experimental Support 3 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 7697.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293/HeLa |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells)
... - Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology. |
| Article |
- Kishore S; Gruber AR; Jedlinski DJ; Syed et al. - Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
|
| CLIP-seq Support 1 for dataset GSM1067870 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293/HeLa / Ago2 IP-seq (mitotic cells) |
| Location of target site | ENST00000440598.1 | 3UTR | GGAGAAAAACCCUACAAAUGUGAAGAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23706177 / GSE43666 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000440598.1 | 3UTR | UCCUCAACUCUUAUUACACAUAAGAUAAUUCACAGUGGAGAAAAACCCUACAAAUGUGAAGAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000440598.1 | 3UTR | UCACAGUGGAGAAAAACCCUACAAAUGUGAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000440598.1 | 3UTR | AAUUCACAGUGGAGAAAAACCCUACAAAUGUGAAGAAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
82 hsa-miR-6509-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT055374 | PDCD4 | programmed cell death 4 |  |
|
2 | 4 | ||||||
| MIRT378341 | MARCKS | myristoylated alanine rich protein kinase C substrate | |
|
2 | 2 | ||||||
| MIRT444668 | CDKL2 | cyclin dependent kinase like 2 | |
|
2 | 2 | ||||||
| MIRT446953 | CD248 | CD248 molecule | |
|
2 | 2 | ||||||
| MIRT460332 | CAMK4 | calcium/calmodulin dependent protein kinase IV | |
|
2 | 6 | ||||||
| MIRT464078 | VPS4A | vacuolar protein sorting 4 homolog A | |
|
2 | 2 | ||||||
| MIRT464586 | UBN2 | ubinuclein 2 | |
|
2 | 2 | ||||||
| MIRT468482 | SESN3 | sestrin 3 | |
|
2 | 2 | ||||||
| MIRT468962 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT475455 | HSPA8 | heat shock protein family A (Hsp70) member 8 | |
|
2 | 2 | ||||||
| MIRT482403 | ADRB1 | adrenoceptor beta 1 | |
|
2 | 10 | ||||||
| MIRT486992 | ZFAND2B | zinc finger AN1-type containing 2B | |
|
2 | 2 | ||||||
| MIRT489397 | TUBB2A | tubulin beta 2A class IIa | |
|
2 | 2 | ||||||
| MIRT526319 | UGT2A1 | UDP glucuronosyltransferase family 2 member A1 complex locus | |
|
2 | 2 | ||||||
| MIRT526560 | UGT2A2 | UDP glucuronosyltransferase family 2 member A2 | |
|
2 | 2 | ||||||
| MIRT526732 | ZNF138 | zinc finger protein 138 | |
|
2 | 8 | ||||||
| MIRT531581 | STXBP5L | syntaxin binding protein 5 like | |
|
2 | 2 | ||||||
| MIRT532011 | NOX5 | NADPH oxidase 5 | |
|
2 | 2 | ||||||
| MIRT533407 | TXLNG | taxilin gamma | |
|
2 | 2 | ||||||
| MIRT533436 | TRPC5 | transient receptor potential cation channel subfamily C member 5 | |
|
2 | 2 | ||||||
| MIRT533866 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | |
|
2 | 2 | ||||||
| MIRT539254 | ANKRD50 | ankyrin repeat domain 50 | |
|
2 | 2 | ||||||
| MIRT541451 | C15orf48 | chromosome 15 open reading frame 48 | |
|
2 | 2 | ||||||
| MIRT566794 | MIER3 | MIER family member 3 | |
|
2 | 2 | ||||||
| MIRT569294 | SURF6 | surfeit 6 | |
|
2 | 2 | ||||||
| MIRT571336 | RABGEF1 | RAB guanine nucleotide exchange factor 1 | |
|
2 | 2 | ||||||
| MIRT572802 | PPP3CB | protein phosphatase 3 catalytic subunit beta | |
|
2 | 2 | ||||||
| MIRT572813 | MYO1C | myosin IC | |
|
2 | 2 | ||||||
| MIRT574219 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT607259 | GRAMD1B | GRAM domain containing 1B | |
|
2 | 4 | ||||||
| MIRT609307 | CHD4 | chromodomain helicase DNA binding protein 4 | |
|
2 | 2 | ||||||
| MIRT615459 | REPS1 | RALBP1 associated Eps domain containing 1 | |
|
2 | 2 | ||||||
| MIRT616861 | RPLP1 | ribosomal protein lateral stalk subunit P1 | |
|
2 | 2 | ||||||
| MIRT619415 | NOS1AP | nitric oxide synthase 1 adaptor protein | |
|
2 | 2 | ||||||
| MIRT619652 | COX19 | COX19, cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT625325 | TNFRSF13B | TNF receptor superfamily member 13B | |
|
2 | 2 | ||||||
| MIRT638980 | ARFIP2 | ADP ribosylation factor interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT639458 | ZNF429 | zinc finger protein 429 | |
|
2 | 2 | ||||||
| MIRT640550 | SMCR8 | Smith-Magenis syndrome chromosome region, candidate 8 | |
|
2 | 2 | ||||||
| MIRT641473 | B4GALNT3 | beta-1,4-N-acetyl-galactosaminyltransferase 3 | |
|
2 | 2 | ||||||
| MIRT642720 | ATXN3 | ataxin 3 | |
|
2 | 2 | ||||||
| MIRT643048 | SMN1 | survival of motor neuron 1, telomeric | |
|
2 | 2 | ||||||
| MIRT644921 | SMN2 | survival of motor neuron 2, centromeric | |
|
2 | 2 | ||||||
| MIRT645875 | ZNF275 | zinc finger protein 275 | |
|
2 | 2 | ||||||
| MIRT649824 | LIPG | lipase G, endothelial type | |
|
2 | 2 | ||||||
| MIRT649851 | GYS2 | glycogen synthase 2 | |
|
2 | 2 | ||||||
| MIRT649972 | TRAFD1 | TRAF-type zinc finger domain containing 1 | |
|
2 | 2 | ||||||
| MIRT650675 | ZNF259 | ZPR1 zinc finger | |
1 | 1 | |||||||
| MIRT651319 | ZCCHC2 | zinc finger CCHC-type containing 2 | |
|
2 | 2 | ||||||
| MIRT652876 | TAB1 | TGF-beta activated kinase 1 (MAP3K7) binding protein 1 | |
|
2 | 2 | ||||||
| MIRT652881 | SYVN1 | synoviolin 1 | |
|
2 | 2 | ||||||
| MIRT654144 | RPAP2 | RNA polymerase II associated protein 2 | |
|
2 | 2 | ||||||
| MIRT657080 | JMY | junction mediating and regulatory protein, p53 cofactor | |
|
2 | 2 | ||||||
| MIRT657181 | INO80C | INO80 complex subunit C | |
|
2 | 2 | ||||||
| MIRT657830 | GJD3 | gap junction protein delta 3 | |
|
2 | 2 | ||||||
| MIRT657897 | GDF7 | growth differentiation factor 7 | |
|
2 | 2 | ||||||
| MIRT659631 | CDKN2AIP | CDKN2A interacting protein | |
|
2 | 2 | ||||||
| MIRT663115 | SPTA1 | spectrin alpha, erythrocytic 1 | |
|
2 | 2 | ||||||
| MIRT664739 | METTL16 | methyltransferase like 16 | |
|
2 | 2 | ||||||
| MIRT667551 | LRAT | lecithin retinol acyltransferase | |
|
2 | 2 | ||||||
| MIRT668552 | ERCC1 | ERCC excision repair 1, endonuclease non-catalytic subunit | |
|
2 | 2 | ||||||
| MIRT682893 | XIAP | X-linked inhibitor of apoptosis | |
|
2 | 2 | ||||||
| MIRT683092 | PRRG4 | proline rich and Gla domain 4 | |
|
2 | 2 | ||||||
| MIRT683102 | TIMM10B | translocase of inner mitochondrial membrane 10B | |
|
2 | 2 | ||||||
| MIRT697648 | WNK1 | WNK lysine deficient protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT709158 | ZNF419 | zinc finger protein 419 | |
|
2 | 2 | ||||||
| MIRT713220 | RCAN2 | regulator of calcineurin 2 | |
|
2 | 2 | ||||||
| MIRT713277 | LAIR1 | leukocyte associated immunoglobulin like receptor 1 | |
|
2 | 2 | ||||||
| MIRT715008 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT715051 | SYNJ2BP | synaptojanin 2 binding protein | |
|
2 | 2 | ||||||
| MIRT715696 | PNMAL2 | paraneoplastic Ma antigen family member 8B | |
|
2 | 2 | ||||||
| MIRT717250 | TMEM246 | transmembrane protein 246 | |
|
2 | 2 | ||||||
| MIRT717322 | PGK1 | phosphoglycerate kinase 1 | |
|
2 | 2 | ||||||
| MIRT717587 | MTHFD1L | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like | |
|
2 | 2 | ||||||
| MIRT718122 | CHST4 | carbohydrate sulfotransferase 4 | |
|
2 | 2 | ||||||
| MIRT718418 | CALN1 | calneuron 1 | |
|
2 | 2 | ||||||
| MIRT718750 | ZNF490 | zinc finger protein 490 | |
|
2 | 2 | ||||||
| MIRT720048 | PPP1R3F | protein phosphatase 1 regulatory subunit 3F | |
|
2 | 2 | ||||||
| MIRT721497 | THRB | thyroid hormone receptor beta | |
|
2 | 2 | ||||||
| MIRT722531 | EPRS | glutamyl-prolyl-tRNA synthetase | |
|
2 | 2 | ||||||
| MIRT723279 | KRTAP21-2 | keratin associated protein 21-2 | |
|
2 | 2 | ||||||
| MIRT724813 | MSX2 | msh homeobox 2 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|