>DNAAF3|NM_178837|3'UTR
   1 CCCAACCCCTAGACACCCCTTATCTCCAACTTCCAAAGTCAGGTTGTAGGATGAGAACCCGCTGATACCATTCTAAGTCC
  81 GCTGCTAGAGTCCTCAATTTTATTCTAATCATTCCCACTCAGTACCCGCCACCCCCACCCCGGGAGTGTTGGTAGACTTT
 161 CAAATTCCATTTCTGAGATTCTATGGTCTATTCCTAGAATTCTAGATTGTTCTCTCAGAATTCCAAATTCCACTTCTGAG
 241 GCTCTAAGCCCAGCCTAGGATCTGACACTGAGTCTCAGGCCCTTGACTTTGGCCCCCTTGTTCCCAGGCACCCTGTGGCT
 321 GACTAGGGGCTGGGGTGTCTCCTCACCAGGGCCTGGTCAGCACCCAGATGGTTCAAGTAAAGCAAGTTGTGTCCACCCTT
 401 C

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugGGAGACUUUCC----UUCGu 5' |:|||| ||| |||| Target 5' caCTTCTG--AGGCTCTAAGCc 3'	231 - 250	100.00	-11.00
2	miRNA 3' ugggagacuuUCCUUCgu 5' |||| | Target 5' gtcaggttgtAGGATGag 3'	38 - 55	88.00	-5.50
3	miRNA 3' ugggagacuuuCCUUCGu 5' ||:||: Target 5' acccccaccccGGGAGTg 3'	131 - 148	88.00	-9.30

Mutant ID	Mutant Position	Mutant Source
330205	28	ClinVar
COSN30500127	9	COSMIC
COSN5762167	26	COSMIC
COSN30453887	60	COSMIC
COSN5268667	60	COSMIC
COSN30508289	65	COSMIC
COSN30508330	67	COSMIC
COSN30508245	70	COSMIC
COSN13836180	81	COSMIC
COSN20807413	88	COSMIC
COSN25897721	127	COSMIC
COSN30525182	128	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs752998991	1	dbSNP
rs765312080	2	dbSNP
rs547397454	3	dbSNP
rs1431175274	6	dbSNP
rs1332908231	7	dbSNP
rs376466344	12	dbSNP
rs1191376414	17	dbSNP
rs753688172	18	dbSNP
rs766154848	24	dbSNP
rs201512228	28	dbSNP
rs750337673	29	dbSNP
rs767076467	36	dbSNP
rs1056626335	37	dbSNP
rs1261705988	40	dbSNP
rs761186350	42	dbSNP
rs774056189	43	dbSNP
rs1220214967	44	dbSNP
rs768252759	45	dbSNP
rs568564289	60	dbSNP
rs1477847286	61	dbSNP
rs1172239766	75	dbSNP
rs548048894	80	dbSNP
rs924217578	81	dbSNP
rs1186721415	83	dbSNP
rs531570316	105	dbSNP
rs1044343246	110	dbSNP
rs946376262	115	dbSNP
rs867368084	116	dbSNP
rs1288194609	125	dbSNP
rs530765673	127	dbSNP
rs150804001	128	dbSNP
rs1280121573	129	dbSNP
rs142148946	132	dbSNP
rs1006667799	136	dbSNP
rs1187071480	139	dbSNP
rs532132907	141	dbSNP
rs544757290	142	dbSNP
rs1487999027	147	dbSNP
rs1260613174	151	dbSNP
rs922462089	156	dbSNP
rs1196493752	160	dbSNP
rs1254696244	161	dbSNP
rs540235885	163	dbSNP
rs1474596413	181	dbSNP
rs972600470	207	dbSNP
rs1223565871	221	dbSNP
rs1359698443	232	dbSNP
rs758870525	233	dbSNP
rs1398709078	236	dbSNP
rs961464333	244	dbSNP
rs148658260	254	dbSNP
rs1360957719	260	dbSNP
rs1421381449	269	dbSNP
rs1311002745	270	dbSNP
rs1273514546	292	dbSNP
rs996253144	298	dbSNP
rs1016871020	320	dbSNP
rs1447471813	326	dbSNP
rs1284974494	334	dbSNP
rs1005410944	335	dbSNP
rs1222310084	337	dbSNP
rs1308919385	337	dbSNP
rs1343708417	341	dbSNP
rs1219343689	344	dbSNP
rs1278895386	345	dbSNP
rs1441323585	347	dbSNP
rs1210257089	348	dbSNP
rs1238733449	352	dbSNP
rs369312182	371	dbSNP
rs886054637	374	dbSNP
rs1386709853	382	dbSNP
rs1040886999	386	dbSNP
rs1441389894	389	dbSNP
rs1171673617	390	dbSNP
rs1366188088	391	dbSNP
rs554664741	396	dbSNP

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.