miRTarBase - #MIRT527996


—
pre-miRNA Information
pre-miRNA hsa-mir-6715b   
Genomic Coordinates chr10: 112299612 - 112299688
Description Homo sapiens miR-6715b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6715b-3p
Sequence 46| CUCAAACCGGCUGUGCCUGUGG |67
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs761643095 7 dbSNP
rs768295556 8 dbSNP
rs182337914 9 dbSNP
rs1369684979 11 dbSNP
rs776704371 13 dbSNP
rs1039819520 15 dbSNP
rs771110697 18 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol NDNF   
Synonyms C4orf31, NORD
Description neuron derived neurotrophic factor
Transcript NM_024574   
Expression
Putative miRNA Targets on NDNF
3'UTR of NDNF
(miRNA target sites are highlighted)		 
>NDNF|NM_024574|3'UTR
   1 TTACCTTCTTATAGAGATATATTATGTAGAACTCCAGGAGGGACATTAAATCACTTTAAGTATAAACTGACTACTCCCAC
  81 AGTTGAGAGAAGTTGTGACCTGTACTTGTACTATGGAAGGAAGGATATCAACGTGTGTATATTGATGTTTATATAAGTAA
 161 CTCTTGAAGGAGACTTGTTCTAGCGTGCCCCATGGTACCTAGTGTGTGTCTGATGCCGGTTGGTGTCAAAGATAGAGGGC
 241 TTCTTGAAGGAACTTGCCATTCCTTGCTTTGACCACTGCATGAACTGCTTCTAAATTATTTTATTACCTAAAAATTTAAA
 321 ATATGCCATTCATTGCACACACCCACAAATGCAAATCATTCCTCTCTGTAGATGCTAGGATATATATAAATTATTTTATA
 401 AATTCTTGTTTTAAATGTCAGTGTTTCTATGATTGTAAACTATTAAATTCTTTTCCTATTAAAGTACAGATCTAATCTAA
 481 GTATTATTAAGTTGATAGCCCTCTAGTCAGTTATATTGCTATTGTAAATTCTTGTTTGTTGAGTAAAATGTTTAAATACT
 561 ATATGTATCTCATGTACAAAGTTGACATACATTATATTCATGTACATAAAATTAAAGAGATTAGATTATATACTGTTAAA
 641 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gguguccguguCGGCCAAACuc 5'
                     ||||||| |  
Target 5' gtgtgtctgatGCCGGTTGGtg 3'
 204 - 225 103.00 -11.00
2 
miRNA  3' ggUGUCCG-UGUCGGCCAAACUc 5'
            |||| : | ||  | | ||| 
Target 5' ccACAGTTGAGAGAAGTTGTGAc 3'
 77 - 99 92.00 -10.73
3 
miRNA  3' gguguccgugucggccaAACUc 5'
                           |||| 
Target 5' gtatctcatgtacaaagTTGAc 3'
 565 - 586 80.00 -6.09
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31506969 8 COSMIC
COSN30177775 11 COSMIC
COSN30105698 14 COSMIC
COSN31581592 18 COSMIC
COSN31509648 29 COSMIC
COSN30472775 50 COSMIC
COSN30467592 52 COSMIC
COSN1286372 53 COSMIC
COSN30487131 54 COSMIC
COSN20123995 60 COSMIC
COSN30490092 64 COSMIC
COSN31524995 89 COSMIC
COSN14091104 113 COSMIC
COSN30505593 148 COSMIC
COSN30192967 152 COSMIC
COSN30508218 156 COSMIC
COSN15875511 162 COSMIC
COSN30171176 191 COSMIC
COSN31543328 193 COSMIC
COSN9900837 193 COSMIC
COSN16564653 199 COSMIC
COSN22451476 288 COSMIC
COSN31583385 303 COSMIC
COSN26553396 357 COSMIC
COSN31570607 382 COSMIC
COSN31540403 435 COSMIC
COSN31534962 450 COSMIC
COSN5051672 522 COSMIC
COSN31596110 535 COSMIC
COSN31489729 584 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs929056418 3 dbSNP
rs28738955 12 dbSNP
rs764127734 24 dbSNP
rs777492658 26 dbSNP
rs1196220007 32 dbSNP
rs756073951 34 dbSNP
rs553332697 42 dbSNP
rs1027070069 47 dbSNP
rs1234268259 58 dbSNP
rs975559344 63 dbSNP
rs964444939 66 dbSNP
rs1323974414 68 dbSNP
rs1378969161 72 dbSNP
rs72911671 73 dbSNP
rs1402443845 75 dbSNP
rs910783999 76 dbSNP
rs576981802 81 dbSNP
rs1403185334 87 dbSNP
rs1448927770 89 dbSNP
rs866026189 95 dbSNP
rs141548291 97 dbSNP
rs185502117 100 dbSNP
rs1031041930 101 dbSNP
rs1303744324 105 dbSNP
rs967862629 114 dbSNP
rs762069080 116 dbSNP
rs1261341416 117 dbSNP
rs567858630 120 dbSNP
rs1320019241 124 dbSNP
rs904444549 127 dbSNP
rs1232800503 131 dbSNP
rs1024427230 132 dbSNP
rs76137074 133 dbSNP
rs1193261698 134 dbSNP
rs1268450634 135 dbSNP
rs1454472872 148 dbSNP
rs948548733 151 dbSNP
rs534350474 154 dbSNP
rs1175198466 163 dbSNP
rs896344314 183 dbSNP
rs77235791 185 dbSNP
rs1171347632 189 dbSNP
rs1002135851 192 dbSNP
rs1458705945 199 dbSNP
rs1234039301 203 dbSNP
rs75596922 217 dbSNP
rs72911670 218 dbSNP
rs1404582878 219 dbSNP
rs908196630 220 dbSNP
rs982453298 222 dbSNP
rs563735146 223 dbSNP
rs929028776 228 dbSNP
rs931529171 231 dbSNP
rs920189501 237 dbSNP
rs1347440738 240 dbSNP
rs897563796 242 dbSNP
rs1242485475 250 dbSNP
rs1224341495 251 dbSNP
rs1040156401 256 dbSNP
rs1490286059 257 dbSNP
rs1377697578 280 dbSNP
rs1198329512 294 dbSNP
rs1266288514 303 dbSNP
rs1280117635 304 dbSNP
rs1478545231 306 dbSNP
rs964226068 318 dbSNP
rs749815697 328 dbSNP
rs910731745 330 dbSNP
rs986896014 331 dbSNP
rs1166756987 338 dbSNP
rs957044648 343 dbSNP
rs575181496 344 dbSNP
rs1030968794 348 dbSNP
rs780528843 351 dbSNP
rs1269681328 356 dbSNP
rs1359889466 365 dbSNP
rs1045080 368 dbSNP
rs1359226018 384 dbSNP
rs1220690782 385 dbSNP
rs977816162 386 dbSNP
rs1215977895 387 dbSNP
rs1241029800 395 dbSNP
rs1474133032 413 dbSNP
rs1183596394 417 dbSNP
rs561405003 424 dbSNP
rs750654517 432 dbSNP
rs1385748329 435 dbSNP
rs1021570575 437 dbSNP
rs967433401 439 dbSNP
rs1161464623 440 dbSNP
rs528684494 442 dbSNP
rs1401520018 450 dbSNP
rs894297877 450 dbSNP
rs1176083886 468 dbSNP
rs1057392335 474 dbSNP
rs572496459 476 dbSNP
rs886865345 481 dbSNP
rs565250745 483 dbSNP
rs1244370961 491 dbSNP
rs1311925611 495 dbSNP
rs545786409 499 dbSNP
rs1046682342 514 dbSNP
rs1033521363 516 dbSNP
rs1283113492 524 dbSNP
rs1189162466 526 dbSNP
rs1211585347 528 dbSNP
rs1485545586 531 dbSNP
rs1278504407 543 dbSNP
rs930995893 551 dbSNP
rs577018634 558 dbSNP
rs1382006872 561 dbSNP
rs556970051 572 dbSNP
rs149448747 574 dbSNP
rs1039919410 583 dbSNP
rs1027608170 587 dbSNP
rs1222082990 590 dbSNP
rs1405359176 591 dbSNP
rs1371111712 597 dbSNP
rs1285870003 600 dbSNP
rs942978986 601 dbSNP
rs993559384 604 dbSNP
rs897506316 606 dbSNP
rs1336792579 607 dbSNP
rs1040496838 611 dbSNP
rs987376024 620 dbSNP
rs1441894965 636 dbSNP
rs956780456 638 dbSNP
rs1348121512 644 dbSNP
rs1220553918 650 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 79625.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gguguccgugucggcCAAACUc 5'
                         |||||| 
Target 5' --gaugaacuucagaGUUUGA- 3'
 		1 - 19
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000379692.4 | 3UTR | GAUGAACUUCAGAGUUUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-6715b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080245 SMAD4 SMAD family member 4 2 2
MIRT142553 TNRC6A trinucleotide repeat containing 6A 2 4
MIRT384667 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT446660 MXI1 MAX interactor 1, dimerization protein 2 4
MIRT463754 YTHDC1 YTH domain containing 1 2 2
MIRT476873 FEM1B fem-1 homolog B 2 2
MIRT478429 DAZAP2 DAZ associated protein 2 2 2
MIRT495237 SPRY3 sprouty RTK signaling antagonist 3 2 4
MIRT495945 ANKRD52 ankyrin repeat domain 52 2 2
MIRT497116 TYW3 tRNA-yW synthesizing protein 3 homolog 2 2
MIRT497344 RPP25L ribonuclease P/MRP subunit p25 like 2 2
MIRT498133 KLHL3 kelch like family member 3 2 2
MIRT502306 GNA13 G protein subunit alpha 13 2 2
MIRT510854 RAN RAN, member RAS oncogene family 2 8
MIRT513323 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 6
MIRT523995 DTX4 deltex E3 ubiquitin ligase 4 2 4
MIRT525837 FAR2 fatty acyl-CoA reductase 2 2 2
MIRT527506 MYD88 myeloid differentiation primary response 88 2 2
MIRT527668 CIT citron rho-interacting serine/threonine kinase 2 2
MIRT527996 NDNF neuron derived neurotrophic factor 2 2
MIRT528052 MRS2 MRS2, magnesium transporter 2 2
MIRT528257 GPRIN2 G protein regulated inducer of neurite outgrowth 2 2 2
MIRT529401 ICK intestinal cell kinase 2 2
MIRT529558 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT530323 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT532230 KLF2 Kruppel like factor 2 2 2
MIRT534220 SLC35G1 solute carrier family 35 member G1 2 2
MIRT536195 MAML2 mastermind like transcriptional coactivator 2 2 2
MIRT538093 DEPDC1 DEP domain containing 1 2 2
MIRT543159 GTF2A1 general transcription factor IIA subunit 1 2 2
MIRT545840 ZNF264 zinc finger protein 264 2 4
MIRT546401 SRP9 signal recognition particle 9 2 2
MIRT550643 SLC39A7 solute carrier family 39 member 7 2 2
MIRT558648 CNKSR3 CNKSR family member 3 2 2
MIRT562208 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT562886 NACA2 nascent polypeptide associated complex alpha subunit 2 2 2
MIRT566786 MKL2 MKL1/myocardin like 2 2 2
MIRT567508 FOXC1 forkhead box C1 2 2
MIRT570235 CPNE5 copine 5 2 2
MIRT576823 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT610704 GPX6 glutathione peroxidase 6 2 2
MIRT611141 CRISP1 cysteine rich secretory protein 1 2 4
MIRT618100 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT619086 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT619716 FCF1 FCF1, rRNA-processing protein 2 2
MIRT620953 POLR2D RNA polymerase II subunit D 2 2
MIRT624645 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT624655 ARMC10 armadillo repeat containing 10 2 2
MIRT630778 KLHL42 kelch like family member 42 2 4
MIRT635596 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT637122 MKX mohawk homeobox 2 2
MIRT645527 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT647249 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT651508 WNT9A Wnt family member 9A 2 2
MIRT658721 ELK4 ELK4, ETS transcription factor 2 2
MIRT658804 EFNA5 ephrin A5 2 2
MIRT659319 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT664605 UGT3A1 UDP glycosyltransferase family 3 member A1 2 2
MIRT666047 STON2 stonin 2 2 2
MIRT672228 PDE7B phosphodiesterase 7B 2 2
MIRT683243 WFDC6 WAP four-disulfide core domain 6 2 2
MIRT686565 TPM3 tropomyosin 3 2 2
MIRT697560 ZBTB10 zinc finger and BTB domain containing 10 2 2
MIRT699294 SLC5A3 solute carrier family 5 member 3 2 2
MIRT707134 TRA2B transformer 2 beta homolog 2 2
MIRT712255 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT713896 IGF2R insulin like growth factor 2 receptor 2 2
MIRT716186 UBN2 ubinuclein 2 2 2
MIRT716525 KSR2 kinase suppressor of ras 2 2 2
MIRT716968 CNOT6 CCR4-NOT transcription complex subunit 6 2 2
MIRT717154 LRRC3C leucine rich repeat containing 3C 2 2
MIRT718669 LSM10 LSM10, U7 small nuclear RNA associated 2 2
MIRT722100 PTBP3 polypyrimidine tract binding protein 3 2 2
MIRT723569 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT724703 CRAMP1L cramped chromatin regulator homolog 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6715b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-6715b-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission