miRTarBase - #MIRT528141


—
pre-miRNA Information
pre-miRNA hsa-mir-6867   
Genomic Coordinates chr17: 40193597 - 40193663
Description Homo sapiens miR-6867 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6867-3p
Sequence 47| CUCUCCCUCUUUACCCACUAG |67
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM7811173 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1403216522 1 dbSNP
rs781776276 3 dbSNP
rs202050374 4 dbSNP
rs367842831 5 dbSNP
rs1223489976 6 dbSNP
rs907256096 9 dbSNP
rs753257137 14 dbSNP
rs757843554 17 dbSNP
rs371369162 18 dbSNP
Putative Targets

Gene Information
Gene Symbol LRRC38
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 126755.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaUCACCCAUUUCUCCCUCuc 5'
            :||| ||:  |:|||||  
Target 5' --GGUGUGUGUUGGGGGAG-- 3'
 		1 - 17
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000376085.3 | 3UTR | GGUGUGUGUUGGGGGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
203 hsa-miR-6867-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT078229 DYNLL2 dynein light chain LC8-type 2 2 2
MIRT107799 SLC1A1 solute carrier family 1 member 1 2 2
MIRT115808 CAPN15 calpain 15 2 2
MIRT137570 RCOR1 REST corepressor 1 2 2
MIRT161372 MBNL1 muscleblind like splicing regulator 1 2 2
MIRT320477 HOXA10 homeobox A10 2 2
MIRT444449 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT461305 MRPS27 mitochondrial ribosomal protein S27 2 6
MIRT470306 PPP6R1 protein phosphatase 6 regulatory subunit 1 2 2
MIRT471679 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT475546 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 2
MIRT480901 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT489368 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT489557 PLD6 phospholipase D family member 6 2 2
MIRT494969 TMEM233 transmembrane protein 233 2 2
MIRT496634 SLC46A1 solute carrier family 46 member 1 2 2
MIRT500259 ZNF788 zinc finger family member 788 2 6
MIRT500272 ZNF781 zinc finger protein 781 2 8
MIRT500328 ZNF487P zinc finger protein 487 1 3
MIRT504012 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT504830 EREG epiregulin 2 2
MIRT513588 DCTN6 dynactin subunit 6 2 2
MIRT520896 STMN1 stathmin 1 2 2
MIRT525275 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT526166 ANKRD65 ankyrin repeat domain 65 2 2
MIRT526582 CCDC43 coiled-coil domain containing 43 2 2
MIRT527812 TMEM74B transmembrane protein 74B 2 2
MIRT528141 LRRC38 leucine rich repeat containing 38 2 2
MIRT529903 C1orf64 steroid receptor associated and regulated protein 2 4
MIRT531980 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT532251 TBPL2 TATA-box binding protein like 2 2 2
MIRT534300 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT534879 QKI QKI, KH domain containing RNA binding 2 2
MIRT538305 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT539385 ADRB1 adrenoceptor beta 1 2 2
MIRT541304 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT543960 RNF20 ring finger protein 20 2 2
MIRT544380 ZNF266 zinc finger protein 266 2 2
MIRT544451 KRBOX4 KRAB box domain containing 4 2 2
MIRT545783 ZNF791 zinc finger protein 791 2 4
MIRT548156 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT556660 KMT2D lysine methyltransferase 2D 2 4
MIRT557715 GABARAPL1 GABA type A receptor associated protein like 1 2 2
MIRT562701 ZNF415 zinc finger protein 415 2 2
MIRT563050 ZNF138 zinc finger protein 138 2 2
MIRT564307 CCNT1 cyclin T1 2 2
MIRT568333 BACH1 BTB domain and CNC homolog 1 2 2
MIRT570864 ZNF525 zinc finger protein 525 2 2
MIRT570874 ZFP1 ZFP1 zinc finger protein 2 2
MIRT571516 ZNF625 zinc finger protein 625 2 2
MIRT572470 MTMR10 myotubularin related protein 10 2 2
MIRT572898 RUNDC3B RUN domain containing 3B 2 2
MIRT573084 APLN apelin 2 2
MIRT575251 Timp3 tissue inhibitor of metalloproteinase 3 2 2
MIRT575275 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 2 2
MIRT607230 LINS lines homolog 1 2 4
MIRT611803 FCRL4 Fc receptor like 4 2 2
MIRT612669 POU2F1 POU class 2 homeobox 1 2 4
MIRT612739 MYOCD myocardin 2 2
MIRT613409 CDH8 cadherin 8 2 4
MIRT614007 PAOX polyamine oxidase 2 2
MIRT615188 CLUAP1 clusterin associated protein 1 2 2
MIRT616497 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT616524 URM1 ubiquitin related modifier 1 2 2
MIRT617066 SPIB Spi-B transcription factor 2 2
MIRT617813 EMX2 empty spiracles homeobox 2 2 2
MIRT619291 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT619375 KLHL12 kelch like family member 12 2 2
MIRT619499 TXLNB taxilin beta 2 2
MIRT619601 MKKS McKusick-Kaufman syndrome 2 2
MIRT619754 MYO1F myosin IF 2 2
MIRT619976 ZSCAN22 zinc finger and SCAN domain containing 22 2 2
MIRT620743 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT620871 KCTD7 potassium channel tetramerization domain containing 7 2 2
MIRT621380 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT621511 ZNF638 zinc finger protein 638 2 2
MIRT621537 ZNF500 zinc finger protein 500 2 2
MIRT621772 TMEM87B transmembrane protein 87B 2 2
MIRT622193 SLC5A12 solute carrier family 5 member 12 2 2
MIRT622319 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT622738 PITPNM3 PITPNM family member 3 2 2
MIRT622996 ONECUT3 one cut homeobox 3 2 2
MIRT625301 SHISA6 shisa family member 6 2 2
MIRT625637 KCNQ3 potassium voltage-gated channel subfamily Q member 3 2 2
MIRT627698 RFFL ring finger and FYVE like domain containing E3 ubiquitin protein ligase 2 2
MIRT627751 RAD51L3-RFFL RAD51L3-RFFL readthrough 2 2
MIRT628438 ANTXR2 anthrax toxin receptor 2 2 2
MIRT635440 SLC25A44 solute carrier family 25 member 44 2 2
MIRT637166 TMEM50A transmembrane protein 50A 2 2
MIRT638207 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT639288 TFAP2A transcription factor AP-2 alpha 2 4
MIRT639398 NEURL1B neuralized E3 ubiquitin protein ligase 1B 2 2
MIRT641230 SEMA3E semaphorin 3E 2 2
MIRT641501 STC2 stanniocalcin 2 2 2
MIRT642577 PSTPIP1 proline-serine-threonine phosphatase interacting protein 1 2 2
MIRT642735 TDRD6 tudor domain containing 6 2 2
MIRT644001 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644210 CBS cystathionine-beta-synthase 2 2
MIRT645405 FAM110A family with sequence similarity 110 member A 2 2
MIRT645685 TBC1D13 TBC1 domain family member 13 2 2
MIRT645699 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT645761 SURF6 surfeit 6 2 2
MIRT645826 INADL PATJ, crumbs cell polarity complex component 2 2
MIRT645914 PLXNA3 plexin A3 2 2
MIRT646167 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646634 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
MIRT647547 CYP2B6 cytochrome P450 family 2 subfamily B member 6 2 2
MIRT648262 ZNF582 zinc finger protein 582 2 2
MIRT648385 ZNF22 zinc finger protein 22 2 2
MIRT648629 LEMD2 LEM domain containing 2 2 2
MIRT649353 SLC27A2 solute carrier family 27 member 2 2 2
MIRT649395 SH2D4A SH2 domain containing 4A 2 2
MIRT650241 CD68 CD68 molecule 2 2
MIRT650379 PTGIS prostaglandin I2 synthase 2 2
MIRT650705 KRT32 keratin 32 2 2
MIRT650854 UNC13D unc-13 homolog D 2 2
MIRT651042 ZNF644 zinc finger protein 644 2 2
MIRT651102 ZNF48 zinc finger protein 48 2 2
MIRT651130 ZNF398 zinc finger protein 398 2 2
MIRT652089 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT652200 TRIM33 tripartite motif containing 33 2 2
MIRT652422 TMEM239 transmembrane protein 239 2 2
MIRT652755 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT653201 SP9 Sp9 transcription factor 2 2
MIRT653338 SMG7 SMG7, nonsense mediated mRNA decay factor 2 2
MIRT653715 SLC25A32 solute carrier family 25 member 32 2 2
MIRT654456 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT654499 RABIF RAB interacting factor 2 2
MIRT654678 PSMB5 proteasome subunit beta 5 2 2
MIRT655162 PHF20L1 PHD finger protein 20 like 1 2 2
MIRT655540 PADI2 peptidyl arginine deiminase 2 2 4
MIRT655850 NFE2L1 nuclear factor, erythroid 2 like 1 2 2
MIRT656248 MEX3A mex-3 RNA binding family member A 2 2
MIRT656581 LSAMP limbic system-associated membrane protein 2 2
MIRT657597 GRID1 glutamate ionotropic receptor delta type subunit 1 2 2
MIRT657824 GJD3 gap junction protein delta 3 2 2
MIRT658466 FAM102B family with sequence similarity 102 member B 2 2
MIRT659083 DENR density regulated re-initiation and release factor 2 2
MIRT659196 CYBB cytochrome b-245 beta chain 2 2
MIRT659558 CGGBP1 CGG triplet repeat binding protein 1 2 2
MIRT659860 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660172 BNC2 basonuclin 2 2 2
MIRT660626 ANKRD52 ankyrin repeat domain 52 2 2
MIRT660917 ADAM19 ADAM metallopeptidase domain 19 2 2
MIRT660979 ABHD2 abhydrolase domain containing 2 2 2
MIRT661564 EPHX2 epoxide hydrolase 2 2 2
MIRT662214 CCRL2 C-C motif chemokine receptor like 2 2 2
MIRT662246 C15orf52 chromosome 15 open reading frame 52 2 2
MIRT662560 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT662591 MAGEB4 MAGE family member B4 2 2
MIRT663294 TECPR2 tectonin beta-propeller repeat containing 2 2 2
MIRT663437 FBXO2 F-box protein 2 2 2
MIRT663811 RNF128 ring finger protein 128, E3 ubiquitin protein ligase 2 2
MIRT663821 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT665959 SZRD1 SUZ RNA binding domain containing 1 2 2
MIRT666115 SRRM4 serine/arginine repetitive matrix 4 2 2
MIRT667448 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT669330 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT669409 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT669641 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT672663 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT673266 RUNDC1 RUN domain containing 1 2 2
MIRT676995 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT679290 SSBP2 single stranded DNA binding protein 2 2 2
MIRT687508 NCKAP1 NCK associated protein 1 2 2
MIRT698932 SPATA2 spermatogenesis associated 2 2 2
MIRT700852 PERP PERP, TP53 apoptosis effector 2 2
MIRT702426 KIAA1958 KIAA1958 2 2
MIRT703939 EPB41L1 erythrocyte membrane protein band 4.1 like 1 2 2
MIRT708962 SLC12A3 solute carrier family 12 member 3 2 2
MIRT709742 UBD ubiquitin D 2 2
MIRT709946 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT711121 CYYR1 cysteine and tyrosine rich 1 2 2
MIRT711217 RETSAT retinol saturase 2 2
MIRT711576 ASPA aspartoacylase 2 2
MIRT711599 LHX5 LIM homeobox 5 2 2
MIRT712232 RCC2 regulator of chromosome condensation 2 2 2
MIRT713317 TMEM44 transmembrane protein 44 2 2
MIRT713510 PAFAH2 platelet activating factor acetylhydrolase 2 2 2
MIRT713543 GJB1 gap junction protein beta 1 2 2
MIRT713621 MED8 mediator complex subunit 8 2 2
MIRT714988 TSPAN11 tetraspanin 11 2 2
MIRT715449 PTCD1 pentatricopeptide repeat domain 1 2 2
MIRT715575 ATP5J2-PTCD1 ATP5J2-PTCD1 readthrough 2 2
MIRT715771 DDX42 DEAD-box helicase 42 2 2
MIRT715887 GNG2 G protein subunit gamma 2 2 2
MIRT716091 HARS histidyl-tRNA synthetase 2 2
MIRT717403 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT717965 PXMP4 peroxisomal membrane protein 4 2 2
MIRT718324 METTL7A methyltransferase like 7A 2 2
MIRT718628 DIP2A disco interacting protein 2 homolog A 2 2
MIRT719213 CAMK4 calcium/calmodulin dependent protein kinase IV 2 2
MIRT719234 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT719817 LRRC4 leucine rich repeat containing 4 2 2
MIRT719978 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT720480 TMEM178B transmembrane protein 178B 2 2
MIRT720713 RAPGEF6 Rap guanine nucleotide exchange factor 6 2 2
MIRT721006 ZNF619 zinc finger protein 619 2 2
MIRT721741 SDK2 sidekick cell adhesion molecule 2 2 2
MIRT723547 ZDHHC22 zinc finger DHHC-type containing 22 2 2
MIRT723596 FKRP fukutin related protein 2 2
MIRT723746 AIFM2 apoptosis inducing factor, mitochondria associated 2 2 2
MIRT724784 C1D C1D nuclear receptor corepressor 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6867-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)

Error report submission