>UCHL3|NM_006002|3'UTR
   1 CTTGTCAATAATGGAAACACCAAAAACTGTATTATTTGCAACTAAATTTTCTCTGCCATACACTAACTCAAAAATTTTGA
  81 TATTTTCATTAACTTGATGATTAAACTTTATGTGAGTTAAACTTTGCCTTAACCTGTGTTTTATGTTATTTTTGCTCCAG
 161 GTTAAAGGTGCAATGCTTTCCTCCTCTTTTCTTGTGAAGGATTTATCT

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' agacuguCGGUCA-AACUCUUGUu 5' |:|| | ||: |||| Target 5' ----cttGTCAATAATGGAAACAc 3'	1 - 20	104.00	-5.10
2	miRNA 3' agacugucggucaAACUCUUguu 5' ||| ||| Target 5' tcctcctcttttcTTGTGAAgga 3'	179 - 201	78.00	-5.20
3	miRNA 3' agacugucGGU-CAAACUCU-UGUu 5' ||| ||| ||: :|| Target 5' tttttgctCCAGGTTAAAGGTGCAa 3'	149 - 173	63.00	-7.40

Mutant ID	Mutant Position	Mutant Source
COSN27001047	30	COSMIC
COSN26573426	44	COSMIC
COSN31556413	83	COSMIC
COSN31559481	93	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1270235998	1	dbSNP
rs1338192114	3	dbSNP
rs1194528647	8	dbSNP
rs1294666208	9	dbSNP
rs750019599	11	dbSNP
rs755549913	12	dbSNP
rs748891906	15	dbSNP
rs1355616099	21	dbSNP
rs1378103361	26	dbSNP
rs1430477847	31	dbSNP
rs1309249042	32	dbSNP
rs772458113	33	dbSNP
rs1217000483	35	dbSNP
rs1372517813	36	dbSNP
rs371424841	37	dbSNP
rs1370592857	41	dbSNP
rs887804108	43	dbSNP
rs1387056673	45	dbSNP
rs778053733	52	dbSNP
rs532076425	62	dbSNP
rs1467379798	72	dbSNP
rs762029977	74	dbSNP
rs1417188964	83	dbSNP
rs550058570	89	dbSNP
rs1258376951	92	dbSNP
rs896838375	94	dbSNP
rs2274048	95	dbSNP
rs1175553296	98	dbSNP
rs753348223	136	dbSNP
rs1236011347	143	dbSNP
rs1219055560	166	dbSNP
rs1354928589	168	dbSNP
rs112597363	170	dbSNP
rs532073619	177	dbSNP
rs952533788	185	dbSNP
rs1323981106	187	dbSNP
rs1314267146	201	dbSNP
rs757726253	202	dbSNP
rs1033818817	204	dbSNP

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.