miRTarBase - #MIRT528669


—
pre-miRNA Information
pre-miRNA hsa-mir-3618   
Genomic Coordinates chr22: 20085746 - 20085833
Description Homo sapiens miR-3618 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3618
Sequence 52| UGUCUACAUUAAUGAAAAGAGC |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 11 22 + 20085807 27587585 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30730356 3 COSMIC
COSN30178222 4 COSMIC
COSN26973254 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs12159555 4 dbSNP
rs761877586 8 dbSNP
Putative Targets

Gene Information
Gene Symbol PDE4DIP   
Synonyms CMYA2, MMGL
Description phosphodiesterase 4D interacting protein
Transcript NM_001002811   
Other Transcripts NM_001002810 , NM_001002812 , NM_014644 , NM_022359   
Expression
Putative miRNA Targets on PDE4DIP
3'UTR of PDE4DIP
(miRNA target sites are highlighted)		 
>PDE4DIP|NM_001002811|3'UTR
   1 CTTCAGAAGCATTTTTACTTGCAAGACGATGGACACATTCCCCTTGGGCTTTTTGTAACTGAAACGCACCACAGAAGACA
  81 GGGAGTCATCGAAGGGCTGCTCGGGGAGGTGGCAGGGCGGAGGACCTGCTTGGGAAGAAACTCCAAGAAGATTGGAATGC
 161 TTCCAAAGCAAGAATCTTTCTCAGTGAAATCTCATTATACAAAGAGAACCTTATGCAACCTGACAAACCACTGAGGTCAT
 241 GGTGACTCAGTGATCAGCAGATGGTACTTCAACAGCAATCCCCTGTCAAACCTCAGAACTTGAGGCTGAAACATTGCTTC
 321 CACCCACCATCAGTGAAGATGTAACTAGCATGTTACAAGAGTGAATAATCTGGACTTCAGAGATTAAGTCACCAATAGTG
 401 ATCTCACAAGCACTCACCGGAACTCCTATAATGTCTCCACTTTGTCCATGCCATTTAGCAATCTCATCTCCTAAATGGAC
 481 TGTGCCTATGATTCTTAAGGAGAAAGTGAATCATTGGTAGATATCCTGCACAAGCAGCTGGACTTTCCAGTAATAGCTTT
 561 CTTGGGGCTATTAGGAAAATTAAACAAGAAATGAGGCTTTCTGGGTCTGCCTGTATGTCTTCTGCATAAGACAAAGAAGA
 641 GACATCGAATCAACCAATAAGAAGAGCCCAAATAAGCATCCTCAAATCTTTTGGGATTTGGCACTTGGGGACATGAGTAG
 721 TTGTCTGGGATACGTCATATTCTCAACAGTTTCTTTGTAGTAGTAGGATCACCTTCTTATAATAGGATCACCTTCTTGTT
 801 GCTATAGCTGTACCCGACCTTCCCTTCTCCCTTGAGTGCTTGCATGAGCTCCACTTTTCCTTTTGCTTGAACAGCTTCTC
 881 CTGAGTCCTCCTTACCGATGGTTGTGACTTTAATTATATACATCTCTGTCCCTCCAGACAGATCCCTCTGTCCTCACTCT
 961 CTGATTTCATTGAGGATCTTGGGTGAGAGAGAGGGACCTGCAGGATGAACAAATGTCTACTCTAAGACAGCTAGATTGGG
1041 AGGTTGGCTGGTCACTGATGGTTATAATGACTGTGGGACAGGATTAACTTCAGAATAAATGAACAGGAGACACAGATATG
1121 AAGAAAGTTTCTGATTGATATGGTCTGAAGTACTCCTGGTATTGCAAGTCATTTGCTCTAATTCTCAATTGTAGGCAAAC
1201 TGATTTGTAAATTTGCTTCTTCAGCCTTCTTTCCTGTAGCCTAGCATGGAGAATCTGACCAGACCCCATTTTGAGAAGGT
1281 CAGCCTACACTGGAATGAACTTTTTACATTAGGGCATTTGTATTTCCCTCACAATACTTGCCACATTACTTGGCATAGGA
1361 GAGATGCTTAGTGTAATTATAAGTTAACAAGCCTTTGGATCAGGGCTTGACTCATGATAGACAAAGTATATGCCTGCTGG
1441 ATGGAAGAATCTCTTGGGCGAGCACCATTTTTCTTTCCATCACCTTTCCTTGAAAATATATCTTCAGCTTTGGGTAGGAG
1521 GAATCTTGGTGTATGAAATCATTGCAAATTTACTTCATCTTTTCTGGAGTTTGAAGTTGTGACTCTCCTGCTACCAATTA
1601 AATAAAGCTTACTTTGCCATAACAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgAGAAAAGUAAUU-ACAUCUGu 5'
            |||  |: | || |||||:| 
Target 5' gcTCTAATTCTCAATTGTAGGCa 3'
 1175 - 1197 140.00 -14.90
2 
miRNA  3' cgagaaAAGUAAUUAC-AUCUGu 5'
                || | | ||| ||||| 
Target 5' cagggcTTGACTCATGATAGACa 3'
 1401 - 1423 124.00 -10.70
3 
miRNA  3' cgagaaaAGUAAUUACAUCUGu 5'
                 |||||:  |||||: 
Target 5' aagtgaaTCATTG--GTAGATa 3'
 504 - 523 114.00 -10.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM6570331 1 COSMIC
COSN31495874 5 COSMIC
COSN30176496 12 COSMIC
COSN20064692 28 COSMIC
COSN13464235 29 COSMIC
COSN28724125 43 COSMIC
COSN30458641 44 COSMIC
COSN30138808 51 COSMIC
COSN20073423 59 COSMIC
COSN31539717 62 COSMIC
COSN31482332 67 COSMIC
COSN30450723 91 COSMIC
COSN31480955 104 COSMIC
COSN31508277 117 COSMIC
COSN13464231 119 COSMIC
COSN19695599 126 COSMIC
COSN31662930 144 COSMIC
COSN31605009 162 COSMIC
COSN31598975 173 COSMIC
COSN19749063 175 COSMIC
COSN31558799 187 COSMIC
COSN30620615 192 COSMIC
COSN31532370 252 COSMIC
COSN24195123 475 COSMIC
COSN6001673 591 COSMIC
COSN28285701 734 COSMIC
COSN16132190 817 COSMIC
COSN28852166 1068 COSMIC
COSN22069149 1141 COSMIC
COSN16406831 1223 COSMIC
COSN4708504 1419 COSMIC
COSN20074100 1451 COSMIC
COSN8635836 1501 COSMIC
COSN31576194 1558 COSMIC
COSN20090318 1560 COSMIC
COSN31569868 1569 COSMIC
COSN30544812 1589 COSMIC
COSN15871396 1601 COSMIC
COSN31570335 1602 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1437449961 6 dbSNP
rs781825736 13 dbSNP
rs1386642633 19 dbSNP
rs782443469 28 dbSNP
rs368616713 29 dbSNP
rs1370009493 33 dbSNP
rs1162480628 34 dbSNP
rs782801349 39 dbSNP
rs782140869 41 dbSNP
rs781845004 43 dbSNP
rs782754689 47 dbSNP
rs782073996 50 dbSNP
rs1390774777 66 dbSNP
rs1189935913 67 dbSNP
rs1260539148 80 dbSNP
rs1210090141 83 dbSNP
rs587718893 89 dbSNP
rs781821597 90 dbSNP
rs587655467 91 dbSNP
rs1267578188 92 dbSNP
rs587609491 95 dbSNP
rs1359338934 98 dbSNP
rs1298995852 104 dbSNP
rs1230626110 106 dbSNP
rs1363143717 113 dbSNP
rs1295074928 115 dbSNP
rs1387535231 119 dbSNP
rs372772472 120 dbSNP
rs587648923 123 dbSNP
rs587751518 135 dbSNP
rs587711908 141 dbSNP
rs1170430834 145 dbSNP
rs1447083981 147 dbSNP
rs1372035625 153 dbSNP
rs782114379 174 dbSNP
rs1199010206 175 dbSNP
rs1434525703 183 dbSNP
rs1220631491 186 dbSNP
rs1490292179 199 dbSNP
rs587754512 200 dbSNP
rs587700589 204 dbSNP
rs1275911345 206 dbSNP
rs1207960572 207 dbSNP
rs1340715026 223 dbSNP
rs1250810558 242 dbSNP
rs587698037 242 dbSNP
rs587666499 257 dbSNP
rs1234128808 282 dbSNP
rs1333045953 293 dbSNP
rs1299473883 308 dbSNP
rs1404049527 309 dbSNP
rs1350910833 313 dbSNP
rs1309736596 332 dbSNP
rs587776125 345 dbSNP
rs1395753893 353 dbSNP
rs1172647467 371 dbSNP
rs1467134228 381 dbSNP
rs1375510401 401 dbSNP
rs1198264794 410 dbSNP
rs1480291063 411 dbSNP
rs1252951384 413 dbSNP
rs1184848310 414 dbSNP
rs1436565589 417 dbSNP
rs1250525178 419 dbSNP
rs1201043217 420 dbSNP
rs1347238594 438 dbSNP
rs1261445508 439 dbSNP
rs1223170043 441 dbSNP
rs1330131408 449 dbSNP
rs1289965341 459 dbSNP
rs1407833680 469 dbSNP
rs1335026046 475 dbSNP
rs1334757223 477 dbSNP
rs1397216291 482 dbSNP
rs1175135938 489 dbSNP
rs1457422986 491 dbSNP
rs1413794404 497 dbSNP
rs1161822259 499 dbSNP
rs1468929062 507 dbSNP
rs1363671017 511 dbSNP
rs1188883138 513 dbSNP
rs1444166476 525 dbSNP
rs1241325937 527 dbSNP
rs797027876 527 dbSNP
rs1203170073 528 dbSNP
rs376434773 529 dbSNP
rs1270252523 547 dbSNP
rs1349713171 548 dbSNP
rs1284666711 553 dbSNP
rs1246860425 566 dbSNP
rs1338680225 571 dbSNP
rs1335481256 572 dbSNP
rs370432583 574 dbSNP
rs1435270204 581 dbSNP
rs1390304353 586 dbSNP
rs587650031 594 dbSNP
rs1801794 597 dbSNP
rs1399273120 598 dbSNP
rs1407761088 615 dbSNP
rs1164243501 616 dbSNP
rs1474049583 620 dbSNP
rs1383994465 624 dbSNP
rs587733423 628 dbSNP
rs1182987493 629 dbSNP
rs1450180298 640 dbSNP
rs1250079138 645 dbSNP
rs1213954232 647 dbSNP
rs1446677815 648 dbSNP
rs1290298517 656 dbSNP
rs1211476242 657 dbSNP
rs1357186412 665 dbSNP
rs1314300873 668 dbSNP
rs1228420600 672 dbSNP
rs587693576 689 dbSNP
rs1366770121 705 dbSNP
rs1268006946 714 dbSNP
rs587617512 715 dbSNP
rs1429559143 724 dbSNP
rs1350163165 727 dbSNP
rs1407436794 729 dbSNP
rs1364185779 731 dbSNP
rs1163527816 734 dbSNP
rs1430439777 735 dbSNP
rs1392064511 741 dbSNP
rs1184906801 754 dbSNP
rs1475200620 755 dbSNP
rs1247579182 757 dbSNP
rs1200650209 761 dbSNP
rs1489802763 762 dbSNP
rs1290887602 768 dbSNP
rs1205826215 772 dbSNP
rs1344284594 773 dbSNP
rs587736087 774 dbSNP
rs1270251479 787 dbSNP
rs587663414 792 dbSNP
rs1367781079 793 dbSNP
rs1276257763 799 dbSNP
rs1407092636 803 dbSNP
rs1344056137 814 dbSNP
rs1302964274 815 dbSNP
rs1430928314 816 dbSNP
rs1356848917 830 dbSNP
rs1168421516 836 dbSNP
rs1409458318 837 dbSNP
rs1426066534 860 dbSNP
rs1174559907 870 dbSNP
rs1479312038 871 dbSNP
rs868926311 873 dbSNP
rs1698713 874 dbSNP
rs1267883173 875 dbSNP
rs1182699470 876 dbSNP
rs587728543 885 dbSNP
rs587671196 897 dbSNP
rs587597138 898 dbSNP
rs1312285774 919 dbSNP
rs1280246812 920 dbSNP
rs1221270222 921 dbSNP
rs1322453239 922 dbSNP
rs868958675 927 dbSNP
rs375361064 928 dbSNP
rs1283025828 934 dbSNP
rs1410898241 939 dbSNP
rs1376080560 946 dbSNP
rs1296973974 949 dbSNP
rs1441507340 954 dbSNP
rs1359850100 960 dbSNP
rs1338829647 962 dbSNP
rs1468413352 976 dbSNP
rs868946426 983 dbSNP
rs587716726 984 dbSNP
rs1428931030 1000 dbSNP
rs1159627939 1003 dbSNP
rs1473455756 1013 dbSNP
rs1405634104 1024 dbSNP
rs1176594049 1025 dbSNP
rs1238655086 1027 dbSNP
rs1201247571 1031 dbSNP
rs1460550151 1035 dbSNP
rs1268442887 1048 dbSNP
rs1229380460 1062 dbSNP
rs1319155114 1067 dbSNP
rs1305449955 1081 dbSNP
rs1223676329 1083 dbSNP
rs1380555214 1128 dbSNP
rs1338713000 1136 dbSNP
rs1450544216 1138 dbSNP
rs1405612071 1140 dbSNP
rs1321531138 1147 dbSNP
rs587649497 1154 dbSNP
rs1455127145 1160 dbSNP
rs781936147 1176 dbSNP
rs1343177937 1181 dbSNP
rs1158135621 1190 dbSNP
rs1424267806 1195 dbSNP
rs1387021509 1196 dbSNP
rs587602350 1212 dbSNP
rs587720178 1217 dbSNP
rs1443541799 1224 dbSNP
rs1248233701 1227 dbSNP
rs587666271 1240 dbSNP
rs1210252918 1242 dbSNP
rs370664186 1245 dbSNP
rs1259278216 1247 dbSNP
rs1215533495 1261 dbSNP
rs782019977 1267 dbSNP
rs1322773853 1269 dbSNP
rs1317856768 1272 dbSNP
rs1243851071 1274 dbSNP
rs1382183202 1291 dbSNP
rs1298466535 1307 dbSNP
rs1384091029 1309 dbSNP
rs1360154329 1321 dbSNP
rs1288003681 1331 dbSNP
rs1458281269 1353 dbSNP
rs1367355193 1354 dbSNP
rs1161646861 1368 dbSNP
rs587709394 1371 dbSNP
rs1390211759 1387 dbSNP
rs1194720446 1395 dbSNP
rs1426305065 1397 dbSNP
rs1260612894 1402 dbSNP
rs587675088 1404 dbSNP
rs1489042238 1413 dbSNP
rs1294553648 1418 dbSNP
rs1220857610 1420 dbSNP
rs1359385606 1421 dbSNP
rs371479159 1422 dbSNP
rs1275371971 1427 dbSNP
rs1229712450 1441 dbSNP
rs587694482 1450 dbSNP
rs587611765 1460 dbSNP
rs1387115225 1461 dbSNP
rs879995659 1467 dbSNP
rs1347205887 1478 dbSNP
rs1301095652 1479 dbSNP
rs1404205893 1480 dbSNP
rs1371099289 1484 dbSNP
rs587741565 1490 dbSNP
rs1460082165 1497 dbSNP
rs587683471 1499 dbSNP
rs1176392564 1500 dbSNP
rs1481233558 1524 dbSNP
rs1271439729 1554 dbSNP
rs1197733233 1558 dbSNP
rs376567043 1560 dbSNP
rs1251954792 1578 dbSNP
rs1197616505 1579 dbSNP
rs1337588818 1584 dbSNP
rs1250939502 1586 dbSNP
rs1234186274 1596 dbSNP
rs1325952715 1612 dbSNP
rs880003275 1620 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 9659.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgagaaaagUAAUU-ACAUCUGu 5'
                   || || ||||||| 
Target 5' --------gAUGAACUGUAGACc 3'
 		1 - 15
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293/HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1067869. RNA binding protein: AGO2. Condition:Ago2 IP-seq (asynchronous cells) HITS-CLIP data was present in GSM1067870. RNA binding protein: AGO2. Condition:Ago2 IP-seq (mitotic cells) ...

- Kishore S; Gruber AR; Jedlinski DJ; Syed et al., 2013, Genome biology.

Article - Kishore S; Gruber AR; Jedlinski DJ; Syed et al.
- Genome biology, 2013
BACKGROUND: In recent years, a variety of small RNAs derived from other RNAs with well-known functions such as tRNAs and snoRNAs, have been identified. The functional relevance of these RNAs is largely unknown. To gain insight into the complexity of snoRNA processing and the functional relevance of snoRNA-derived small RNAs, we sequence long and short RNAs, small RNAs that co-precipitate with the Argonaute 2 protein and RNA fragments obtained in photoreactive nucleotide-enhanced crosslinking and immunoprecipitation (PAR-CLIP) of core snoRNA-associated proteins. RESULTS: Analysis of these data sets reveals that many loci in the human genome reproducibly give rise to C/D box-like snoRNAs, whose expression and evolutionary conservation are typically less pronounced relative to the snoRNAs that are currently cataloged. We further find that virtually all C/D box snoRNAs are specifically processed inside the regions of terminal complementarity, retaining in the mature form only 4-5 nucleotides upstream of the C box and 2-5 nucleotides downstream of the D box. Sequencing of the total and Argonaute 2-associated populations of small RNAs reveals that despite their cellular abundance, C/D box-derived small RNAs are not efficiently incorporated into the Ago2 protein. CONCLUSIONS: We conclude that the human genome encodes a large number of snoRNAs that are processed along the canonical pathway and expressed at relatively low levels. Generation of snoRNA-derived processing products with alternative, particularly miRNA-like, functions appears to be uncommon.
LinkOut: [PMID: 23706177]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084046. RNA binding protein: AGO2. Condition:CLIP_noarsenite_rep4 HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions Cardiac Tissues
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM2202479. RNA binding protein: AGO2. Condition:S4_LV_29yo_Male_AGO2_bound_RNA ...

- Spengler RM; Zhang X; Cheng C; McLendon JM; et al., 2016, Nucleic acids research.

Article - Spengler RM; Zhang X; Cheng C; McLendon JM; et al.
- Nucleic acids research, 2016
MicroRNAs (miRs) have emerged as key biological effectors in human health and disease. These small noncoding RNAs are incorporated into Argonaute (Ago) proteins, where they direct post-transcriptional gene silencing via base-pairing with target transcripts. Although miRs have become intriguing biological entities and attractive therapeutic targets, the translational impacts of miR research remain limited by a paucity of empirical miR targeting data, particularly in human primary tissues. Here, to improve our understanding of the diverse roles miRs play in cardiovascular function and disease, we applied high-throughput methods to globally profile miR:target interactions in human heart tissues. We deciphered Ago2:RNA interactions using crosslinking immunoprecipitation coupled with high-throughput sequencing (HITS-CLIP) to generate the first transcriptome-wide map of miR targeting events in human myocardium, detecting 4000 cardiac Ago2 binding sites across >2200 target transcripts. Our initial exploration of this interactome revealed an abundance of miR target sites in gene coding regions, including several sites pointing to new miR-29 functions in regulating cardiomyocyte calcium, growth and metabolism. Also, we uncovered several clinically-relevant interactions involving common genetic variants that alter miR targeting events in cardiomyopathy-associated genes. Overall, these data provide a critical resource for bolstering translational miR research in heart, and likely beyond.
LinkOut: [PMID: 27418678]
CLIP-seq Support 1 for dataset GSM1067869
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (asynchronous cells)
Location of target site ENST00000369345.4 | 3UTR | GACCUCUCUCUCUCUCUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1067870
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293/HeLa / Ago2 IP-seq (mitotic cells)
Location of target site ENST00000369345.4 | 3UTR | GACCUCUCUCUCUCUCUCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23706177 / GSE43666
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1084046
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_noarsenite_rep4
Location of target site ENST00000369345.4 | 3UTR | UGUAGACCUCUCUCUCUCUCUCUCUCUCUCUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1084079
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_AbnovaAb
Location of target site ENST00000369345.4 | 3UTR | UAGACCUCUCUCUCUCUCUCUCUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000369345.4 | 3UTR | GAUGAACUGUAGACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
29 hsa-miR-3618 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT378435 SOX4 SRY-box 4 2 2
MIRT459627 GABARAP GABA type A receptor-associated protein 2 2
MIRT471295 PGAM4 phosphoglycerate mutase family member 4 2 2
MIRT471369 PDZD8 PDZ domain containing 8 2 2
MIRT504886 MRPL51 mitochondrial ribosomal protein L51 2 2
MIRT505938 RBM33 RNA binding motif protein 33 2 8
MIRT525461 TMPRSS12 transmembrane protease, serine 12 2 2
MIRT526767 ZNF527 zinc finger protein 527 2 2
MIRT526990 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT528669 PDE4DIP phosphodiesterase 4D interacting protein 2 6
MIRT538462 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT542899 HSBP1 heat shock factor binding protein 1 2 2
MIRT550274 AHI1 Abelson helper integration site 1 2 2
MIRT551674 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT551689 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT551755 TRIM42 tripartite motif containing 42 2 2
MIRT555769 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556241 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT556926 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 4
MIRT562638 ARID1A AT-rich interaction domain 1A 2 2
MIRT571348 RPL37 ribosomal protein L37 2 2
MIRT612818 KLHL3 kelch like family member 3 2 2
MIRT619329 TIPRL TOR signaling pathway regulator 2 4
MIRT653927 SERPINC1 serpin family C member 1 2 2
MIRT659150 DDHD1 DDHD domain containing 1 2 2
MIRT688334 FAM126B family with sequence similarity 126 member B 2 2
MIRT694760 FZD2 frizzled class receptor 2 2 2
MIRT700477 PUM1 pumilio RNA binding family member 1 2 2
MIRT702375 KLF10 Kruppel like factor 10 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3618 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-3618 Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-3618 Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-mir-3618 Methotrexate 126941 NSC740 approved sensitive cell line (W1)
hsa-mir-3618 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3618 Tamoxifen 2733525 NSC180973 approved resistant cell line (LCC2)
hsa-miR-3618 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-3618 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3618 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-3618 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission