miRTarBase - #MIRT527270


—
pre-miRNA Information
pre-miRNA hsa-mir-497   
Genomic Coordinates chr17: 7017911 - 7018022
Synonyms MIRN497, hsa-mir-497, MIR497
Description Homo sapiens miR-497 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-497-3p
Sequence 64| CAAACCACACUGUGGUGUUAGA |85
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 17 - 7017957 29233923 MiREDiBase
A-to-I 4 17 - 7017956 29233923 MiREDiBase
A-to-I 20 17 - 7017940 24964909, 25521855, 27229138, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1413601274 5 dbSNP
rs1028648384 6 dbSNP
rs1479092960 9 dbSNP
rs1261056598 10 dbSNP
rs997278260 11 dbSNP
rs1324708562 13 dbSNP
rs755634302 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FBLN2   
Synonyms -
Description fibulin 2
Transcript NM_001004019   
Other Transcripts NM_001165035 , NM_001998   
Expression
Putative miRNA Targets on FBLN2
3'UTR of FBLN2
(miRNA target sites are highlighted)		 
>FBLN2|NM_001004019|3'UTR
   1 GGTGCCAGCACGGGCCACCTGCGGGTGTGGCGCAGCCCAGGGCTCACACTGCGTGGGAGGGACTGGGTCACTATTGTGGT
  81 TTTTACTATAACTTTGTAAATTAACTTAATTTTGCTGACTTGACTCCTGTGGCTTCTGGACCCCTCCTCTGCCCCGCAGG
 161 AGGAAGTTCCACGGCAGGTGGTGCGTTCCCACGCAGGCACCAAGTGGAAGCTTGCACGGTGGGCCACGGCCGTGGCGGGT
 241 GCCCTGTGGGTGAGGCTGGGTGATGACCTGAGGACCAGAGACACGCGACCATGTTGGGGCTCTTGGACTCCTCTGGATGA
 321 CCCGTCCCCAAAGTTGACATTCCATTTCATGTTCCACTGTGATTAATTCTTTTCTTTTTTAAAAAATCATTTTAAAGTTT
 401 TTTGTTTAACTATAAAGTAGTACATGTACATTATATAAAAAAAAGTTCAACTAGTATGAAAGGGTTATAAAGTAACAGAG
 481 GAAAACGCCTCTTGGTCCCTTTAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agauuGUGGUGUCACACCAAAc 5'
               |||:|:  |||||||| 
Target 5' tgggtCACTAT--TGTGGTTTt 3'
 64 - 83 157.00 -13.10
2 
miRNA  3' agAUUGUGGUGUCACACCAAAc 5'
            |:|| ||    ||||| || 
Target 5' ctTGACTCC----TGTGGCTTc 3'
 119 - 136 122.00 -9.16
3 
miRNA  3' agauuGUGGUGUCACACCAaac 5'
               ||| :||| |||||   
Target 5' agttcCACGGCAG-GTGGTgcg 3'
 165 - 185 120.00 -16.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN25247510 7 COSMIC
COSN30502420 23 COSMIC
COSN31495659 23 COSMIC
COSN30165913 24 COSMIC
COSN31553708 32 COSMIC
COSN26169550 62 COSMIC
COSN31814265 67 COSMIC
COSN28866532 85 COSMIC
COSN30108872 104 COSMIC
COSN31523458 105 COSMIC
COSN30191336 132 COSMIC
COSN32056191 173 COSMIC
COSN23987426 194 COSMIC
COSN29463155 220 COSMIC
COSN30604795 233 COSMIC
COSN29513690 237 COSMIC
COSN19748604 238 COSMIC
COSN9974319 270 COSMIC
COSN9974320 277 COSMIC
COSN29513501 286 COSMIC
COSN31564492 287 COSMIC
COSN24641827 288 COSMIC
COSN9974321 290 COSMIC
COSN26678736 316 COSMIC
COSN14035298 370 COSMIC
COSN25544332 399 COSMIC
COSN31522119 408 COSMIC
COSN20098124 437 COSMIC
COSN28013092 437 COSMIC
rs7596 437 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1417966868 6 dbSNP
rs937698489 8 dbSNP
rs747650824 11 dbSNP
rs769639084 12 dbSNP
rs773180546 13 dbSNP
rs990391051 14 dbSNP
rs749191456 15 dbSNP
rs770778645 16 dbSNP
rs914458932 17 dbSNP
rs1470455635 20 dbSNP
rs200806008 23 dbSNP
rs556247082 24 dbSNP
rs1272513823 25 dbSNP
rs1390879013 26 dbSNP
rs1308355025 28 dbSNP
rs370950427 32 dbSNP
rs576053173 33 dbSNP
rs541849507 37 dbSNP
rs1312858343 38 dbSNP
rs34164428 40 dbSNP
rs1324686790 43 dbSNP
rs1205216978 46 dbSNP
rs762400649 51 dbSNP
rs1449528584 52 dbSNP
rs897996761 53 dbSNP
rs998059552 54 dbSNP
rs561510702 64 dbSNP
rs1372098955 80 dbSNP
rs889394135 89 dbSNP
rs1444415822 91 dbSNP
rs141917225 93 dbSNP
rs1473436368 97 dbSNP
rs1376061243 117 dbSNP
rs769000609 124 dbSNP
rs1032377363 126 dbSNP
rs1202591766 127 dbSNP
rs540897395 137 dbSNP
rs200352896 139 dbSNP
rs1275636067 140 dbSNP
rs750746829 144 dbSNP
rs1358501034 145 dbSNP
rs1289370015 147 dbSNP
rs1229935244 149 dbSNP
rs754614393 150 dbSNP
rs1355473459 151 dbSNP
rs780846189 153 dbSNP
rs752266871 156 dbSNP
rs559168695 157 dbSNP
rs888884279 159 dbSNP
rs570964070 163 dbSNP
rs1349460787 168 dbSNP
rs111929034 173 dbSNP
rs534840035 174 dbSNP
rs1484687999 179 dbSNP
rs1003587648 180 dbSNP
rs770788705 182 dbSNP
rs778711885 185 dbSNP
rs745629045 186 dbSNP
rs764947015 188 dbSNP
rs1303039872 189 dbSNP
rs113738289 193 dbSNP
rs775823834 194 dbSNP
rs937960283 199 dbSNP
rs1024963734 204 dbSNP
rs1473625548 211 dbSNP
rs1227554747 212 dbSNP
rs570174991 215 dbSNP
rs1489622615 216 dbSNP
rs906563884 218 dbSNP
rs553147690 219 dbSNP
rs1490783858 222 dbSNP
rs529355274 229 dbSNP
rs1184488560 230 dbSNP
rs113057429 232 dbSNP
rs1036791058 233 dbSNP
rs1283499883 236 dbSNP
rs750074238 237 dbSNP
rs989989401 237 dbSNP
rs1021916375 238 dbSNP
rs1392143188 239 dbSNP
rs762410816 241 dbSNP
rs765795087 243 dbSNP
rs750836932 244 dbSNP
rs763421016 245 dbSNP
rs1439092693 246 dbSNP
rs1343317850 249 dbSNP
rs766620045 252 dbSNP
rs1361676669 254 dbSNP
rs1295648084 255 dbSNP
rs1382479031 259 dbSNP
rs1299358966 260 dbSNP
rs967302223 261 dbSNP
rs752459534 262 dbSNP
rs1292416624 264 dbSNP
rs977335932 268 dbSNP
rs1061390 270 dbSNP
rs1241354775 275 dbSNP
rs1061398 277 dbSNP
rs1187393100 279 dbSNP
rs1250114235 280 dbSNP
rs1442869124 281 dbSNP
rs879340267 282 dbSNP
rs148527523 285 dbSNP
rs941810415 286 dbSNP
rs571873622 287 dbSNP
rs537688437 288 dbSNP
rs12968 290 dbSNP
rs1322151847 291 dbSNP
rs1380038066 292 dbSNP
rs1451317634 294 dbSNP
rs1315076724 298 dbSNP
rs1380678923 304 dbSNP
rs775105350 307 dbSNP
rs898014315 308 dbSNP
rs929563596 309 dbSNP
rs1046657496 319 dbSNP
rs906785275 321 dbSNP
rs762638113 322 dbSNP
rs77983433 324 dbSNP
rs1033711341 325 dbSNP
rs112258236 329 dbSNP
rs1270253975 332 dbSNP
rs1011431018 333 dbSNP
rs1460113792 334 dbSNP
rs1468315331 335 dbSNP
rs1021445908 339 dbSNP
rs1203248995 349 dbSNP
rs1280910018 352 dbSNP
rs3202499 357 dbSNP
rs758320333 362 dbSNP
rs14468 370 dbSNP
rs1186506949 379 dbSNP
rs1202430463 381 dbSNP
rs555361135 381 dbSNP
rs1473817377 387 dbSNP
rs1482006862 388 dbSNP
rs1257283989 389 dbSNP
rs998663520 391 dbSNP
rs1295849521 395 dbSNP
rs1176045411 398 dbSNP
rs1407820124 410 dbSNP
rs7820 411 dbSNP
rs954635803 415 dbSNP
rs1314999595 422 dbSNP
rs985753059 425 dbSNP
rs1187575360 428 dbSNP
rs1404408881 429 dbSNP
rs1392594148 430 dbSNP
rs540934222 431 dbSNP
rs71773469 432 dbSNP
rs1376503854 435 dbSNP
rs963143481 435 dbSNP
rs68091511 436 dbSNP
rs7596 437 dbSNP
rs929423473 437 dbSNP
rs959198706 445 dbSNP
rs928192136 446 dbSNP
rs1480066385 449 dbSNP
rs938282335 450 dbSNP
rs1207685024 454 dbSNP
rs984005553 458 dbSNP
rs1291561804 465 dbSNP
rs375077326 485 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 2199.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000404922.3 | 3UTR | UUUUACUAUAACUUUGUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE42095 Differentiated embryonic stem cells -0.767 9.8e-6 -0.686 1.5e-4 23 Click to see details
GSE28260 Renal cortex and medulla 0.7 3.9e-3 0.532 3.1e-2 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.308 7.2e-2 -0.395 2.8e-2 24 Click to see details
GSE32688 Pancreatic cancer -0.263 7.3e-2 -0.188 1.5e-1 32 Click to see details
GSE38226 Liver fibrosis -0.312 8.4e-2 -0.353 5.8e-2 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.241 1.2e-1 0.095 3.3e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.217 1.8e-1 0.197 2.0e-1 20 Click to see details
GSE28544 Breast cancer -0.162 2.2e-1 -0.184 1.9e-1 24 Click to see details
GSE17498 Multiple myeloma 0.057 3.6e-1 0.070 3.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.105 3.7e-1 0.364 1.2e-1 12 Click to see details
GSE21687 Ependynoma primary tumors 0.033 4.0e-1 0.060 3.2e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.033 4.0e-1 0.060 3.2e-1 64 Click to see details
GSE21687 Ependynoma primary tumors 0.033 4.0e-1 0.060 3.2e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
BRCA -0.349 0.01 -0.466 0 42 Click to see details
HNSC -0.522 0.01 -0.434 0.04 18 Click to see details
PRAD -0.277 0.03 -0.332 0.01 46 Click to see details
UCEC -0.453 0.04 -0.424 0.05 16 Click to see details
LUAD -0.827 0.09 -1.000 0.5 4 Click to see details
KIRC -0.164 0.15 -0.187 0.11 43 Click to see details
KICH -0.278 0.16 -0.539 0.02 15 Click to see details
LIHC 0.189 0.16 0.232 0.11 30 Click to see details
BLCA 0.611 0.19 0.400 0.3 4 Click to see details
PAAD -0.541 0.23 -0.200 0.4 4 Click to see details
THCA 0.087 0.28 0.147 0.17 45 Click to see details
LUSC 0.089 0.32 0.110 0.28 30 Click to see details
CHOL 0.224 0.33 0.200 0.35 6 Click to see details
STAD -0.091 0.35 -0.153 0.25 21 Click to see details
KIRP -0.064 0.39 -0.084 0.36 21 Click to see details
ESCA 0.028 0.47 -0.200 0.29 10 Click to see details
ESCA 0.028 0.47 -0.200 0.29 10 Click to see details
ESCA 0.028 0.47 -0.200 0.29 10 Click to see details
ESCA 0.028 0.47 -0.200 0.29 10 Click to see details
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092955 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT124568 PRRC2B proline rich coiled-coil 2B 2 2
MIRT125196 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT147296 KPNA2 karyopherin subunit alpha 2 2 8
MIRT163999 KIAA1109 KIAA1109 2 4
MIRT252495 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT357969 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT443007 TRIOBP TRIO and F-actin binding protein 2 2
MIRT443524 NETO1 neuropilin and tolloid like 1 2 2
MIRT443573 EVX2 even-skipped homeobox 2 2 2
MIRT443656 BACH1 BTB domain and CNC homolog 1 2 2
MIRT460670 KRT10 keratin 10 2 8
MIRT464761 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT465032 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465040 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT468667 SEC62 SEC62 homolog, preprotein translocation factor 2 2
MIRT473694 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT477618 EFNA3 ephrin A3 2 2
MIRT480506 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT480592 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT486915 ZNF398 zinc finger protein 398 2 6
MIRT487770 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT493265 MDFIC MyoD family inhibitor domain containing 2 2
MIRT495271 SLC1A2 solute carrier family 1 member 2 2 4
MIRT495309 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT496681 DPP6 dipeptidyl peptidase like 6 2 4
MIRT496891 FOXP1 forkhead box P1 2 2
MIRT497330 IRF4 interferon regulatory factor 4 2 2
MIRT498272 KIAA1644 KIAA1644 2 2
MIRT498634 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT500581 USP53 ubiquitin specific peptidase 53 2 2
MIRT500751 TMPPE transmembrane protein with metallophosphoesterase domain 2 6
MIRT509668 ZNF354B zinc finger protein 354B 2 10
MIRT510919 PSMA2 proteasome subunit alpha 2 2 4
MIRT519118 CEP76 centrosomal protein 76 2 2
MIRT526193 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT526746 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527270 FBLN2 fibulin 2 2 2
MIRT528198 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT528330 TBC1D22B TBC1 domain family member 22B 2 2
MIRT530346 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT533627 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT533738 TMEM200C transmembrane protein 200C 2 2
MIRT533779 TMEM133 transmembrane protein 133 2 2
MIRT534317 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT538438 COG5 component of oligomeric golgi complex 5 2 2
MIRT539156 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT539474 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT539620 SHISA9 shisa family member 9 2 2
MIRT539650 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540346 OPHN1 oligophrenin 1 2 2
MIRT540412 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541200 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT541395 CDC27 cell division cycle 27 2 2
MIRT546443 SNX5 sorting nexin 5 2 2
MIRT547369 MSI2 musashi RNA binding protein 2 2 2
MIRT553288 TSPAN3 tetraspanin 3 2 2
MIRT554402 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT557822 FOXN2 forkhead box N2 2 2
MIRT568530 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT569508 THYN1 thymocyte nuclear protein 1 2 2
MIRT570707 FAM69A family with sequence similarity 69 member A 2 2
MIRT608376 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608483 NKTR natural killer cell triggering receptor 2 6
MIRT613533 TRA2B transformer 2 beta homolog 2 2
MIRT616601 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT618166 DUSP18 dual specificity phosphatase 18 2 2
MIRT632059 CEP135 centrosomal protein 135 2 2
MIRT647379 ZDHHC23 zinc finger DHHC-type containing 23 2 2
MIRT648366 POTED POTE ankyrin domain family member D 2 2
MIRT651075 ZNF518B zinc finger protein 518B 2 4
MIRT653618 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653636 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654895 POU2F1 POU class 2 homeobox 1 2 2
MIRT656232 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT659880 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660526 ARL4C ADP ribosylation factor like GTPase 4C 2 2
MIRT666286 SLC30A3 solute carrier family 30 member 3 2 2
MIRT686808 SNX2 sorting nexin 2 2 4
MIRT695302 TK1 thymidine kinase 1 2 2
MIRT699737 SERINC3 serine incorporator 3 2 2
MIRT700794 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT712270 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712617 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714264 RPL10A ribosomal protein L10a 2 2
MIRT715072 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715386 TADA3 transcriptional adaptor 3 2 2
MIRT716397 NPAS1 neuronal PAS domain protein 1 2 2
MIRT725328 NFASC neurofascin 2 2
MIRT725503 GANAB glucosidase II alpha subunit 2 2
MIRT732913 IRAK2 interleukin 1 receptor associated kinase 2 3 0
MIRT734890 SMAD3 SMAD family member 3 3 0
MIRT737328 LINC02476 long intergenic non-protein coding RNA 2476 3 0
MIRT737544 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 0
MIRT755545 PAK1 p21 (RAC1) activated kinase 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-497 Bufalin NULL 9547215 Quantitative real-time PCR colorectal cancer HCT116 cells 24375248 2014 up-regulated
miR-497 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-497 Ethanol NULL 702 Quantitative real-time PCR CIE10 22141737 2012 up-regulated
miR-497 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-497 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-497 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-497 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-497 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-497-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-497-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-497-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-497-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-497-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission