miRTarBase - #MIRT528111


—
pre-miRNA Information
pre-miRNA hsa-mir-4763   
Genomic Coordinates chr22: 46113566 - 46113657
Description Homo sapiens miR-4763 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4763-5p
Sequence 19| CGCCUGCCCAGCCCUCCUGCU |39
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs374776264 1 dbSNP
rs1174502793 2 dbSNP
rs966122637 3 dbSNP
rs891363409 6 dbSNP
rs1303008773 8 dbSNP
rs1446379219 11 dbSNP
rs1410535134 13 dbSNP
rs1424733379 14 dbSNP
rs1372551711 16 dbSNP
rs756995936 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FOXH1   
Synonyms FAST-1, FAST1
Description forkhead box H1
Transcript NM_003923   
Expression
Putative miRNA Targets on FOXH1
3'UTR of FOXH1
(miRNA target sites are highlighted)		 
>FOXH1|NM_003923|3'UTR
   1 GGCTCTTAAGACAGGGGCCACTCCTCCCTCCCGCTCCCACCCCCACCTTGTTGACAGGGAGCCAAGGCGAGGCGGCTGTC
  81 TGCGACCACAGCAGCCTCGAAACACCAGGCAGCAGCCTTGCTGGGAGTCCACGGTGTTTATTGGGCCACCCCACGCATGG
 161 CCGTGGCCCAGCTGGGCACAACCCTCACCCTGGTCTGTCATGCCTGTTTTTCCTACACTCAGCGGCAAAGCTGCAGGAGC
 241 AGGGCTGAGCCTGGAATAGCCCTTCCTAGTCCCCTCTTCTCAGCCCACTACCCATCCATCAGTCACCAGCCGTCACCTCC
 321 CCTCCCGTGCTCCAGGCTGGGGGAGGGAGAGCCCAGTGGTGGATCCAGCCTGAAGTCCTGCCCTCTCTCATCTGTCTGGA
 401 AAGGAGGTAGCACCTTTTTCGGGAAACGGGTTAGGGAGTAAAGACTGCACCCTACATGGTCCTGGTGGTGGGGGGGATAA
 481 CAGTAAAGGAATTTGCAACGTTTTAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGUCCUCCCGACCCG-UCCGc 5'
            ||||: | |  ||| |||| 
Target 5' gaCAGGGAGCCAAGGCGAGGCg 3'
 53 - 74 127.00 -21.20
2 
miRNA  3' ucGUCCUCCCGACCCGUCCgc 5'
            |:| |  |||  |||||  
Target 5' agCGGCAAAGCT--GCAGGag 3'
 221 - 239 106.00 -13.90
3 
miRNA  3' ucguccucCCGA-CCCGUCCgc 5'
                  |||| ||| |||  
Target 5' gtgctccaGGCTGGGGGAGGga 3'
 327 - 348 105.00 -17.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
259199 20 ClinVar
910871 21 ClinVar
362277 23 ClinVar
362276 55 ClinVar
362275 74 ClinVar
909984 88 ClinVar
362274 172 ClinVar
909983 233 ClinVar
362273 240 ClinVar
362272 311 ClinVar
909982 322 ClinVar
909981 354 ClinVar
909980 382 ClinVar
909979 423 ClinVar
909138 430 ClinVar
909137 436 ClinVar
362271 451 ClinVar
362270 472 ClinVar
COSN28731582 20 COSMIC
COSN31491426 42 COSMIC
COSN30124807 47 COSMIC
COSN32053249 83 COSMIC
COSN26575534 380 COSMIC
COSN19361542 645 COSMIC
COSN19148510 661 COSMIC
COSN22451873 697 COSMIC
COSN28858537 719 COSMIC
COSM9549440 795 COSMIC
COSM6695766 800 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs201981529 1 dbSNP
rs373032613 3 dbSNP
rs757036642 4 dbSNP
rs1181935936 5 dbSNP
rs1264277355 6 dbSNP
rs751324327 10 dbSNP
rs763785097 12 dbSNP
rs1246807407 13 dbSNP
rs941933747 14 dbSNP
rs764396529 15 dbSNP
rs369265305 16 dbSNP
rs1273557050 18 dbSNP
rs530636645 19 dbSNP
rs2721176 20 dbSNP
rs777157477 22 dbSNP
rs541830947 23 dbSNP
rs763529908 24 dbSNP
rs1368142662 25 dbSNP
rs923115366 26 dbSNP
rs773702679 28 dbSNP
rs748310499 32 dbSNP
rs1168252418 33 dbSNP
rs1483920965 34 dbSNP
rs774581690 36 dbSNP
rs1375174460 38 dbSNP
rs367916293 40 dbSNP
rs1255308527 43 dbSNP
rs745820912 44 dbSNP
rs1442559638 45 dbSNP
rs781228976 46 dbSNP
rs1202225044 47 dbSNP
rs1382471625 48 dbSNP
rs1440521158 49 dbSNP
rs757117725 50 dbSNP
rs192907579 55 dbSNP
rs990078092 56 dbSNP
rs541365013 61 dbSNP
rs1467588364 63 dbSNP
rs1303946289 68 dbSNP
rs1034540258 71 dbSNP
rs770161398 72 dbSNP
rs980308408 73 dbSNP
rs562738425 74 dbSNP
rs1239009328 75 dbSNP
rs368718619 83 dbSNP
rs558828457 84 dbSNP
rs1024459830 88 dbSNP
rs1318129170 92 dbSNP
rs1261998528 93 dbSNP
rs1210143173 95 dbSNP
rs1013785917 99 dbSNP
rs763466873 100 dbSNP
rs1332769039 112 dbSNP
rs1301807740 114 dbSNP
rs1390742252 117 dbSNP
rs575923954 123 dbSNP
rs1370978080 124 dbSNP
rs1176840726 127 dbSNP
rs1405988945 129 dbSNP
rs1435038507 133 dbSNP
rs897543268 141 dbSNP
rs1014601071 147 dbSNP
rs1429249068 149 dbSNP
rs1005867099 158 dbSNP
rs1299649281 159 dbSNP
rs894675425 162 dbSNP
rs537111394 163 dbSNP
rs1050798851 167 dbSNP
rs148389554 172 dbSNP
rs1369270423 177 dbSNP
rs1379886988 178 dbSNP
rs1219375520 183 dbSNP
rs901712027 184 dbSNP
rs1299952520 187 dbSNP
rs1321390618 192 dbSNP
rs939705547 195 dbSNP
rs1200282408 197 dbSNP
rs1202164482 199 dbSNP
rs1231457677 206 dbSNP
rs1418980534 212 dbSNP
rs1489569244 213 dbSNP
rs1248909786 217 dbSNP
rs1191892055 220 dbSNP
rs912468825 224 dbSNP
rs1040201856 225 dbSNP
rs554640776 232 dbSNP
rs11781640 233 dbSNP
rs779715976 237 dbSNP
rs921123430 239 dbSNP
rs550365735 240 dbSNP
rs565774335 240 dbSNP
rs913282679 241 dbSNP
rs924719616 244 dbSNP
rs1212624895 245 dbSNP
rs1291727074 246 dbSNP
rs990130371 251 dbSNP
rs547665270 253 dbSNP
rs1256058416 254 dbSNP
rs971455933 255 dbSNP
rs1238307009 256 dbSNP
rs1315026924 257 dbSNP
rs1291231370 259 dbSNP
rs1311228555 263 dbSNP
rs1489885441 263 dbSNP
rs1447191018 265 dbSNP
rs1377945697 271 dbSNP
rs1024964399 273 dbSNP
rs1336248315 274 dbSNP
rs538984852 275 dbSNP
rs1475356606 276 dbSNP
rs927284790 276 dbSNP
rs958964760 279 dbSNP
rs1173200511 280 dbSNP
rs1162549833 288 dbSNP
rs1453711568 289 dbSNP
rs1027750819 291 dbSNP
rs1421061360 298 dbSNP
rs571463697 302 dbSNP
rs1298237421 310 dbSNP
rs74360910 311 dbSNP
rs1428575251 312 dbSNP
rs1285836678 313 dbSNP
rs1379631332 316 dbSNP
rs994975344 321 dbSNP
rs1440626432 322 dbSNP
rs1218941113 326 dbSNP
rs898200689 337 dbSNP
rs1214317151 338 dbSNP
rs1239665012 339 dbSNP
rs971671803 339 dbSNP
rs1004280685 343 dbSNP
rs759346959 346 dbSNP
rs1158819501 350 dbSNP
rs1383655444 369 dbSNP
rs1181428631 370 dbSNP
rs972886689 371 dbSNP
rs1359662923 372 dbSNP
rs1443764535 375 dbSNP
rs961808166 382 dbSNP
rs1014651228 383 dbSNP
rs1380918156 385 dbSNP
rs921188687 387 dbSNP
rs1256299495 390 dbSNP
rs1350060743 390 dbSNP
rs1203998128 392 dbSNP
rs1054249204 402 dbSNP
rs1281431985 404 dbSNP
rs530494486 407 dbSNP
rs935886180 408 dbSNP
rs1288001932 412 dbSNP
rs887464815 413 dbSNP
rs1240608877 414 dbSNP
rs1358549439 420 dbSNP
rs1312630888 421 dbSNP
rs1028654086 422 dbSNP
rs1362803083 423 dbSNP
rs1468209929 424 dbSNP
rs1173821200 434 dbSNP
rs1425842451 435 dbSNP
rs996532017 438 dbSNP
rs1288379110 439 dbSNP
rs977561598 446 dbSNP
rs971785362 447 dbSNP
rs1329859408 448 dbSNP
rs886062751 451 dbSNP
rs569747071 456 dbSNP
rs1040615839 457 dbSNP
rs1381661053 465 dbSNP
rs945862026 467 dbSNP
rs1237024867 468 dbSNP
rs1359187306 469 dbSNP
rs891894909 470 dbSNP
rs1054498237 471 dbSNP
rs576710211 472 dbSNP
rs1261740347 475 dbSNP
rs1420823777 476 dbSNP
rs1385055403 477 dbSNP
rs771753880 478 dbSNP
rs1249466815 483 dbSNP
rs958914878 488 dbSNP
rs927326144 489 dbSNP
rs980090982 491 dbSNP
rs1200434767 493 dbSNP
rs1027865239 497 dbSNP
rs1479802288 498 dbSNP
rs373793992 499 dbSNP
rs950350743 507 dbSNP
rs1425669050 508 dbSNP
rs1466006173 511 dbSNP
rs917484050 513 dbSNP
rs972909820 514 dbSNP
rs762053515 517 dbSNP
rs1325726363 524 dbSNP
rs1191868636 525 dbSNP
rs1015749418 531 dbSNP
rs910030118 535 dbSNP
rs1342936942 536 dbSNP
rs1228669392 537 dbSNP
rs1426155313 540 dbSNP
rs1264702429 543 dbSNP
rs1337800547 543 dbSNP
rs984577095 545 dbSNP
rs879837025 548 dbSNP
rs951766068 549 dbSNP
rs1029085050 557 dbSNP
rs1265295376 563 dbSNP
rs995819341 564 dbSNP
rs370490193 565 dbSNP
rs899745635 565 dbSNP
rs996515753 565 dbSNP
rs370078082 569 dbSNP
rs1217326983 574 dbSNP
rs745503715 578 dbSNP
rs529692611 580 dbSNP
rs1289360062 583 dbSNP
rs776981240 584 dbSNP
rs796397414 588 dbSNP
rs1366409562 590 dbSNP
rs1358756982 591 dbSNP
rs1284932666 595 dbSNP
rs1424173114 598 dbSNP
rs891654756 601 dbSNP
rs1301338964 604 dbSNP
rs1342993341 605 dbSNP
rs903039516 606 dbSNP
rs1226955316 607 dbSNP
rs1338592472 612 dbSNP
rs1325054891 618 dbSNP
rs1247369745 619 dbSNP
rs1054215807 626 dbSNP
rs1280143840 630 dbSNP
rs1000272113 632 dbSNP
rs1401185995 633 dbSNP
rs1485883815 634 dbSNP
rs1204479690 635 dbSNP
rs1259501320 636 dbSNP
rs917340532 643 dbSNP
rs1322016269 644 dbSNP
rs1407378845 645 dbSNP
rs1391014778 646 dbSNP
rs905906809 647 dbSNP
rs1167031644 651 dbSNP
rs1444215989 654 dbSNP
rs375461784 657 dbSNP
rs1425212753 658 dbSNP
rs1193703346 662 dbSNP
rs1454315915 663 dbSNP
rs1288812870 664 dbSNP
rs1383424159 667 dbSNP
rs1480081483 669 dbSNP
rs1398196179 673 dbSNP
rs1337775587 674 dbSNP
rs1382430987 683 dbSNP
rs1310905552 688 dbSNP
rs1266613768 689 dbSNP
rs950051571 695 dbSNP
rs1200736907 697 dbSNP
rs1258957642 699 dbSNP
rs188887895 700 dbSNP
rs368758656 702 dbSNP
rs940251620 706 dbSNP
rs559438262 707 dbSNP
rs183946498 712 dbSNP
rs951891187 726 dbSNP
rs920838189 727 dbSNP
rs1362615828 728 dbSNP
rs1471254943 730 dbSNP
rs1219279935 731 dbSNP
rs1345451417 732 dbSNP
rs1250382669 739 dbSNP
rs1205462366 744 dbSNP
rs1453376851 746 dbSNP
rs1481380387 747 dbSNP
rs1254043360 748 dbSNP
rs1232173039 749 dbSNP
rs921681358 750 dbSNP
rs532459382 751 dbSNP
rs1373598899 752 dbSNP
rs1285175238 753 dbSNP
rs973710216 754 dbSNP
rs374547620 755 dbSNP
rs1307456041 757 dbSNP
rs777539592 760 dbSNP
rs1398841939 763 dbSNP
rs965769299 764 dbSNP
rs1015071857 765 dbSNP
rs1465915181 766 dbSNP
rs758060465 768 dbSNP
rs1179255311 771 dbSNP
rs1321170926 772 dbSNP
rs1200293299 773 dbSNP
rs752298180 774 dbSNP
rs762538448 775 dbSNP
rs764686161 777 dbSNP
rs1420506708 778 dbSNP
rs1481068547 779 dbSNP
rs955109874 780 dbSNP
rs754557940 781 dbSNP
rs1483484172 784 dbSNP
rs1264739869 788 dbSNP
rs1206778507 789 dbSNP
rs753268294 792 dbSNP
rs775848728 792 dbSNP
rs1018547532 793 dbSNP
rs766970193 795 dbSNP
rs761086073 798 dbSNP
rs371342935 802 dbSNP
rs1172944908 806 dbSNP
rs1354805131 808 dbSNP
rs1337611201 810 dbSNP
rs899526495 811 dbSNP
rs768944021 813 dbSNP
rs1032909283 814 dbSNP
rs1404968472 816 dbSNP
rs767932639 818 dbSNP
rs1000092735 819 dbSNP
rs376745034 822 dbSNP
rs774671659 823 dbSNP
rs768728856 825 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 8928.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucguccucCCGA--CCCGUCCgc 5'
                  ||||  ||||:||  
Target 5' --------GGCUGGGGGCGGGgg 3'
 		1 - 15
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000377317.4 | 3UTR | GGCUGGGGGCGGGGGGUGAUCACUUCAGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-4763-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT116035 DEPDC1 DEP domain containing 1 2 2
MIRT347197 SIN3B SIN3 transcription regulator family member B 2 2
MIRT443248 C9orf170 chromosome 9 open reading frame 170 2 2
MIRT475164 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT495486 VTI1B vesicle transport through interaction with t-SNAREs 1B 2 2
MIRT496755 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT496863 C21orf2 chromosome 21 open reading frame 2 2 2
MIRT499264 NBPF11 NBPF member 11 2 2
MIRT499517 MAFK MAF bZIP transcription factor K 2 2
MIRT512952 MKI67 marker of proliferation Ki-67 2 2
MIRT514656 NUP93 nucleoporin 93 2 2
MIRT517986 SLC16A13 solute carrier family 16 member 13 2 2
MIRT522816 KLHL9 kelch like family member 9 2 4
MIRT525495 CD63 CD63 molecule 2 2
MIRT528111 FOXH1 forkhead box H1 2 2
MIRT531683 MYO3A myosin IIIA 2 2
MIRT534806 RAB37 RAB37, member RAS oncogene family 2 2
MIRT573041 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT576720 Wars tryptophanyl-tRNA synthetase 2 2
MIRT609727 MLXIPL MLX interacting protein like 2 2
MIRT610843 FAM180B family with sequence similarity 180 member B 2 4
MIRT614735 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT616981 EPOR erythropoietin receptor 2 2
MIRT617265 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT619405 INTS7 integrator complex subunit 7 2 2
MIRT621832 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT621893 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT630263 SMIM14 small integral membrane protein 14 2 2
MIRT634879 SENP8 SUMO/sentrin peptidase family member, NEDD8 specific 2 2
MIRT636863 ARSE arylsulfatase E (chondrodysplasia punctata 1) 2 2
MIRT637653 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT637699 ZNF439 zinc finger protein 439 2 2
MIRT637759 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT638193 TAOK1 TAO kinase 1 2 2
MIRT638996 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT642221 RABAC1 Rab acceptor 1 2 2
MIRT643327 ATCAY ATCAY, caytaxin 2 4
MIRT643419 ERVMER34-1 endogenous retrovirus group MER34 member 1, envelope 2 2
MIRT644499 RNF14 ring finger protein 14 2 2
MIRT644603 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT644795 C21orf59 chromosome 21 open reading frame 59 2 2
MIRT648732 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT653856 SHE Src homology 2 domain containing E 2 2
MIRT654129 RPL14 ribosomal protein L14 2 4
MIRT658876 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 2
MIRT671624 C20orf144 chromosome 20 open reading frame 144 2 4
MIRT677367 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677579 TRIM65 tripartite motif containing 65 2 2
MIRT678220 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT679613 RRP36 ribosomal RNA processing 36 2 2
MIRT686081 PNPLA3 patatin like phospholipase domain containing 3 2 2
MIRT691817 ICA1L islet cell autoantigen 1 like 2 2
MIRT693869 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT694544 BPNT1 3'(2'), 5'-bisphosphate nucleotidase 1 2 2
MIRT694926 ANKS4B ankyrin repeat and sterile alpha motif domain containing 4B 2 2
MIRT697758 USP37 ubiquitin specific peptidase 37 2 2
MIRT697891 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT701569 MYPN myopalladin 2 2
MIRT703081 GPRIN3 GPRIN family member 3 2 2
MIRT708104 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT708320 NT5C 5', 3'-nucleotidase, cytosolic 2 2
MIRT709878 TRAF1 TNF receptor associated factor 1 2 2
MIRT713545 GJB1 gap junction protein beta 1 2 2
MIRT716275 NUP85 nucleoporin 85 2 2
MIRT716621 CRCP CGRP receptor component 2 2
MIRT717987 C9orf171 cilia and flagella associated protein 77 2 2
MIRT718438 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT722544 AGPAT4 1-acylglycerol-3-phosphate O-acyltransferase 4 2 2
MIRT724013 F2RL1 F2R like trypsin receptor 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-mir-4763 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4763 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4763-5p Anthracycline 30323 NSC82151 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Fluorouracil 3385 NSC19893 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Cyclophosphamide 2907 NSC26271 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Methotrexate 126941 NSC740 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Taxol 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-4763-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4763-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-4763-5p Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-4763-5p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4763-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission