miRTarBase - #MIRT527995


—
pre-miRNA Information
pre-miRNA hsa-mir-452   
Genomic Coordinates chrX: 151959628 - 151959712
Synonyms MIRN452, hsa-mir-452, MIR452
Description Homo sapiens miR-452 stem-loop
Comment The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-452-3p
Sequence 58| CUCAUCUGCAAAGAAGUAAGUG |79
Evidence Experimental
Experiments Array-cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 X - 151959644 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs757928550 3 dbSNP
rs1324216965 6 dbSNP
rs1390793899 13 dbSNP
rs899383242 17 dbSNP
rs747858567 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NDNF   
Synonyms C4orf31, NORD
Description neuron derived neurotrophic factor
Transcript NM_024574   
Expression
Putative miRNA Targets on NDNF
3'UTR of NDNF
(miRNA target sites are highlighted)		 
>NDNF|NM_024574|3'UTR
   1 TTACCTTCTTATAGAGATATATTATGTAGAACTCCAGGAGGGACATTAAATCACTTTAAGTATAAACTGACTACTCCCAC
  81 AGTTGAGAGAAGTTGTGACCTGTACTTGTACTATGGAAGGAAGGATATCAACGTGTGTATATTGATGTTTATATAAGTAA
 161 CTCTTGAAGGAGACTTGTTCTAGCGTGCCCCATGGTACCTAGTGTGTGTCTGATGCCGGTTGGTGTCAAAGATAGAGGGC
 241 TTCTTGAAGGAACTTGCCATTCCTTGCTTTGACCACTGCATGAACTGCTTCTAAATTATTTTATTACCTAAAAATTTAAA
 321 ATATGCCATTCATTGCACACACCCACAAATGCAAATCATTCCTCTCTGTAGATGCTAGGATATATATAAATTATTTTATA
 401 AATTCTTGTTTTAAATGTCAGTGTTTCTATGATTGTAAACTATTAAATTCTTTTCCTATTAAAGTACAGATCTAATCTAA
 481 GTATTATTAAGTTGATAGCCCTCTAGTCAGTTATATTGCTATTGTAAATTCTTGTTTGTTGAGTAAAATGTTTAAATACT
 561 ATATGTATCTCATGTACAAAGTTGACATACATTATATTCATGTACATAAAATTAAAGAGATTAGATTATATACTGTTAAA
 641 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guGAAUGAAGAAACGUCUACuc 5'
            | | | ||| ||:|||||  
Target 5' atCATTCCTCTCTGTAGATGct 3'
 355 - 376 132.00 -11.90
2 
miRNA  3' guGAAUGAAGA-AACGUCUACUc 5'
            || ||| ||    ||| ||| 
Target 5' aaCTGACTACTCCCACAGTTGAg 3'
 65 - 87 120.00 -11.60
3 
miRNA  3' gugAAUGAA-GAAAC----GUC-UACUc 5'
             || ||| |||||    | | |||| 
Target 5' ccaTTCCTTGCTTTGACCACTGCATGAa 3'
 257 - 284 101.00 -7.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31506969 8 COSMIC
COSN30177775 11 COSMIC
COSN30105698 14 COSMIC
COSN31581592 18 COSMIC
COSN31509648 29 COSMIC
COSN30472775 50 COSMIC
COSN30467592 52 COSMIC
COSN1286372 53 COSMIC
COSN30487131 54 COSMIC
COSN20123995 60 COSMIC
COSN30490092 64 COSMIC
COSN31524995 89 COSMIC
COSN14091104 113 COSMIC
COSN30505593 148 COSMIC
COSN30192967 152 COSMIC
COSN30508218 156 COSMIC
COSN15875511 162 COSMIC
COSN30171176 191 COSMIC
COSN31543328 193 COSMIC
COSN9900837 193 COSMIC
COSN16564653 199 COSMIC
COSN22451476 288 COSMIC
COSN31583385 303 COSMIC
COSN26553396 357 COSMIC
COSN31570607 382 COSMIC
COSN31540403 435 COSMIC
COSN31534962 450 COSMIC
COSN5051672 522 COSMIC
COSN31596110 535 COSMIC
COSN31489729 584 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs929056418 3 dbSNP
rs28738955 12 dbSNP
rs764127734 24 dbSNP
rs777492658 26 dbSNP
rs1196220007 32 dbSNP
rs756073951 34 dbSNP
rs553332697 42 dbSNP
rs1027070069 47 dbSNP
rs1234268259 58 dbSNP
rs975559344 63 dbSNP
rs964444939 66 dbSNP
rs1323974414 68 dbSNP
rs1378969161 72 dbSNP
rs72911671 73 dbSNP
rs1402443845 75 dbSNP
rs910783999 76 dbSNP
rs576981802 81 dbSNP
rs1403185334 87 dbSNP
rs1448927770 89 dbSNP
rs866026189 95 dbSNP
rs141548291 97 dbSNP
rs185502117 100 dbSNP
rs1031041930 101 dbSNP
rs1303744324 105 dbSNP
rs967862629 114 dbSNP
rs762069080 116 dbSNP
rs1261341416 117 dbSNP
rs567858630 120 dbSNP
rs1320019241 124 dbSNP
rs904444549 127 dbSNP
rs1232800503 131 dbSNP
rs1024427230 132 dbSNP
rs76137074 133 dbSNP
rs1193261698 134 dbSNP
rs1268450634 135 dbSNP
rs1454472872 148 dbSNP
rs948548733 151 dbSNP
rs534350474 154 dbSNP
rs1175198466 163 dbSNP
rs896344314 183 dbSNP
rs77235791 185 dbSNP
rs1171347632 189 dbSNP
rs1002135851 192 dbSNP
rs1458705945 199 dbSNP
rs1234039301 203 dbSNP
rs75596922 217 dbSNP
rs72911670 218 dbSNP
rs1404582878 219 dbSNP
rs908196630 220 dbSNP
rs982453298 222 dbSNP
rs563735146 223 dbSNP
rs929028776 228 dbSNP
rs931529171 231 dbSNP
rs920189501 237 dbSNP
rs1347440738 240 dbSNP
rs897563796 242 dbSNP
rs1242485475 250 dbSNP
rs1224341495 251 dbSNP
rs1040156401 256 dbSNP
rs1490286059 257 dbSNP
rs1377697578 280 dbSNP
rs1198329512 294 dbSNP
rs1266288514 303 dbSNP
rs1280117635 304 dbSNP
rs1478545231 306 dbSNP
rs964226068 318 dbSNP
rs749815697 328 dbSNP
rs910731745 330 dbSNP
rs986896014 331 dbSNP
rs1166756987 338 dbSNP
rs957044648 343 dbSNP
rs575181496 344 dbSNP
rs1030968794 348 dbSNP
rs780528843 351 dbSNP
rs1269681328 356 dbSNP
rs1359889466 365 dbSNP
rs1045080 368 dbSNP
rs1359226018 384 dbSNP
rs1220690782 385 dbSNP
rs977816162 386 dbSNP
rs1215977895 387 dbSNP
rs1241029800 395 dbSNP
rs1474133032 413 dbSNP
rs1183596394 417 dbSNP
rs561405003 424 dbSNP
rs750654517 432 dbSNP
rs1385748329 435 dbSNP
rs1021570575 437 dbSNP
rs967433401 439 dbSNP
rs1161464623 440 dbSNP
rs528684494 442 dbSNP
rs1401520018 450 dbSNP
rs894297877 450 dbSNP
rs1176083886 468 dbSNP
rs1057392335 474 dbSNP
rs572496459 476 dbSNP
rs886865345 481 dbSNP
rs565250745 483 dbSNP
rs1244370961 491 dbSNP
rs1311925611 495 dbSNP
rs545786409 499 dbSNP
rs1046682342 514 dbSNP
rs1033521363 516 dbSNP
rs1283113492 524 dbSNP
rs1189162466 526 dbSNP
rs1211585347 528 dbSNP
rs1485545586 531 dbSNP
rs1278504407 543 dbSNP
rs930995893 551 dbSNP
rs577018634 558 dbSNP
rs1382006872 561 dbSNP
rs556970051 572 dbSNP
rs149448747 574 dbSNP
rs1039919410 583 dbSNP
rs1027608170 587 dbSNP
rs1222082990 590 dbSNP
rs1405359176 591 dbSNP
rs1371111712 597 dbSNP
rs1285870003 600 dbSNP
rs942978986 601 dbSNP
rs993559384 604 dbSNP
rs897506316 606 dbSNP
rs1336792579 607 dbSNP
rs1040496838 611 dbSNP
rs987376024 620 dbSNP
rs1441894965 636 dbSNP
rs956780456 638 dbSNP
rs1348121512 644 dbSNP
rs1220553918 650 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 79625.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000379692.4 | 3UTR | GAUGAACUUCAGAGUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE26953 Aortic valvular endothelial cells -0.513 5.2e-3 -0.451 1.3e-2 24 Click to see details
GSE21687 Ependynoma primary tumors 0.298 8.4e-3 0.284 1.1e-2 64 Click to see details
GSE28260 Renal cortex and medulla -0.461 5.6e-2 -0.429 7.2e-2 13 Click to see details
GSE27834 Pluripotent stem cells 0.391 6.7e-2 0.382 7.2e-2 16 Click to see details
GSE32688 Pancreatic cancer 0.267 7.0e-2 0.189 1.5e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.233 1.4e-1 -0.352 5.0e-2 23 Click to see details
GSE17306 Multiple myeloma 0.152 1.5e-1 0.513 8.2e-5 49 Click to see details
GSE21849 B cell lymphoma 0.164 2.0e-1 0.463 5.7e-3 29 Click to see details
GSE28544 Breast cancer 0.154 2.4e-1 0.176 2.1e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.142 2.8e-1 -0.062 4.0e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.097 3.2e-1 -0.138 2.6e-1 25 Click to see details
GSE17498 Multiple myeloma -0.032 4.2e-1 -0.072 3.3e-1 40 Click to see details
GSE19350 CNS germ cell tumors -0.042 4.5e-1 0.406 9.5e-2 12 Click to see details
GSE38226 Liver fibrosis -0.008 4.9e-1 -0.106 3.2e-1 21 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 -0.091 2.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 -0.091 2.0e-1 90 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 -0.091 2.0e-1 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
LUSC -0.425 0 -0.377 0.01 38 Click to see details
STAD -0.367 0.03 -0.413 0.01 29 Click to see details
LUAD -0.56 0.04 -0.527 0.05 11 Click to see details
HNSC -0.275 0.04 -0.298 0.03 42 Click to see details
CHOL 0.437 0.12 0.683 0.02 9 Click to see details
CESC 0.86 0.17 0.500 0.33 3 Click to see details
PRAD -0.126 0.2 -0.105 0.24 48 Click to see details
BLCA 0.208 0.21 0.211 0.21 17 Click to see details
KIRC 0.079 0.27 0.078 0.27 65 Click to see details
BRCA -0.055 0.32 -0.010 0.47 79 Click to see details
LIHC 0.067 0.32 0.095 0.26 49 Click to see details
KICH -0.092 0.33 -0.093 0.33 24 Click to see details
UCEC -0.076 0.38 -0.181 0.23 19 Click to see details
KIRP 0.035 0.43 0.056 0.38 31 Click to see details
ESCA 0.07 0.43 0.183 0.32 9 Click to see details
PAAD -0.116 0.44 0.800 0.1 4 Click to see details
THCA 0.009 0.47 -0.045 0.37 59 Click to see details
THCA 0.009 0.47 -0.045 0.37 59 Click to see details
THCA 0.009 0.47 -0.045 0.37 59 Click to see details
THCA 0.009 0.47 -0.045 0.37 59 Click to see details
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT150000 MIDN midnolin 2 10
MIRT330600 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT358701 SUB1 SUB1 homolog, transcriptional regulator 2 4
MIRT362854 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT447215 ATXN7 ataxin 7 2 2
MIRT466655 TAF1D TATA-box binding protein associated factor, RNA polymerase I subunit D 2 6
MIRT483979 PANK1 pantothenate kinase 1 2 8
MIRT485118 SF3B3 splicing factor 3b subunit 3 2 2
MIRT488864 AUTS8 Autism, susceptibility to, 8 2 2
MIRT492293 SH2B3 SH2B adaptor protein 3 2 2
MIRT492976 NCK2 NCK adaptor protein 2 2 2
MIRT497410 LRRC40 leucine rich repeat containing 40 2 2
MIRT511143 MRPL17 mitochondrial ribosomal protein L17 2 6
MIRT512650 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT513017 NSFL1C NSFL1 cofactor 2 6
MIRT520445 TSPAN2 tetraspanin 2 2 6
MIRT527995 NDNF neuron derived neurotrophic factor 2 2
MIRT528667 PDE4DIP phosphodiesterase 4D interacting protein 2 2
MIRT533512 TRIM71 tripartite motif containing 71 2 2
MIRT537404 FBXO47 F-box protein 47 2 2
MIRT538161 DCP2 decapping mRNA 2 2 2
MIRT539124 ARHGEF17 Rho guanine nucleotide exchange factor 17 2 2
MIRT540666 MIS18A MIS18 kinetochore protein A 2 4
MIRT542948 GDF11 growth differentiation factor 11 2 2
MIRT547534 MAML3 mastermind like transcriptional coactivator 3 2 2
MIRT559033 C20orf24 chromosome 20 open reading frame 24 2 4
MIRT559554 ARF6 ADP ribosylation factor 6 2 2
MIRT570177 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT573149 ITGA9 integrin subunit alpha 9 2 2
MIRT575849 Rab1 RAB1A, member RAS oncogene family 1 1
MIRT611034 RRP1B ribosomal RNA processing 1B 2 2
MIRT616281 HMGB1 high mobility group box 1 2 2
MIRT618372 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619540 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT622303 SGIP1 SH3 domain GRB2 like endophilin interacting protein 1 2 2
MIRT622590 PRRG4 proline rich and Gla domain 4 2 2
MIRT624441 CAMK2N1 calcium/calmodulin dependent protein kinase II inhibitor 1 2 2
MIRT637089 KLRD1 killer cell lectin like receptor D1 2 2
MIRT639084 ADCYAP1 adenylate cyclase activating polypeptide 1 2 2
MIRT639334 NINJ1 ninjurin 1 2 2
MIRT639798 EIF3E eukaryotic translation initiation factor 3 subunit E 2 2
MIRT640851 RAB3B RAB3B, member RAS oncogene family 2 2
MIRT641628 KIAA1244 ARFGEF family member 3 1 1
MIRT642634 EPPIN epididymal peptidase inhibitor 2 2
MIRT643053 EPPIN-WFDC6 EPPIN-WFDC6 readthrough 2 2
MIRT643416 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT645586 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT647393 FAM181B family with sequence similarity 181 member B 2 2
MIRT649411 CDC14B cell division cycle 14B 2 2
MIRT649477 CLDN16 claudin 16 2 2
MIRT651307 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT651387 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT653411 SLC7A2 solute carrier family 7 member 2 2 2
MIRT654084 RSPH4A radial spoke head 4 homolog A 2 2
MIRT654613 PTPRM protein tyrosine phosphatase, receptor type M 2 2
MIRT655338 PCP4L1 Purkinje cell protein 4 like 1 2 2
MIRT656173 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT657272 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 2
MIRT657881 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT659875 CAPRIN1 cell cycle associated protein 1 2 2
MIRT662381 ICA1L islet cell autoantigen 1 like 2 4
MIRT666308 SLC22A3 solute carrier family 22 member 3 2 2
MIRT667274 NAV1 neuron navigator 1 2 2
MIRT667614 LIMCH1 LIM and calponin homology domains 1 2 2
MIRT674242 NUP62 nucleoporin 62 2 4
MIRT690386 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT693402 NUDT16 nudix hydrolase 16 2 2
MIRT702503 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT708632 STMN4 stathmin 4 2 2
MIRT708839 SCAND3 zinc finger BED-type containing 9 1 1
MIRT709016 HSBP1 heat shock factor binding protein 1 2 2
MIRT709235 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT710885 PARL presenilin associated rhomboid like 2 2
MIRT712262 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712573 ATP2B4 ATPase plasma membrane Ca2+ transporting 4 2 2
MIRT715046 PRPF38A pre-mRNA processing factor 38A 2 2
MIRT718905 GALR1 galanin receptor 1 2 2
MIRT719368 FEM1A fem-1 homolog A 2 2
MIRT719495 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719601 PRKX protein kinase, X-linked 2 2
MIRT719891 RRP36 ribosomal RNA processing 36 2 2
MIRT720063 ZNF449 zinc finger protein 449 2 2
MIRT721679 CMTM4 CKLF like MARVEL transmembrane domain containing 4 2 2
MIRT721724 VTI1A vesicle transport through interaction with t-SNAREs 1A 2 2
MIRT723370 ZNF470 zinc finger protein 470 2 2
MIRT724941 TXNL1 thioredoxin like 1 2 2
MIRT725302 NLRC5 NLR family CARD domain containing 5 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-452 Formaldehyde NULL 712 Microarray Human lung epithelial cells (A549) 21147603 2011 down-regulated
miR-452 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 up-regulated
miR-452 Tert-butyl hydroperoxide (t-BHP) NULL 6410 Microarray mouse auditory cells 20510889 2010 down-regulated
miR-452 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CP20)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-mir-452 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-mir-452 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-452-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-452-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-452-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (HCT8)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-452-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-452-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-452-3p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission