miRTarBase - #MIRT528194


—
pre-miRNA Information
pre-miRNA hsa-mir-3622b   
Genomic Coordinates chr8: 27701673 - 27701767
Description Homo sapiens miR-3622b stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3622b-3p
Sequence 58| UCACCUGAGCUCCCGUGCCUG |78
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1232922758 2 dbSNP
rs530939348 5 dbSNP
rs1439657384 10 dbSNP
rs1157333896 12 dbSNP
rs66683138 14 dbSNP
rs1044808718 15 dbSNP
rs946438979 19 dbSNP
rs551845360 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PLEKHM2   
Synonyms SKIP
Description pleckstrin homology and RUN domain containing M2
Transcript NM_015164   
Expression
Putative miRNA Targets on PLEKHM2
3'UTR of PLEKHM2
(miRNA target sites are highlighted)		 
>PLEKHM2|NM_015164|3'UTR
   1 GGCAGAGCTGGTTGGCGTCCCTGGTGGGCAGGAAAGGAAGGCACGCCAGCCGGCAGGCACACTGTCACGGCTGTTGTCAT
  81 GCTGTCGGGAGCCTACAGTCCACCCCTGCCCTGGGCGGCAGAACCACCGAGTGTGGCTTAAGACAGGGTCCCTCCACTCC
 161 AGGGATCCAGATCAGGTGCCCGGCACCCCTGGGCATCCTGCCCGACAGGTAGCGAATGGAGGTCGCTGGGGGCAGAGGGT
 241 CCGAGCCCTGTGGGCTCTGCGGATGCACGCCCTCCTCCCGGGCCTCCGCCTCAGTCTGCAGAATTTCTGCCGAGTGGCAC
 321 CGAGAACACCATCCATCTAAGGACGAACAAAAGAACCAGGAGGGCGGGACCCCCCTCTTCCTCTCCTGGGTTGGGGGCTG
 401 GGGCCCTGAGTGCCCAGCCATCCTTGTTCGTGTTTGAACACTCTCCTGGCCACGTGGGGAAGCGGGAACACGGGGTGTCT
 481 GCGCATGTTTCCTCCTCCTAGCTCCATCACTGCGCACACAGCTGCCTGCCTCGCCAGATGCAGGGGGGCGGGCAGCCCTC
 561 CCTGGCTGCCAGGAGGCTCTGCATGCCCACAGTCCTGCCCTGCCTGTCCCCTCAACCCGGCAGTGCCTGTAGCACCGAGG
 641 AGCAAAGGGGGTGGATGGGGGGCTTGGAGAAGGGCGGAGCCCACCAGCCTGGCATCCATGTTGACATCTTCTGACTGTCC
 721 CCTGCTTGGCTGGAGCCAGGCCCTTCCCTAGAGTTTCGTCAAGAGCCTCCTGGGGAAGGGGTCAGGTGGTTTGGGTTTTG
 801 TTTTTTAAAATAAAATAGACATGTTATATTGCCAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guCCGUGCCCUCGAGUCCACu 5'
            || | |||:  ||||||| 
Target 5' tgGGGAAGGGG--TCAGGTGg 3'
 771 - 789 155.00 -20.90
2 
miRNA  3' guccGUGCCC----UCGAGUCCACu 5'
              || |||    || ||||||| 
Target 5' actcCA-GGGATCCAGATCAGGTGc 3'
 156 - 179 150.00 -17.60
3 
miRNA  3' guCCGUGCCCUCG--AGUCCacu 5'
            ||||||  |||   ||||   
Target 5' aaGGCACGCCAGCCGGCAGGcac 3'
 38 - 60 97.00 -20.22
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
1175687 250 ClinVar
COSN30451036 21 COSMIC
COSN26561315 28 COSMIC
COSN30527113 47 COSMIC
COSN30498618 52 COSMIC
COSN19771127 54 COSMIC
COSN31550012 116 COSMIC
COSN31960180 183 COSMIC
COSN30344106 270 COSMIC
COSN18723368 483 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs567449777 4 dbSNP
rs1329272068 8 dbSNP
rs759289109 13 dbSNP
rs986180418 15 dbSNP
rs1263464589 16 dbSNP
rs751706088 17 dbSNP
rs373277994 18 dbSNP
rs781591637 27 dbSNP
rs750460965 29 dbSNP
rs756275044 36 dbSNP
rs780125685 41 dbSNP
rs377689243 42 dbSNP
rs1202235828 43 dbSNP
rs768306027 45 dbSNP
rs1042752150 46 dbSNP
rs1157469002 47 dbSNP
rs1347153801 50 dbSNP
rs1454563892 51 dbSNP
rs371434584 52 dbSNP
rs934828955 53 dbSNP
rs1392790191 54 dbSNP
rs760832371 58 dbSNP
rs902881532 69 dbSNP
rs77963885 70 dbSNP
rs1268884618 71 dbSNP
rs576674477 75 dbSNP
rs896045807 77 dbSNP
rs949023126 78 dbSNP
rs779221714 86 dbSNP
rs1033198937 88 dbSNP
rs1305770489 93 dbSNP
rs1225082599 94 dbSNP
rs1045061319 100 dbSNP
rs888421515 103 dbSNP
rs1192227193 107 dbSNP
rs1371226967 109 dbSNP
rs1476374621 116 dbSNP
rs1168646730 118 dbSNP
rs1334716885 122 dbSNP
rs1422221012 123 dbSNP
rs1244872414 128 dbSNP
rs963815002 129 dbSNP
rs1015684285 130 dbSNP
rs1285377560 139 dbSNP
rs1359091616 141 dbSNP
rs144541067 144 dbSNP
rs897277307 145 dbSNP
rs1316736971 147 dbSNP
rs559215130 155 dbSNP
rs754045311 156 dbSNP
rs1436541068 171 dbSNP
rs1030187988 172 dbSNP
rs1248276561 178 dbSNP
rs368388509 179 dbSNP
rs1266205380 182 dbSNP
rs954959099 182 dbSNP
rs150699153 183 dbSNP
rs908133971 185 dbSNP
rs1204296252 186 dbSNP
rs1259457083 188 dbSNP
rs1207623545 199 dbSNP
rs541053509 202 dbSNP
rs1242472670 205 dbSNP
rs1442189939 214 dbSNP
rs139674413 215 dbSNP
rs1368654283 222 dbSNP
rs920690898 225 dbSNP
rs1317307520 226 dbSNP
rs1017480747 229 dbSNP
rs755187659 230 dbSNP
rs978438165 232 dbSNP
rs924359150 233 dbSNP
rs1454606797 234 dbSNP
rs1313580255 238 dbSNP
rs1335376165 243 dbSNP
rs1237226973 244 dbSNP
rs560946809 248 dbSNP
rs7553242 250 dbSNP
rs1262389327 251 dbSNP
rs1162811308 261 dbSNP
rs993387784 262 dbSNP
rs917054777 266 dbSNP
rs543635658 269 dbSNP
rs181429747 270 dbSNP
rs1179146971 278 dbSNP
rs948914735 280 dbSNP
rs753016959 281 dbSNP
rs903081657 288 dbSNP
rs186914798 289 dbSNP
rs1471270509 291 dbSNP
rs1303486910 295 dbSNP
rs1395944050 308 dbSNP
rs1389748278 310 dbSNP
rs1054097360 312 dbSNP
rs899597010 313 dbSNP
rs996511649 322 dbSNP
rs1029361788 323 dbSNP
rs1479994567 325 dbSNP
rs1314940456 330 dbSNP
rs954915975 336 dbSNP
rs1193593469 337 dbSNP
rs1253471913 345 dbSNP
rs1343390762 346 dbSNP
rs1199121992 349 dbSNP
rs558896831 366 dbSNP
rs778252076 367 dbSNP
rs1007805975 368 dbSNP
rs1373033590 370 dbSNP
rs1017474508 373 dbSNP
rs1015623453 375 dbSNP
rs1339000122 378 dbSNP
rs1302306879 386 dbSNP
rs1343340069 398 dbSNP
rs968642160 400 dbSNP
rs962292362 404 dbSNP
rs1201206226 405 dbSNP
rs1258392417 408 dbSNP
rs973830387 418 dbSNP
rs920569282 427 dbSNP
rs559620403 430 dbSNP
rs576980081 431 dbSNP
rs917334748 444 dbSNP
rs1266333798 447 dbSNP
rs949887519 454 dbSNP
rs1041560102 455 dbSNP
rs1261606138 461 dbSNP
rs10927843 464 dbSNP
rs1168073274 465 dbSNP
rs779449385 467 dbSNP
rs1390942952 472 dbSNP
rs544399126 472 dbSNP
rs899462528 473 dbSNP
rs41270295 479 dbSNP
rs1438294388 482 dbSNP
rs536395207 483 dbSNP
rs1468822469 484 dbSNP
rs1380515503 486 dbSNP
rs980710484 490 dbSNP
rs1336731857 498 dbSNP
rs890865136 499 dbSNP
rs116089142 507 dbSNP
rs1437830959 510 dbSNP
rs774137832 514 dbSNP
rs1289091210 515 dbSNP
rs1015070154 517 dbSNP
rs747942456 519 dbSNP
rs79668581 529 dbSNP
rs1037305320 533 dbSNP
rs1485177802 535 dbSNP
rs1190991090 543 dbSNP
rs1249208234 545 dbSNP
rs918560685 549 dbSNP
rs375228006 550 dbSNP
rs1416185521 551 dbSNP
rs1406219569 553 dbSNP
rs1165196410 554 dbSNP
rs113565441 560 dbSNP
rs995066748 562 dbSNP
rs1321580728 566 dbSNP
rs1455446834 578 dbSNP
rs1322395125 581 dbSNP
rs1028314499 586 dbSNP
rs1203114899 587 dbSNP
rs958733326 588 dbSNP
rs1451241112 592 dbSNP
rs7748 607 dbSNP
rs1024423761 610 dbSNP
rs971440568 619 dbSNP
rs1283128595 620 dbSNP
rs1260824842 623 dbSNP
rs558959495 628 dbSNP
rs1433531789 632 dbSNP
rs977268702 637 dbSNP
rs537362875 638 dbSNP
rs1426767041 639 dbSNP
rs1269278729 647 dbSNP
rs763823699 649 dbSNP
rs990125040 651 dbSNP
rs921163056 652 dbSNP
rs932350413 655 dbSNP
rs1050692419 658 dbSNP
rs1038874394 661 dbSNP
rs1176763937 663 dbSNP
rs773250512 667 dbSNP
rs1390145705 668 dbSNP
rs566409536 670 dbSNP
rs1036947215 677 dbSNP
rs1389261981 681 dbSNP
rs898029293 685 dbSNP
rs995411155 689 dbSNP
rs148967579 695 dbSNP
rs1303770263 699 dbSNP
rs1278546465 700 dbSNP
rs1230584817 701 dbSNP
rs1289420292 707 dbSNP
rs1343885485 716 dbSNP
rs955699491 718 dbSNP
rs576310999 720 dbSNP
rs1281353341 723 dbSNP
rs1443015751 728 dbSNP
rs1024049434 739 dbSNP
rs1231355052 747 dbSNP
rs1484188068 754 dbSNP
rs970240702 758 dbSNP
rs554649631 759 dbSNP
rs1322170218 765 dbSNP
rs541887272 767 dbSNP
rs971471610 769 dbSNP
rs1427211951 774 dbSNP
rs760712578 776 dbSNP
rs980248108 777 dbSNP
rs1327654316 782 dbSNP
rs751519266 786 dbSNP
rs1368289670 793 dbSNP
rs868753898 799 dbSNP
rs910028149 808 dbSNP
rs1309011497 815 dbSNP
rs977497510 817 dbSNP
rs972944282 821 dbSNP
rs918835342 822 dbSNP
rs1346364075 823 dbSNP
rs1032162860 824 dbSNP
rs1271042893 833 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 23207.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guccgugcccucgAGUCCACu 5'
                       ||||||| 
Target 5' -------------UCAGGUGg 3'
 		1 - 8
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000375799.3 | 3UTR | UCAGGUGGUUUGGGUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.774 0.02 0.643 0.06 7 Click to see details
THCA 0.774 0.02 0.643 0.06 7 Click to see details
THCA 0.774 0.02 0.643 0.06 7 Click to see details
THCA 0.774 0.02 0.643 0.06 7 Click to see details
THCA 0.774 0.02 0.643 0.06 7 Click to see details
THCA 0.774 0.02 0.643 0.06 7 Click to see details
102 hsa-miR-3622b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT076713 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT080212 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT081398 GTPBP3 GTP binding protein 3, mitochondrial 2 2
MIRT107158 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT254071 BACH1 BTB domain and CNC homolog 1 2 2
MIRT409790 FOXO3 forkhead box O3 2 2
MIRT448679 MAPK9 mitogen-activated protein kinase 9 2 2
MIRT450206 ABHD15 abhydrolase domain containing 15 2 2
MIRT486621 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT489267 TTLL1 tubulin tyrosine ligase like 1 2 2
MIRT493117 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 4
MIRT494570 BAK1 BCL2 antagonist/killer 1 2 2
MIRT497395 RALY RALY heterogeneous nuclear ribonucleoprotein 2 2
MIRT504900 CCDC86 coiled-coil domain containing 86 2 2
MIRT505192 USP46 ubiquitin specific peptidase 46 2 4
MIRT506522 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 6
MIRT508162 ABCC5 ATP binding cassette subfamily C member 5 2 8
MIRT508545 PARVG parvin gamma 2 4
MIRT509850 BIRC5 baculoviral IAP repeat containing 5 2 6
MIRT510088 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 8
MIRT512094 CRK CRK proto-oncogene, adaptor protein 2 4
MIRT515381 RPL7 ribosomal protein L7 2 2
MIRT519176 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT519964 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT522292 NKAP NFKB activating protein 2 2
MIRT523160 HMGB2 high mobility group box 2 2 4
MIRT525314 FANCA Fanconi anemia complementation group A 2 2
MIRT528194 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT532885 ZNF451 zinc finger protein 451 2 2
MIRT538209 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT539497 ACTN4 actinin alpha 4 2 2
MIRT554600 RRAGC Ras related GTP binding C 2 2
MIRT562444 DCTN6 dynactin subunit 6 2 2
MIRT562748 AOC3 amine oxidase, copper containing 3 2 2
MIRT565798 SEC14L5 SEC14 like lipid binding 5 2 2
MIRT565838 SCML2 Scm polycomb group protein like 2 2 2
MIRT566072 RCC2 regulator of chromosome condensation 2 2 2
MIRT566104 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT572407 MRPS14 mitochondrial ribosomal protein S14 2 2
MIRT576198 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576313 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576651 Mill2 MHC I like leukocyte 2 1 1
MIRT576859 Socs6 suppressor of cytokine signaling 6 2 2
MIRT606819 BICD2 BICD cargo adaptor 2 2 2
MIRT610738 NUDT16 nudix hydrolase 16 2 4
MIRT614798 RORA RAR related orphan receptor A 2 2
MIRT619006 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 2
MIRT619420 NOS1AP nitric oxide synthase 1 adaptor protein 2 2
MIRT620405 MYO1H myosin IH 2 2
MIRT624869 ABHD13 abhydrolase domain containing 13 2 2
MIRT633527 ZFP30 ZFP30 zinc finger protein 2 2
MIRT633927 DNAH9 dynein axonemal heavy chain 9 2 2
MIRT636611 CLIC5 chloride intracellular channel 5 2 2
MIRT640616 MIOX myo-inositol oxygenase 2 2
MIRT642605 C14orf180 chromosome 14 open reading frame 180 2 2
MIRT644624 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT655113 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT658976 DNAJB5 DnaJ heat shock protein family (Hsp40) member B5 2 4
MIRT661495 CHMP1B charged multivesicular body protein 1B 2 2
MIRT662996 TMEM59 transmembrane protein 59 2 2
MIRT663075 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT665405 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT666106 SSR1 signal sequence receptor subunit 1 2 2
MIRT669562 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT670070 ZNF783 zinc finger family member 783 2 2
MIRT671192 ZNF891 zinc finger protein 891 2 2
MIRT675361 KLHL26 kelch like family member 26 2 2
MIRT678857 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT679443 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT684163 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT684543 ZNF460 zinc finger protein 460 2 2
MIRT684674 SLC2A11 solute carrier family 2 member 11 2 2
MIRT684971 MINOS1 mitochondrial inner membrane organizing system 1 2 2
MIRT686006 NEK4 NIMA related kinase 4 2 2
MIRT687758 KIAA1328 KIAA1328 2 2
MIRT688961 ATXN3 ataxin 3 2 2
MIRT689409 UQCR11 ubiquinol-cytochrome c reductase, complex III subunit XI 2 2
MIRT690001 MMP17 matrix metallopeptidase 17 2 2
MIRT690165 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690202 C5orf45 MRN complex interacting protein 2 2
MIRT690477 ZNF33A zinc finger protein 33A 2 2
MIRT690566 MICA MHC class I polypeptide-related sequence A 2 2
MIRT692160 C10orf111 chromosome 10 open reading frame 111 2 2
MIRT693430 PLGLB2 plasminogen-like B2 2 2
MIRT693547 ZNF708 zinc finger protein 708 2 2
MIRT693697 PLGLB1 plasminogen-like B1 2 2
MIRT695006 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT698525 TFRC transferrin receptor 2 2
MIRT699574 SIKE1 suppressor of IKBKE 1 2 2
MIRT703446 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704397 CTSS cathepsin S 2 2
MIRT704485 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT709822 STPG1 sperm tail PG-rich repeat containing 1 2 2
MIRT710859 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT711893 INSIG2 insulin induced gene 2 2 2
MIRT713796 CPLX2 complexin 2 2 2
MIRT718800 C1GALT1C1 C1GALT1 specific chaperone 1 2 2
MIRT719501 SEC24B SEC24 homolog B, COPII coat complex component 2 2
MIRT719722 PDE6B phosphodiesterase 6B 2 2
MIRT722204 URM1 ubiquitin related modifier 1 2 2
MIRT723523 CLPTM1L CLPTM1 like 2 2
MIRT725471 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3622b-3p Platinum 23939 sensitive tissue
hsa-miR-3622b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3622b-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-3622b-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission