miRTarBase - #MIRT527505


—
pre-miRNA Information
pre-miRNA hsa-mir-155   
Genomic Coordinates chr21: 25573980 - 25574044
Description Homo sapiens miR-155 stem-loop
Comment Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-155-3p
Sequence 43| CUCCUACAUAUUAGCAUUAACA |64
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1181188719 6 dbSNP
rs759895287 7 dbSNP
rs200351615 8 dbSNP
rs377265631 10 dbSNP
rs1038360714 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Blood and urinary supernatants Quantitative real-time PCR
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Kidney tissue Quantitative real-time PCR
Gene Information
Gene Symbol MYD88   
Synonyms MYD88D
Description myeloid differentiation primary response 88
Transcript NM_001172566   
Other Transcripts NM_001172567 , NM_001172568 , NM_001172569 , NM_002468   
Expression
Putative miRNA Targets on MYD88
3'UTR of MYD88
(miRNA target sites are highlighted)		 
>MYD88|NM_001172566|3'UTR
   1 TCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCC
  81 TGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGT
 161 GTGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAATCTGTGCTCTACTTACCTC
 241 TCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTG
 321 GCTGTGAGTGGCATGTCCACTTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAG
 401 CAGAGCCAGCTCAGCTCTGAGCCATTCACACATCTTCACCCTCAGTTTCCTCACTTGAGGAGTGGGATGGGGAGAACAGA
 481 GAGTAGCTGTGTTTGAATCCCTGTAGGAAATGGTGAAGCATAGCTCTGGGTCTCCTGGGGGAGACCAGGCTTGGCTGCGG
 561 GAGAGCTGGCTGTTGCTGGACTACATGCTGGCCACTGCTGTGACCACGACACTGCTGGGGCAGCTTCTTCCACAGTGATG
 641 CCTACTGATGCTTCAGTGCCTCTGCACACCGCCCATTCCACTTCCTCCTTCCCCACAGGGCAGGTGGGGAAGCAGTTTGG
 721 CCCAGCCCAAGGAGACCCCACCTTGAGCCTTATTTCCTAATGGGTCCACCTCTCATCTGCATCTTTCACACCTCCCAGCT
 801 TCTGCCCAACCTTCAGCAGTGACAAGTCCCCAAGAGACTCGCCTGAGCAGCTTGGGCTGCTTTTCATTTCCACCTGTCAG
 881 GATGCCTGTGGTCATGCTCTCAGCTCCACCTGGCATGAGAAGGGATCCTGGCCTCTGGCATATTCATCAAGTATGAGTTC
 961 TGGGGATGAGTCACTGTAATGATGTGAGCAGGGAGCCTTCCTCCCTGGGCCACCTGCAGAGAGCTTTCCCACCAACTTTG
1041 TACCTTGATTGCCTTACAAAGTTATTTGTTTACAAACAGCGACCATATAAAAGCCTCCTGCCCCAAAGCTTGTGGGCACA
1121 TGGGCACATACAGACTCACATACAGACACACACATATATGTACAGACATGTACTCTCACACACACAGGCACCAGCATACA
1201 CACGTTTTTCTAGGTACAGCTCCCAGGAACAGCTAGGTGGGAAAGTCCCATCACTGAGGGAGCCTAACCATGTCCCTGAA
1281 CAAAAATTGGGCACTCATCTATTCCTTTTCTCTTGTGTCCCTACTCATTGAAACCAAACTCTGGAAAGGACCCAATGTAC
1361 CAGTATTTATACCTCTAATGAAGCACAGAGAGAGGAAGAGAGCTGCTTAAACTCACACAACAATGAACTGCAGACACAGC
1441 TGTTCTCTCCCTCTCTCCTTCCCAGAGCAATTTATACTTTACCCTCAGGCTGTCCTCTGGGGAGAAGGTGCCATGGTCTT
1521 AGGTGTCTGTGCCCCAGGACAGACCCTAGGACCCTAAATCCAATAGAAAATGCATATCTTTGCTCCACTTTCAGCCAGGC
1601 TGGAGCAAGGTACCTTTTCTTAGGATCTTGGGAGGGAATGGATGCCCCTCTCTGCATGATCTTGTTGAGGCATTTAGCTG
1681 CCATGCACCTGTCCCCCTTTAATACTGGGCATTTTAAAGCCATCTCAAGAGGCATCTTCTACATGTTTTGTACGCATTAA
1761 AATAATTTCAAAGATATCTGAGAAAAGCCGATATTTGCCATTCTTCCTATATCCTGGAATATATCTTGCATCCTGAGTTT
1841 ATAATAATAAATAATATTCTACCTTGGAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acaauUACGA--UUA--UACAUCCUc 5'
               :||:|  |||   ||||||| 
Target 5' tagctGTGTTTGAATCCCTGTAGGAa 3'
 484 - 509 149.00 -9.20
2 
miRNA  3' acaauuacGAUUAUACAUCCUc 5'
                  :| :| ||||||| 
Target 5' ctcctcctTTCGT-TGTAGGAg 3'
 198 - 218 141.00 -11.90
3 
miRNA  3' acaaUUACGAUUAUACAUCCuc 5'
              || |||    |||:||  
Target 5' ccccAAAGCT----TGTGGGca 3'
 1101 - 1118 112.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
537302 104 ClinVar
COSM9377301 6 COSMIC
COSM262193 14 COSMIC
COSM5732408 31 COSMIC
COSM6097388 36 COSMIC
COSM3593159 38 COSMIC
COSM3593161 46 COSMIC
COSM5978600 61 COSMIC
COSM1044152 63 COSMIC
COSM1327588 102 COSMIC
COSM1044153 106 COSMIC
COSM5742947 107 COSMIC
COSM1485124 114 COSMIC
COSM7628363 115 COSMIC
COSN26583653 136 COSMIC
COSN20074961 144 COSMIC
COSN30134238 150 COSMIC
COSN26579871 152 COSMIC
COSN30532540 156 COSMIC
COSN30154832 185 COSMIC
COSN26985531 186 COSMIC
COSN28540118 192 COSMIC
COSN26985532 209 COSMIC
COSN30500767 238 COSMIC
COSN31536211 265 COSMIC
COSN30502399 270 COSMIC
COSN30512400 311 COSMIC
COSN31573820 327 COSMIC
COSN23644724 536 COSMIC
COSN1276641 809 COSMIC
COSN1276643 835 COSMIC
COSN17517188 1223 COSMIC
COSN17037901 1553 COSMIC
COSN25490381 1578 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777953448 3 dbSNP
rs1387104411 4 dbSNP
rs1424674435 6 dbSNP
rs1164336742 9 dbSNP
rs749555519 15 dbSNP
rs199631431 19 dbSNP
rs150473880 23 dbSNP
rs1400249300 27 dbSNP
rs1445122296 28 dbSNP
rs1434444364 29 dbSNP
rs927256757 30 dbSNP
rs1322873412 47 dbSNP
rs746009580 48 dbSNP
rs374614507 51 dbSNP
rs772137830 55 dbSNP
rs776556775 60 dbSNP
rs761677852 61 dbSNP
rs1319502476 63 dbSNP
rs370623345 67 dbSNP
rs1418257391 74 dbSNP
rs776395883 78 dbSNP
rs772838610 81 dbSNP
rs1156691174 82 dbSNP
rs937914897 83 dbSNP
rs1412285889 84 dbSNP
rs775722793 87 dbSNP
rs1159761534 95 dbSNP
rs138284536 104 dbSNP
rs765995806 106 dbSNP
rs751208476 112 dbSNP
rs754600491 117 dbSNP
rs767079920 119 dbSNP
rs375388881 120 dbSNP
rs893672462 125 dbSNP
rs1423284196 130 dbSNP
rs1464584267 141 dbSNP
rs1179175771 154 dbSNP
rs367636369 155 dbSNP
rs757632544 156 dbSNP
rs779074080 160 dbSNP
rs1376525313 164 dbSNP
rs746027655 166 dbSNP
rs772149966 170 dbSNP
rs902247201 172 dbSNP
rs1233800393 180 dbSNP
rs748113162 183 dbSNP
rs1264900720 187 dbSNP
rs191538099 192 dbSNP
rs537077316 195 dbSNP
rs1216298849 197 dbSNP
rs1319944839 198 dbSNP
rs1322993808 207 dbSNP
rs900137337 208 dbSNP
rs1423772248 209 dbSNP
rs550661080 210 dbSNP
rs1474222717 215 dbSNP
rs1388892586 226 dbSNP
rs1189987278 229 dbSNP
rs1348585567 234 dbSNP
rs1188296379 244 dbSNP
rs1418591635 254 dbSNP
rs755921204 256 dbSNP
rs543907076 273 dbSNP
rs952270367 274 dbSNP
rs891720661 279 dbSNP
rs1410485836 285 dbSNP
rs984012408 297 dbSNP
rs1010136618 301 dbSNP
rs567464021 302 dbSNP
rs1401626159 310 dbSNP
rs1334001169 318 dbSNP
rs201963479 326 dbSNP
rs766235458 327 dbSNP
rs1374035349 339 dbSNP
rs753721210 348 dbSNP
rs1015066965 349 dbSNP
rs1417104997 353 dbSNP
rs971909471 357 dbSNP
rs1445278943 359 dbSNP
rs981486110 362 dbSNP
rs971082420 368 dbSNP
rs1436084970 373 dbSNP
rs536348958 374 dbSNP
rs937314537 375 dbSNP
rs990773482 376 dbSNP
rs1237754134 378 dbSNP
rs1034550886 384 dbSNP
rs1422014168 385 dbSNP
rs1180492215 392 dbSNP
rs1277387647 410 dbSNP
rs373153220 411 dbSNP
rs915123047 420 dbSNP
rs115769759 430 dbSNP
rs1482147399 432 dbSNP
rs973985593 437 dbSNP
rs1204270084 440 dbSNP
rs541555536 442 dbSNP
rs1308014936 443 dbSNP
rs1274794394 448 dbSNP
rs1226426898 451 dbSNP
rs1377946286 465 dbSNP
rs920743249 484 dbSNP
rs902320302 490 dbSNP
rs1416079662 491 dbSNP
rs1348163004 502 dbSNP
rs944461195 505 dbSNP
rs950986330 529 dbSNP
rs1277570219 537 dbSNP
rs1040065104 540 dbSNP
rs777793237 544 dbSNP
rs983691245 559 dbSNP
rs900217723 560 dbSNP
rs573371486 566 dbSNP
rs747062009 570 dbSNP
rs1027936002 573 dbSNP
rs888041352 577 dbSNP
rs944749204 581 dbSNP
rs1212868959 593 dbSNP
rs1038973964 596 dbSNP
rs1015512101 607 dbSNP
rs1219079328 608 dbSNP
rs922018621 609 dbSNP
rs936071186 618 dbSNP
rs757472126 624 dbSNP
rs1234679628 632 dbSNP
rs539302060 633 dbSNP
rs981556270 639 dbSNP
rs1470598608 640 dbSNP
rs1034429882 648 dbSNP
rs1391496802 649 dbSNP
rs781463270 657 dbSNP
rs1376130281 661 dbSNP
rs1172230725 662 dbSNP
rs1292351396 670 dbSNP
rs1393611782 671 dbSNP
rs1284317936 672 dbSNP
rs891652105 673 dbSNP
rs1167570846 681 dbSNP
rs1174782261 689 dbSNP
rs559320409 691 dbSNP
rs1455793969 700 dbSNP
rs958715465 704 dbSNP
rs1390301989 710 dbSNP
rs1010061669 711 dbSNP
rs1326356308 716 dbSNP
rs990134369 726 dbSNP
rs1410055525 727 dbSNP
rs1045715526 734 dbSNP
rs907114391 735 dbSNP
rs56269210 737 dbSNP
rs1033983211 739 dbSNP
rs1253337588 749 dbSNP
rs1442407689 759 dbSNP
rs962789142 760 dbSNP
rs1302264853 763 dbSNP
rs1463238557 764 dbSNP
rs995243356 768 dbSNP
rs140834615 773 dbSNP
rs1025797654 776 dbSNP
rs977994710 780 dbSNP
rs1236266320 781 dbSNP
rs563282228 782 dbSNP
rs944541355 790 dbSNP
rs200418295 792 dbSNP
rs1388149880 799 dbSNP
rs1289726990 801 dbSNP
rs1455409942 810 dbSNP
rs776153938 811 dbSNP
rs1175473919 817 dbSNP
rs1432481842 822 dbSNP
rs1395648655 828 dbSNP
rs542380240 839 dbSNP
rs983575152 841 dbSNP
rs143065501 842 dbSNP
rs147457772 850 dbSNP
rs187053720 858 dbSNP
rs1253694711 859 dbSNP
rs1198382541 866 dbSNP
rs373022111 872 dbSNP
rs887413926 876 dbSNP
rs1005554501 877 dbSNP
rs1251416023 883 dbSNP
rs1365011779 889 dbSNP
rs1455838531 892 dbSNP
rs749761737 895 dbSNP
rs768311163 912 dbSNP
rs907407153 913 dbSNP
rs1170161555 918 dbSNP
rs1375970495 920 dbSNP
rs564884483 930 dbSNP
rs1003022889 945 dbSNP
rs1324763883 947 dbSNP
rs530807392 953 dbSNP
rs1034460662 954 dbSNP
rs958789098 957 dbSNP
rs1011637677 961 dbSNP
rs139252246 967 dbSNP
rs1253685469 973 dbSNP
rs1180746051 981 dbSNP
rs1054577747 984 dbSNP
rs564250473 985 dbSNP
rs1283079624 999 dbSNP
rs978447146 1007 dbSNP
rs923863273 1010 dbSNP
rs567570364 1011 dbSNP
rs1325657135 1014 dbSNP
rs1225093712 1015 dbSNP
rs945903820 1016 dbSNP
rs1340117956 1033 dbSNP
rs1213199110 1037 dbSNP
rs1271494554 1040 dbSNP
rs1338893689 1043 dbSNP
rs774041378 1050 dbSNP
rs1045548926 1053 dbSNP
rs1312340997 1059 dbSNP
rs761382748 1062 dbSNP
rs191520035 1078 dbSNP
rs557798816 1078 dbSNP
rs1407866363 1081 dbSNP
rs937209775 1082 dbSNP
rs1168246383 1097 dbSNP
rs779574846 1114 dbSNP
rs1247730655 1119 dbSNP
rs1048770215 1121 dbSNP
rs1163841718 1122 dbSNP
rs1475334394 1128 dbSNP
rs749433994 1138 dbSNP
rs1427130292 1141 dbSNP
rs1055884919 1142 dbSNP
rs1482994750 1146 dbSNP
rs56271803 1146 dbSNP
rs1195904191 1159 dbSNP
rs1374182332 1160 dbSNP
rs1354758915 1162 dbSNP
rs1265082026 1168 dbSNP
rs1234066522 1173 dbSNP
rs55864741 1173 dbSNP
rs755343566 1173 dbSNP
rs1286488010 1179 dbSNP
rs11555437 1182 dbSNP
rs1409331969 1184 dbSNP
rs145608550 1186 dbSNP
rs1392912058 1192 dbSNP
rs111634948 1200 dbSNP
rs995566552 1204 dbSNP
rs907438139 1205 dbSNP
rs1461597168 1214 dbSNP
rs1419618054 1218 dbSNP
rs1326201828 1219 dbSNP
rs1156277491 1225 dbSNP
rs1469228838 1231 dbSNP
rs1184689491 1243 dbSNP
rs1383924160 1246 dbSNP
rs182110210 1252 dbSNP
rs76180556 1260 dbSNP
rs1055990965 1270 dbSNP
rs1469963711 1274 dbSNP
rs1266525142 1275 dbSNP
rs569530547 1277 dbSNP
rs1351579246 1283 dbSNP
rs772909926 1291 dbSNP
rs1241028789 1298 dbSNP
rs1329297238 1302 dbSNP
rs1302365787 1303 dbSNP
rs1441419632 1307 dbSNP
rs886820181 1313 dbSNP
rs188043576 1325 dbSNP
rs1399615179 1332 dbSNP
rs1019042315 1335 dbSNP
rs1477301561 1336 dbSNP
rs193089416 1338 dbSNP
rs1395050882 1343 dbSNP
rs966285506 1350 dbSNP
rs1194626389 1352 dbSNP
rs55870210 1360 dbSNP
rs1029648843 1362 dbSNP
rs185388621 1372 dbSNP
rs1021703289 1373 dbSNP
rs7744 1379 dbSNP
rs1337055527 1383 dbSNP
rs990554891 1387 dbSNP
rs189917265 1388 dbSNP
rs1019544370 1390 dbSNP
rs913320708 1396 dbSNP
rs1373003030 1406 dbSNP
rs1234077834 1418 dbSNP
rs946078815 1420 dbSNP
rs1429531172 1422 dbSNP
rs766152291 1431 dbSNP
rs928427107 1433 dbSNP
rs1485077080 1439 dbSNP
rs1319677376 1440 dbSNP
rs1804726 1443 dbSNP
rs1375358490 1448 dbSNP
rs937151348 1456 dbSNP
rs975934647 1459 dbSNP
rs1055744281 1463 dbSNP
rs1207308218 1481 dbSNP
rs1263024326 1487 dbSNP
rs547356475 1488 dbSNP
rs1804725 1495 dbSNP
rs1475842871 1500 dbSNP
rs1186442251 1501 dbSNP
rs1244097978 1503 dbSNP
rs1185481255 1504 dbSNP
rs144108067 1514 dbSNP
rs564749516 1521 dbSNP
rs1475922136 1531 dbSNP
rs1211427746 1539 dbSNP
rs1165162553 1542 dbSNP
rs530686024 1545 dbSNP
rs1046680442 1546 dbSNP
rs984987920 1552 dbSNP
rs146475745 1556 dbSNP
rs908942326 1559 dbSNP
rs1271625937 1561 dbSNP
rs940378118 1565 dbSNP
rs886873877 1572 dbSNP
rs140908601 1588 dbSNP
rs1312972365 1589 dbSNP
rs1417107693 1597 dbSNP
rs1369279465 1600 dbSNP
rs1170151798 1605 dbSNP
rs530065961 1607 dbSNP
rs547066481 1608 dbSNP
rs1410928411 1610 dbSNP
rs928260520 1619 dbSNP
rs938917268 1620 dbSNP
rs996743000 1624 dbSNP
rs1029287594 1636 dbSNP
rs894679775 1637 dbSNP
rs947576499 1646 dbSNP
rs1438249305 1648 dbSNP
rs193039432 1648 dbSNP
rs957818016 1649 dbSNP
rs1231011541 1669 dbSNP
rs1311014712 1670 dbSNP
rs1357400414 1671 dbSNP
rs1234016344 1672 dbSNP
rs1371784940 1677 dbSNP
rs1298164607 1681 dbSNP
rs1443387276 1686 dbSNP
rs1356576425 1689 dbSNP
rs990172761 1697 dbSNP
rs1461075992 1705 dbSNP
rs1315413305 1708 dbSNP
rs1241617638 1718 dbSNP
rs1261611781 1725 dbSNP
rs6853 1728 dbSNP
rs1019578460 1733 dbSNP
rs1471682968 1740 dbSNP
rs901149814 1746 dbSNP
rs367636621 1754 dbSNP
rs552756522 1755 dbSNP
rs981544982 1756 dbSNP
rs1486354359 1758 dbSNP
rs1211621708 1762 dbSNP
rs868549495 1770 dbSNP
rs1467730220 1772 dbSNP
rs953356092 1773 dbSNP
rs1181999565 1774 dbSNP
rs928690483 1778 dbSNP
rs1416873301 1779 dbSNP
rs569496011 1788 dbSNP
rs184063027 1790 dbSNP
rs112504425 1791 dbSNP
rs1364108800 1794 dbSNP
rs919862423 1798 dbSNP
rs931195146 1801 dbSNP
rs1301655657 1811 dbSNP
rs971767681 1812 dbSNP
rs1440687725 1813 dbSNP
rs1395473349 1822 dbSNP
rs1328250164 1825 dbSNP
rs1171644155 1831 dbSNP
rs1455847026 1833 dbSNP
rs1046736103 1836 dbSNP
rs1159950977 1842 dbSNP
rs775152571 1844 dbSNP
rs1415461211 1846 dbSNP
rs1410124786 1849 dbSNP
rs765137950 1862 dbSNP
rs991778520 1863 dbSNP
rs867965031 1868 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 4615.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000396334.3 | 3UTR | GAGUAGCUGUGUUUGAAUCCCUGUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.532 8.6e-4 0.473 3.1e-3 32 Click to see details
GSE19536 Breast cancer 0.234 9.6e-3 0.226 1.2e-2 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.45 1.6e-2 0.505 7.0e-3 23 Click to see details
GSE21687 Ependynoma primary tumors -0.229 3.4e-2 -0.221 4.0e-2 64 Click to see details
GSE38226 Liver fibrosis -0.401 3.6e-2 -0.328 7.3e-2 21 Click to see details
GSE19783 ER- ER- breast cancer 0.189 4.8e-2 0.182 5.4e-2 79 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.605 1.0e-1 -0.886 9.4e-3 6 Click to see details
GSE19783 ER+ ER+ breast cancer 0.241 1.5e-1 0.296 1.0e-1 20 Click to see details
GSE28544 Breast cancer -0.18 2.0e-1 -0.250 1.2e-1 24 Click to see details
GSE17498 Multiple myeloma 0.126 2.2e-1 -0.071 3.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors 0.211 2.6e-1 0.568 2.7e-2 12 Click to see details
GSE28260 Renal cortex and medulla -0.116 3.5e-1 -0.082 3.9e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.027 4.5e-1 0.063 3.8e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.019 4.7e-1 -0.239 1.6e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.002 5.0e-1 -0.012 4.8e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.002 5.0e-1 -0.012 4.8e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
STAD 0.697 0.01 0.336 0.14 12 Click to see details
HNSC 0.56 0.01 0.521 0.02 16 Click to see details
LIHC 0.493 0.04 0.544 0.03 13 Click to see details
THCA 0.352 0.05 0.389 0.03 23 Click to see details
BRCA 0.42 0.06 0.407 0.07 15 Click to see details
UCEC -0.605 0.14 -0.100 0.44 5 Click to see details
KIRC 0.337 0.17 0.115 0.38 10 Click to see details
LUSC -0.186 0.22 -0.039 0.44 20 Click to see details
PRAD -0.434 0.23 -0.600 0.14 5 Click to see details
PAAD 0.46 0.27 0.400 0.3 4 Click to see details
CHOL 0.627 0.28 0.500 0.33 3 Click to see details
KIRP 0.27 0.33 0.100 0.44 5 Click to see details
ESCA 0.082 0.46 0.200 0.4 4 Click to see details
ESCA 0.082 0.46 0.200 0.4 4 Click to see details
ESCA 0.082 0.46 0.200 0.4 4 Click to see details
ESCA 0.082 0.46 0.200 0.4 4 Click to see details
73 hsa-miR-155-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005808 IRAK3 interleukin 1 receptor associated kinase 3 4 1
MIRT082844 ZNF460 zinc finger protein 460 2 4
MIRT256047 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT437787 PTEN phosphatase and tensin homolog 2 1
MIRT456168 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT464916 TXNIP thioredoxin interacting protein 2 4
MIRT475559 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT499608 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT504220 MYO6 myosin VI 2 4
MIRT504256 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT507642 CREBRF CREB3 regulatory factor 2 2
MIRT522858 KIAA1551 KIAA1551 2 2
MIRT527505 MYD88 myeloid differentiation primary response 88 5 2
MIRT530713 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT532851 ZNF699 zinc finger protein 699 2 2
MIRT535952 MIA3 MIA family member 3, ER export factor 2 2
MIRT539041 ATXN1L ataxin 1 like 2 4
MIRT556391 LUC7L LUC7 like 2 2
MIRT558617 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT559869 ATXN3 ataxin 3 2 2
MIRT569208 SHC3 SHC adaptor protein 3 2 2
MIRT573122 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT575076 Ddit4 DNA-damage-inducible transcript 4 2 2
MIRT607597 ABCF3 ATP binding cassette subfamily F member 3 2 6
MIRT609386 PHEX phosphate regulating endopeptidase homolog X-linked 2 2
MIRT610550 MDN1 midasin AAA ATPase 1 2 2
MIRT612390 TCF7L2 transcription factor 7 like 2 2 2
MIRT612910 GTDC1 glycosyltransferase like domain containing 1 2 6
MIRT613314 ARL5C ADP ribosylation factor like GTPase 5C 2 2
MIRT613356 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 4
MIRT613541 CLMP CXADR like membrane protein 2 2
MIRT617029 SYT6 synaptotagmin 6 2 2
MIRT618044 MRVI1 murine retrovirus integration site 1 homolog 2 2
MIRT619307 KIRREL kirre like nephrin family adhesion molecule 1 2 2
MIRT623209 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT625448 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT634551 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT640740 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT640906 RAB13 RAB13, member RAS oncogene family 2 2
MIRT644025 ZNF792 zinc finger protein 792 2 2
MIRT651489 WT1 Wilms tumor 1 2 2
MIRT652037 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT669093 CDK6 cyclin dependent kinase 6 2 2
MIRT696720 WNT3 Wnt family member 3 2 2
MIRT698085 TPM1 tropomyosin 1 2 2
MIRT703284 GID4 GID complex subunit 4 homolog 2 2
MIRT707183 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 2
MIRT710362 CREB5 cAMP responsive element binding protein 5 2 2
MIRT713501 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT717153 LRRC3C leucine rich repeat containing 3C 2 2
MIRT719038 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 2 2
MIRT719489 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT720284 DPYSL3 dihydropyrimidinase like 3 2 2
MIRT732474 NLRP3 NLR family pyrin domain containing 3 2 0
MIRT732620 MS multiple sclerosis 1 0
MIRT732968 TGFBR2 transforming growth factor beta receptor 2 3 0
MIRT733063 AGTR1 angiotensin II receptor type 1 3 0
MIRT733206 ADAM10 ADAM metallopeptidase domain 10 1 0
MIRT733302 CRP C-reactive protein 2 0
MIRT734202 PDCD4 programmed cell death 4 3 0
MIRT734467 SIRT1 sirtuin 1 2 0
MIRT734701 Foxo3 forkhead box O3 1 0
MIRT734889 SP4 Sp4 transcription factor 2 0
MIRT735047 BATF basic leucine zipper ATF-like transcription factor 1 0
MIRT735048 SPI1 Spi-1 proto-oncogene 1 0
MIRT735734 PICALM phosphatidylinositol binding clathrin assembly protein 3 0
MIRT735944 TNF tumor necrosis factor 1 0
MIRT736131 MYLK myosin light chain kinase 2 0
MIRT736780 FOXP3 forkhead box P3 1 0
MIRT736781 CEBPB CCAAT/enhancer binding protein beta 1 0
MIRT736858 WEE1 WEE1 G2 checkpoint kinase 2 0
MIRT736873 TLR3 toll like receptor 3 2 0
MIRT736902 CFH complement factor H 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-155 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-155 Cyclophosphamide approved 2907 Quantitative real-time PCR p53+/+ pregnant mice 20170545 2010 down-regulated
miR-155 Estrogen NULL NULL Microarray mouse uterus 20720260 2010 up-regulated
miR-155 Estrogen NULL NULL Quantitative real-time PCR mouse uterus 20720260 2010 up-regulated
miR-155 Camptothecin NULL 24360 Microarray human cancer cells 24252850 2014 down-regulated
miR-155 Cocaine NULL 446220 Quantitative real-time PCR monocyte derived dendritic cells 24391808 2014 down-regulated
miR-155 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-155 Triptolide NULL 107985 Quantitative real-time PCR peripheral blood mononuclear cells (PBMCs) of RA (rheumatoid arthritis) 24909288 2014 down-regulated
miR-155 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-155 Lithium (Li) approved 3028194 Quantitative real-time PCR lymphoblastoid cell lines (LCLs) 19254429 2009 up-regulated
miR-155 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 down-regulated
miR-155 Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-155 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-155 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-155 Gemcitabine approved 60750 Quantitative real-time PCR pancreatic cancer 21738581 2011 down-regulated
miR-155 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-155 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-155 Glucocorticoid NULL NULL Microarray RAW264.7 cells 22326887 2012 down-regulated
miR-155 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-155 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-155 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-155 Adrenaline approved 5816 Quantitative real-time PCR colon cancer HT29 cells 23036199 2012 up-regulated
miR-155 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 down-regulated
miR-155 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-155 Sinomenine NULL 5459308 Quantitative real-time PCR Colitis 24066068 2013 down-regualted
miR-155 Praziquantel approved 4891 Quantitative real-time PCR liver cell lines 25051829 2014 down-regualted
miR-155 Uric acid NULL 1175 Quantitative real-time PCR endothelial cells 23996753 2013 up-regualted
miR-155 Hydroxychloroquine approved 3652 Microarray mesangial cells 24121037 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-155 Tripterygium wilfordii Hook F resistant tissue
hsa-mir-155 Doxorubicin 31703 NSC123127 approved resistant cell line (W1)
hsa-mir-155 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-155 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-155-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7, SKBR3, MDA-MB-231)
hsa-miR-155-3p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U87)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-155-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-155-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-155-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission