pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-16-2 |
Genomic Coordinates | chr3: 160404745 - 160404825 |
Description | Homo sapiens miR-16-2 stem-loop |
Comment | This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references . |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-16-2-3p | ||||||||||||||||||
Sequence | 53| CCAAUAUUACUGUGCUGCUUUA |74 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | EI24 | ||||||||||||||||||||
Synonyms | EPG4, PIG8, TP53I8 | ||||||||||||||||||||
Description | EI24, autophagy associated transmembrane protein | ||||||||||||||||||||
Transcript | NM_004879 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on EI24 | |||||||||||||||||||||
3'UTR of EI24 (miRNA target sites are highlighted) |
>EI24|NM_004879|3'UTR 1 GTTGCCTGCCATCCAAAGGGGATGGGCGGGATTGGAAGAAGCTGTGGCAGCTCTTTTCCCTGTTCACCTCCCGCCTGCCA 81 GGGAAGGCAGGACCCGCTCTGCCAAGGGCCCTCTGCGTATTCCCTTCTCTCTGAGGAATTGAAATTTTTGTCTCTGGTGC 161 ACGTAAGGCAGAATGTTCCCTGACACCAGTGTGTGGATTTTTAACATCACCGTGAGTCTGAAAGGACCACAGGTTTTTCT 241 GCAGCTATTTTCTAGCATTTGCCAGTCCCTGTGCCTGGACTGATTGGAACACTTTGTTTTTCTCCCTGTGCCATTTACCC 321 TTCCACCTTTCCATCCTGCCTTCTACCACCCTTGGATGAATGGATTTTGTAATTCTAGCTGTTGTATTTTGTGAATTTGT 401 TAATTTTGTTGTTTTTCTGTGAAACACATACATTGGATATGGGAGGTAAAGGAGTGTCCCAGTTGCTCCTGGTCACTCCC 481 TTTATAGCCATTACTGTCTTGTTTCTTGTAACTCAGGTTAGGTTTTGGTCTCTCTTGCTCCACTGCAAAAAAAAAAAAAA 561 AAAAAAAAAAAAAAAAAAAGCCTGAAGAGATGAGATAGGAGGAAAGACCTCACAGCCAGATCTGCTGGGTTTTGAGGAGT 641 GATTTTCTTTCTTCCCCTTGAAGGGGAAAAAGCTATTTTCATTGGTACATTTAAAGTCCCCCAACTATGGGGAGGTACCA 721 ATTCTGGACAAGTGCCACTACAACAACACTAAACCTGAACTTTTCAACTCCGTTGGTGGTGGGAGGCAGCGGGCAGAAAT 801 TTACTGTTGGCCACTGCCAGGTCTATTTCATATTTCAAAGGAATATTGGGTGCTGCATATAGGAACTGAAGGGGTCAATG 881 TATTAAACCTGTGATTGGTTGTTTTCCTGTCATTTTGAGAGACTAAATGTGGGGGGCAGATGTCAAAATACCTGTACAAT 961 TTTAAAATGTCACAATTAAACATGAGCTGGTTTCCCACAAAGTGTC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 9538.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000343678.4 | 3UTR | AGGAAUAUUGGGUGCUGCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
75 hsa-miR-16-2-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT004488 | RARB | retinoic acid receptor beta | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT038707 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | ![]() |
1 | 1 | |||||||
MIRT057208 | PPIF | peptidylprolyl isomerase F | ![]() |
![]() |
2 | 4 | ||||||
MIRT058726 | RSBN1 | round spermatid basic protein 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT074502 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT081544 | ZNF431 | zinc finger protein 431 | ![]() |
![]() |
2 | 4 | ||||||
MIRT096893 | ERBB2IP | erbb2 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT105124 | MYC | MYC proto-oncogene, bHLH transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT107898 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT109432 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 6 | ||||||
MIRT166742 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | ![]() |
![]() |
2 | 6 | ||||||
MIRT171257 | YWHAG | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma | ![]() |
![]() |
2 | 2 | ||||||
MIRT192760 | B2M | beta-2-microglobulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT194905 | RBBP6 | RB binding protein 6, ubiquitin ligase | ![]() |
![]() |
2 | 8 | ||||||
MIRT215599 | SUB1 | SUB1 homolog, transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT223632 | ATP6V1C1 | ATPase H+ transporting V1 subunit C1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT241605 | AMOTL1 | angiomotin like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT291174 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT444286 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT463285 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT471759 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 8 | ||||||
MIRT479611 | CDC25A | cell division cycle 25A | ![]() |
![]() |
2 | 2 | ||||||
MIRT481497 | ARL6IP1 | ADP ribosylation factor like GTPase 6 interacting protein 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT483117 | SH3BP5 | SH3 domain binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT502279 | GRPEL2 | GrpE like 2, mitochondrial | ![]() |
![]() |
2 | 8 | ||||||
MIRT507838 | CCNT1 | cyclin T1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT508179 | MTRNR2L6 | MT-RNR2-like 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT510576 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT517853 | RPS4X | ribosomal protein S4, X-linked | ![]() |
![]() |
2 | 4 | ||||||
MIRT521690 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT525070 | FRK | fyn related Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT527082 | UBE2E3 | ubiquitin conjugating enzyme E2 E3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529552 | EI24 | EI24, autophagy associated transmembrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530426 | SULT1B1 | sulfotransferase family 1B member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533909 | TBC1D15 | TBC1 domain family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT536627 | IPO7 | importin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT537647 | ERGIC2 | ERGIC and golgi 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT538512 | CLCN3 | chloride voltage-gated channel 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539219 | ANP32E | acidic nuclear phosphoprotein 32 family member E | ![]() |
![]() |
2 | 6 | ||||||
MIRT539348 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 4 | ||||||
MIRT539954 | CCT4 | chaperonin containing TCP1 subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541208 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543216 | TMEM117 | transmembrane protein 117 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543399 | DROSHA | drosha ribonuclease III | ![]() |
![]() |
2 | 2 | ||||||
MIRT546648 | RPS6KA5 | ribosomal protein S6 kinase A5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546852 | RAB1A | RAB1A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT549917 | MRPS30 | mitochondrial ribosomal protein S30 | ![]() |
![]() |
2 | 2 | ||||||
MIRT552998 | USP46 | ubiquitin specific peptidase 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT555254 | PREPL | prolyl endopeptidase-like | ![]() |
![]() |
2 | 2 | ||||||
MIRT555956 | NRIP1 | nuclear receptor interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557095 | HOXA9 | homeobox A9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561396 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT561654 | RNF219 | ring finger protein 219 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563101 | PABPC4L | poly(A) binding protein cytoplasmic 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT565979 | RNF44 | ring finger protein 44 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572396 | CCDC14 | coiled-coil domain containing 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574400 | TM9SF3 | transmembrane 9 superfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT607623 | VSNL1 | visinin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610645 | CTGF | connective tissue growth factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT623379 | LPP | LIM domain containing preferred translocation partner in lipoma | ![]() |
![]() |
2 | 2 | ||||||
MIRT624687 | AR | androgen receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT632089 | ALDH1A2 | aldehyde dehydrogenase 1 family member A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT644216 | CBS | cystathionine-beta-synthase | ![]() |
![]() |
2 | 2 | ||||||
MIRT647841 | BID | BH3 interacting domain death agonist | ![]() |
![]() |
2 | 2 | ||||||
MIRT651649 | WASF2 | WAS protein family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689064 | AGMAT | agmatinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT698150 | TNPO1 | transportin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700516 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT704081 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705970 | ACBD5 | acyl-CoA binding domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT715694 | COMMD3-BMI1 | COMMD3-BMI1 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT717184 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT724607 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT724854 | IGFBP5 | insulin like growth factor binding protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725401 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|