miRTarBase - #MIRT528203


—
pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol NELFE   
Synonyms D6S45, NELF-E, RD, RDBP, RDP
Description negative elongation factor complex member E
Transcript NM_002904   
Expression
Putative miRNA Targets on NELFE
3'UTR of NELFE
(miRNA target sites are highlighted)		 
>NELFE|NM_002904|3'UTR
   1 GGAACAGAGCTGGATTCCTTGTGCCTCATATGCCCCAATGCTGGTCTCAGTAAAACACTGAGGTGGAAGCTTACACATCT
  81 CCCTCAGCCTCTGGTTTTTCAGCACTTGGGATTGGGGTTAAACCTTTAAAAACGGCTGTCAGGTTTGATCTCAGTGTAAC
 161 AACATGGCCAGTGCCTGTTCCCCACTCCCTTGCCCCAAAAGGATCTGGAACACAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uagUUCC-AGGCGACACUUGUGc 5'
             |||| ||:|    |||||| 
Target 5' caaAAGGATCTG----GAACACa 3'
 196 - 214 128.00 -12.30
2 
miRNA  3' uaguUCCAGGC--GA--CAC-UUGUgc 5'
              ||||::|  ||  ||| ||||  
Target 5' tgtcAGGTTTGATCTCAGTGTAACAac 3'
 137 - 163 110.00 -12.70
3 
miRNA  3' uaGUUCCAGGC--GACACUUGUGc 5'
            ||:  ||:|  :| | |:||| 
Target 5' ctCAGCCTCTGGTTTTTCAGCACt 3'
 83 - 106 106.00 -6.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31783709 35 COSMIC
COSN14219475 38 COSMIC
COSN30462595 83 COSMIC
COSN32057272 122 COSMIC
COSN30461246 124 COSMIC
COSN30516714 151 COSMIC
COSN19725680 161 COSMIC
COSN26986306 180 COSMIC
COSN7870599 181 COSMIC
COSN30474309 189 COSMIC
rs522162 161 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs753074425 9 dbSNP
rs1456696327 10 dbSNP
rs1382765654 13 dbSNP
rs765570341 20 dbSNP
rs1201743384 29 dbSNP
rs1479510295 32 dbSNP
rs1246303989 36 dbSNP
rs368735114 38 dbSNP
rs1175597971 39 dbSNP
rs754459419 42 dbSNP
rs1384419576 59 dbSNP
rs897169469 60 dbSNP
rs1344853890 62 dbSNP
rs1454463938 82 dbSNP
rs1291004984 85 dbSNP
rs1041413579 91 dbSNP
rs1053159 102 dbSNP
rs1008497075 103 dbSNP
rs1284480951 112 dbSNP
rs760070 122 dbSNP
rs561435164 124 dbSNP
rs149428147 127 dbSNP
rs1469066180 133 dbSNP
rs183347669 134 dbSNP
rs914707921 138 dbSNP
rs908992932 144 dbSNP
rs1489796033 148 dbSNP
rs986307449 150 dbSNP
rs953553547 154 dbSNP
rs1200481499 160 dbSNP
rs522162 161 dbSNP
rs1175585683 169 dbSNP
rs1260518656 171 dbSNP
rs976320208 176 dbSNP
rs1466653868 183 dbSNP
rs140185216 190 dbSNP
rs1398493715 201 dbSNP
rs1030986256 204 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 7936.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uaguuccaggcgacaCUUGUGc 5'
                         |||||| 
Target 5' ---------gaucugGAACACa 3'
 		1 - 13
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000375429.3 | 3UTR | GAUCUGGAACACAGGUGUUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission