miRTarBase - #MIRT528474


—
pre-miRNA Information
pre-miRNA hsa-mir-6868   
Genomic Coordinates chr17: 76098019 - 76098076
Description Homo sapiens miR-6868 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6868-3p
Sequence 38| UUCCUUCUGUUGUCUGUGCAG |58
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM4415890 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1268215934 1 dbSNP
rs199573454 9 dbSNP
rs893365109 12 dbSNP
rs370367037 13 dbSNP
rs7208391 16 dbSNP
rs752026363 19 dbSNP
rs113525369 20 dbSNP
Putative Targets

Gene Information
Gene Symbol STAMBPL1   
Synonyms ALMalpha, AMSH-FP, AMSH-LP, bA399O19.2
Description STAM binding protein like 1
Transcript NM_020799   
Expression
Putative miRNA Targets on STAMBPL1
3'UTR of STAMBPL1
(miRNA target sites are highlighted)		 
>STAMBPL1|NM_020799|3'UTR
   1 TATGTTCTGAATGTAAGCACCGTCAACATCAGACACCTACTCATGGACATGTGGTTGCCGGATTTTCTTAAGATGTTTCC
  81 AGAAATGACTGATATTTTATATTTATACATTTTAGATGACAAAGCTTGATATTTATTGCTGTTGCACATTTTAAAGTTTT
 161 CTTTTTGGGTTGCTCTGTGTCAAGAGAGGTTACATGGTGTTAAATCGGTACCTGATAATGTACCCAAATACTATGGCCAG
 241 ATAATAAATTGTGCTGCAAACAACATGTCTTGTATTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacguguCUGUUGUCUUCcuu 5'
                 | ||| |||:|   
Target 5' gctctgtGTCAAGAGAGGtta 3'
 172 - 192 98.00 -8.70
2 
miRNA  3' gaCGUGUC---UGUUGUCUuccuu 5'
            |||| |   ||| ||||     
Target 5' aaGCACCGTCAACATCAGAcacct 3'
 15 - 38 87.00 -9.09
3 
miRNA  3' gacGUGUCUGUU----GUCUuccuu 5'
             || | || |    ||||     
Target 5' accCAAATACTATGGCCAGAtaata 3'
 222 - 246 72.00 -10.44
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26997160 3 COSMIC
COSN30109629 8 COSMIC
COSN30169354 11 COSMIC
COSN30191689 22 COSMIC
COSN26641534 23 COSMIC
COSN1505870 68 COSMIC
COSN19749046 132 COSMIC
COSN30140891 201 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777708455 1 dbSNP
rs753796374 4 dbSNP
rs200476724 5 dbSNP
rs1462636020 12 dbSNP
rs1373346998 13 dbSNP
rs778364498 21 dbSNP
rs376278638 22 dbSNP
rs571630253 23 dbSNP
rs779577905 31 dbSNP
rs1428033446 32 dbSNP
rs770919620 33 dbSNP
rs1263671236 34 dbSNP
rs1160028308 36 dbSNP
rs748486717 38 dbSNP
rs770073829 40 dbSNP
rs184125227 41 dbSNP
rs1482428811 45 dbSNP
rs1347575745 48 dbSNP
rs540002560 50 dbSNP
rs748001665 51 dbSNP
rs147342229 60 dbSNP
rs528907360 61 dbSNP
rs937296614 63 dbSNP
rs80093227 76 dbSNP
rs762711048 77 dbSNP
rs899483962 83 dbSNP
rs1341643864 85 dbSNP
rs765850578 88 dbSNP
rs1050752218 102 dbSNP
rs574686942 106 dbSNP
rs554562191 108 dbSNP
rs562493622 111 dbSNP
rs1466178137 143 dbSNP
rs386746352 143 dbSNP
rs1530281 144 dbSNP
rs552812692 145 dbSNP
rs962549190 154 dbSNP
rs997144053 156 dbSNP
rs1257935319 162 dbSNP
rs1247283631 169 dbSNP
rs188575421 176 dbSNP
rs1027649565 183 dbSNP
rs1480258607 184 dbSNP
rs761196089 187 dbSNP
rs1409803316 195 dbSNP
rs1342648971 200 dbSNP
rs528810421 207 dbSNP
rs1004225941 208 dbSNP
rs1328747395 209 dbSNP
rs1160248272 212 dbSNP
rs1028126395 214 dbSNP
rs1162596920 219 dbSNP
rs1456278436 223 dbSNP
rs1370004210 229 dbSNP
rs1015571719 231 dbSNP
rs1439365510 234 dbSNP
rs969461640 235 dbSNP
rs1180658471 242 dbSNP
rs753783349 249 dbSNP
rs980698383 251 dbSNP
rs1413308807 264 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 57559.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacgugUCUGUUGUCUUCCUu 5'
                | :::| ||||||| 
Target 5' ------AUGUGA-AGAAGGAc 3'
 		1 - 14
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000371926.3 | 3UTR | AUGUGAAGAAGGACGUGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
178 hsa-miR-6868-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT107800 SLC1A1 solute carrier family 1 member 1 2 2
MIRT164443 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT180168 NOTCH2 notch 2 2 2
MIRT363961 IMPAD1 inositol monophosphatase domain containing 1 2 2
MIRT445561 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT468817 RSRC2 arginine and serine rich coiled-coil 2 2 4
MIRT475452 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT478206 DDX6 DEAD-box helicase 6 2 2
MIRT506235 PEX13 peroxisomal biogenesis factor 13 2 4
MIRT507651 CREBRF CREB3 regulatory factor 2 4
MIRT509448 CAPRIN1 cell cycle associated protein 1 2 4
MIRT520196 WASL Wiskott-Aldrich syndrome like 2 2
MIRT521020 SLC38A1 solute carrier family 38 member 1 2 4
MIRT526334 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT527175 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527348 FAM69C family with sequence similarity 69 member C 2 2
MIRT527514 FOXB1 forkhead box B1 2 4
MIRT527955 MTAP methylthioadenosine phosphorylase 2 2
MIRT528474 STAMBPL1 STAM binding protein like 1 2 2
MIRT528929 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT531496 NONO non-POU domain containing octamer binding 2 2
MIRT531608 ACP1 acid phosphatase 1, soluble 2 2
MIRT535579 NUP35 nucleoporin 35 2 2
MIRT536158 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 6
MIRT536194 MAML2 mastermind like transcriptional coactivator 2 2 2
MIRT549649 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT551819 TMEM138 transmembrane protein 138 2 2
MIRT557174 HOXA11 homeobox A11 2 2
MIRT558889 CCND2 cyclin D2 2 2
MIRT559109 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT569341 EFHC1 EF-hand domain containing 1 2 2
MIRT608169 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609642 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT610274 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2 2
MIRT611130 CTBP2 C-terminal binding protein 2 2 2
MIRT611350 KIAA2018 upstream transcription factor family member 3 2 2
MIRT612894 HMGB1 high mobility group box 1 2 2
MIRT613291 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT614162 MYO1F myosin IF 2 2
MIRT614217 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT615474 RPS6KA3 ribosomal protein S6 kinase A3 2 2
MIRT615863 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT616022 PRRG4 proline rich and Gla domain 4 2 2
MIRT616349 RASGEF1B RasGEF domain family member 1B 2 2
MIRT616679 FJX1 four jointed box 1 2 2
MIRT616811 PAPPA-AS1 PAPPA antisense RNA 1 2 2
MIRT616964 LMX1A LIM homeobox transcription factor 1 alpha 2 2
MIRT617067 SPIB Spi-B transcription factor 2 2
MIRT618597 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT618656 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT618914 KLHL4 kelch like family member 4 2 2
MIRT620197 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620644 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT620762 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621142 RNF122 ring finger protein 122 2 2
MIRT621248 QTRT1 queuine tRNA-ribosyltransferase catalytic subunit 1 2 2
MIRT622711 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT622941 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT623329 MAK16 MAK16 homolog 2 2
MIRT623539 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT624413 CCDC149 coiled-coil domain containing 149 2 2
MIRT624478 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT624574 BCL9L B-cell CLL/lymphoma 9 like 2 2
MIRT624584 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT624685 AR androgen receptor 2 2
MIRT625750 GPC5 glypican 5 2 2
MIRT626539 EMCN endomucin 2 2
MIRT627474 STRN striatin 2 2
MIRT628183 GLP1R glucagon like peptide 1 receptor 2 2
MIRT634165 XKR4 XK related 4 2 2
MIRT634553 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 2 2
MIRT637463 DEFB105B defensin beta 105B 2 4
MIRT637495 DEFB105A defensin beta 105A 2 4
MIRT638102 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT638313 RNF157 ring finger protein 157 2 2
MIRT639297 OPTN optineurin 2 2
MIRT639588 RGS5 regulator of G protein signaling 5 2 2
MIRT639721 RAB17 RAB17, member RAS oncogene family 2 2
MIRT640060 KPNA6 karyopherin subunit alpha 6 2 2
MIRT640117 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT640387 ZNF785 zinc finger protein 785 2 2
MIRT640579 MYO5A myosin VA 2 2
MIRT640591 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT640627 ZFP30 ZFP30 zinc finger protein 2 2
MIRT640761 GLO1 glyoxalase I 2 2
MIRT640808 ZMAT1 zinc finger matrin-type 1 2 2
MIRT641827 TRIM71 tripartite motif containing 71 2 2
MIRT643955 GALNT13 polypeptide N-acetylgalactosaminyltransferase 13 2 2
MIRT644218 ADD1 adducin 1 2 2
MIRT644356 NDUFAF6 NADH:ubiquinone oxidoreductase complex assembly factor 6 2 2
MIRT644560 SPOP speckle type BTB/POZ protein 2 2
MIRT645486 TRIM63 tripartite motif containing 63 2 2
MIRT645595 MRPS15 mitochondrial ribosomal protein S15 2 2
MIRT645840 BRS3 bombesin receptor subtype 3 2 2
MIRT645944 TTF2 transcription termination factor 2 2 2
MIRT646154 VASH2 vasohibin 2 2 2
MIRT648097 LRRFIP1 LRR binding FLII interacting protein 1 2 2
MIRT648131 JAGN1 jagunal homolog 1 2 2
MIRT648469 TCERG1 transcription elongation regulator 1 2 2
MIRT648954 ZNF385D zinc finger protein 385D 2 4
MIRT649447 ST3GAL6 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 2 2
MIRT649559 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT649641 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT650541 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT651104 ZNF48 zinc finger protein 48 2 2
MIRT651197 ZNF281 zinc finger protein 281 2 2
MIRT651682 VPS13D vacuolar protein sorting 13 homolog D 2 2
MIRT651995 UBA6 ubiquitin like modifier activating enzyme 6 2 2
MIRT652062 TTC39B tetratricopeptide repeat domain 39B 2 2
MIRT652310 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT654265 RGS17 regulator of G protein signaling 17 2 2
MIRT654402 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT654679 PSMB5 proteasome subunit beta 5 2 2
MIRT654741 PRKCB protein kinase C beta 2 2
MIRT656172 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT656583 LSAMP limbic system-associated membrane protein 2 2
MIRT656700 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT657492 HBEGF heparin binding EGF like growth factor 2 2
MIRT658487 EXOC7 exocyst complex component 7 2 2
MIRT658583 EPHB1 EPH receptor B1 2 2
MIRT658657 EMX2 empty spiracles homeobox 2 2 2
MIRT659123 DENND5B DENN domain containing 5B 2 2
MIRT659188 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT659329 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT660376 B4GALT6 beta-1,4-galactosyltransferase 6 2 2
MIRT660636 ANKRD50 ankyrin repeat domain 50 2 2
MIRT660689 ANAPC1 anaphase promoting complex subunit 1 2 4
MIRT662434 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT662562 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT662966 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT666429 SH2B3 SH2B adaptor protein 3 2 2
MIRT668902 CREB1 cAMP responsive element binding protein 1 2 2
MIRT673056 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT687429 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT694785 DHFRL1 dihydrofolate reductase 2 2 2
MIRT708677 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT708853 TMSB4X thymosin beta 4, X-linked 2 2
MIRT709605 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT709993 IFIT1 interferon induced protein with tetratricopeptide repeats 1 2 2
MIRT710881 MTG1 mitochondrial ribosome associated GTPase 1 2 2
MIRT711023 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT711338 FMNL2 formin like 2 2 2
MIRT711351 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 2 2
MIRT712163 SURF4 surfeit 4 2 2
MIRT712225 RIMS3 regulating synaptic membrane exocytosis 3 2 2
MIRT713028 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT713719 CD244 CD244 molecule 2 2
MIRT713970 ASIC4 acid sensing ion channel subunit family member 4 2 2
MIRT714872 SPDL1 spindle apparatus coiled-coil protein 1 2 2
MIRT715837 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT717031 KRTAP4-9 keratin associated protein 4-9 2 2
MIRT717158 SHB SH2 domain containing adaptor protein B 2 2
MIRT717292 KCTD20 potassium channel tetramerization domain containing 20 2 2
MIRT717670 CDC42BPA CDC42 binding protein kinase alpha 2 2
MIRT717838 NEGR1 neuronal growth regulator 1 2 2
MIRT718148 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT719726 SLC39A11 solute carrier family 39 member 11 2 2
MIRT719909 IL5 interleukin 5 2 2
MIRT720245 FAM83F family with sequence similarity 83 member F 2 2
MIRT720352 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT720803 NUDT5 nudix hydrolase 5 2 2
MIRT720930 PPP1R3E protein phosphatase 1 regulatory subunit 3E 2 2
MIRT721609 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT722090 SUSD1 sushi domain containing 1 2 2
MIRT722271 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722548 FGFR1OP FGFR1 oncogene partner 2 2
MIRT723141 METTL24 methyltransferase like 24 2 2
MIRT723271 TAL2 TAL bHLH transcription factor 2 2 2
MIRT723396 OAF out at first homolog 2 2
MIRT723633 STK25 serine/threonine kinase 25 2 2
MIRT723680 CIRH1A UTP4, small subunit processome component 2 2
MIRT723803 BDKRB2 bradykinin receptor B2 2 2
MIRT723894 NUDT21 nudix hydrolase 21 2 2
MIRT724672 NCAPG non-SMC condensin I complex subunit G 2 2
MIRT724759 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
MIRT724973 TNS1 tensin 1 2 2
MIRT725046 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT725428 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6868-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6868-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6868-3p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission