pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-412 |
Genomic Coordinates | chr14: 101065447 - 101065537 |
Synonyms | MIRN412, hsa-mir-412, MIR412 |
Description | Homo sapiens miR-412 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-412-3p | |||||||||||||||||||||||||||||||||||||||
Sequence | 54| ACUUCACCUGGUCCACUAGCCGU |76 | |||||||||||||||||||||||||||||||||||||||
Evidence | Not_experimental | |||||||||||||||||||||||||||||||||||||||
Experiments | DRVs in miRNA |
|
||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
|||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |
---|---|
Gene Symbol | C1orf64 |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 149563.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000329454.2 | 3UTR | AGUGAUUGGGGUGAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000329454.2 | 3UTR | GAGUGAUUGGGGUGAAGAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
138 hsa-miR-412-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT005780 | ACVR1C | activin A receptor type 1C | ![]() |
1 | 1 | |||||||
MIRT062013 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT345112 | ATXN7L3 | ataxin 7 like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT383735 | EDEM3 | ER degradation enhancing alpha-mannosidase like protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT396956 | CELF1 | CUGBP Elav-like family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT439280 | XIAP | X-linked inhibitor of apoptosis | ![]() |
1 | 1 | |||||||
MIRT439313 | VAT1 | vesicle amine transport 1 | ![]() |
1 | 1 | |||||||
MIRT439375 | TUBA1A | tubulin alpha 1a | ![]() |
1 | 1 | |||||||
MIRT439418 | TMOD1 | tropomodulin 1 | ![]() |
1 | 1 | |||||||
MIRT439503 | SURF4 | surfeit 4 | ![]() |
1 | 1 | |||||||
MIRT439563 | SON | SON DNA binding protein | ![]() |
1 | 1 | |||||||
MIRT439598 | SLC3A2 | solute carrier family 3 member 2 | ![]() |
1 | 1 | |||||||
MIRT439670 | SETD1B | SET domain containing 1B | ![]() |
1 | 1 | |||||||
MIRT439767 | RMND5A | required for meiotic nuclear division 5 homolog A | ![]() |
1 | 1 | |||||||
MIRT439922 | PPL | periplakin | ![]() |
1 | 1 | |||||||
MIRT439947 | PLEKHA6 | pleckstrin homology domain containing A6 | ![]() |
1 | 1 | |||||||
MIRT439952 | PLCB4 | phospholipase C beta 4 | ![]() |
1 | 1 | |||||||
MIRT439961 | PKD1 | polycystin 1, transient receptor potential channel interacting | ![]() |
1 | 1 | |||||||
MIRT440005 | PEG3 | paternally expressed 3 | ![]() |
1 | 1 | |||||||
MIRT440061 | OSBPL8 | oxysterol binding protein like 8 | ![]() |
1 | 1 | |||||||
MIRT440166 | MYH14 | myosin heavy chain 14 | ![]() |
1 | 1 | |||||||
MIRT440276 | MAPK8IP1 | mitogen-activated protein kinase 8 interacting protein 1 | ![]() |
1 | 1 | |||||||
MIRT440437 | IPO13 | importin 13 | ![]() |
1 | 1 | |||||||
MIRT440441 | INTS3 | integrator complex subunit 3 | ![]() |
1 | 1 | |||||||
MIRT440448 | INS | insulin | ![]() |
1 | 1 | |||||||
MIRT440461 | IGF2R | insulin like growth factor 2 receptor | ![]() |
1 | 1 | |||||||
MIRT440472 | IARS | isoleucyl-tRNA synthetase | ![]() |
1 | 1 | |||||||
MIRT440530 | GUCY1A3 | guanylate cyclase 1 soluble subunit alpha | ![]() |
1 | 1 | |||||||
MIRT440542 | GOLGA2 | golgin A2 | ![]() |
1 | 1 | |||||||
MIRT440569 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
1 | 1 | |||||||
MIRT440608 | FTSJD2 | cap methyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT440750 | EEF1A2 | eukaryotic translation elongation factor 1 alpha 2 | ![]() |
1 | 1 | |||||||
MIRT440781 | DOT1L | DOT1 like histone lysine methyltransferase | ![]() |
1 | 1 | |||||||
MIRT440804 | DNAJA4 | DnaJ heat shock protein family (Hsp40) member A4 | ![]() |
1 | 1 | |||||||
MIRT440867 | CSDE1 | cold shock domain containing E1 | ![]() |
1 | 1 | |||||||
MIRT440890 | CPEB4 | cytoplasmic polyadenylation element binding protein 4 | ![]() |
1 | 1 | |||||||
MIRT440917 | COL1A1 | collagen type I alpha 1 chain | ![]() |
1 | 1 | |||||||
MIRT440967 | CDH22 | cadherin 22 | ![]() |
1 | 1 | |||||||
MIRT440968 | CDH2 | cadherin 2 | ![]() |
1 | 1 | |||||||
MIRT441024 | CALR | calreticulin | ![]() |
1 | 1 | |||||||
MIRT441278 | ACTB | actin beta | ![]() |
1 | 1 | |||||||
MIRT448421 | TNFAIP3 | TNF alpha induced protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462833 | BCL3 | B-cell CLL/lymphoma 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465062 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT476050 | GRSF1 | G-rich RNA sequence binding factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485318 | MZT1 | mitotic spindle organizing protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT493584 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT494567 | BAK1 | BCL2 antagonist/killer 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT497393 | RALY | RALY heterogeneous nuclear ribonucleoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT503250 | ZNF257 | zinc finger protein 257 | ![]() |
![]() |
2 | 10 | ||||||
MIRT503656 | ZNF138 | zinc finger protein 138 | ![]() |
![]() |
2 | 10 | ||||||
MIRT505882 | RNF219 | ring finger protein 219 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507525 | DSTN | destrin, actin depolymerizing factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT510663 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT514682 | ZNF701 | zinc finger protein 701 | ![]() |
![]() |
2 | 4 | ||||||
MIRT515370 | ZNF208 | zinc finger protein 208 | ![]() |
![]() |
2 | 6 | ||||||
MIRT525237 | KCNJ12 | potassium voltage-gated channel subfamily J member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527963 | MTAP | methylthioadenosine phosphorylase | ![]() |
![]() |
2 | 2 | ||||||
MIRT528482 | STAMBPL1 | STAM binding protein like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT529909 | C1orf64 | steroid receptor associated and regulated protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT531558 | SRD5A1 | steroid 5 alpha-reductase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532234 | KLF2 | Kruppel like factor 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT532480 | HOXA13 | homeobox A13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535544 | P2RY2 | purinergic receptor P2Y2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT547311 | NR1D2 | nuclear receptor subfamily 1 group D member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT551795 | ZNF117 | zinc finger protein 117 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554939 | RAP1A | RAP1A, member of RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT558171 | EIF5A2 | eukaryotic translation initiation factor 5A2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT568771 | LY6K | lymphocyte antigen 6 family member K | ![]() |
![]() |
2 | 2 | ||||||
MIRT570766 | ZNF99 | zinc finger protein 99 | ![]() |
![]() |
2 | 2 | ||||||
MIRT572405 | MRPS14 | mitochondrial ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT573396 | DLC1 | DLC1 Rho GTPase activating protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT610403 | RXRB | retinoid X receptor beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT610886 | SCN8A | sodium voltage-gated channel alpha subunit 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611197 | TMEM105 | transmembrane protein 105 | ![]() |
![]() |
2 | 2 | ||||||
MIRT611244 | ZNF550 | zinc finger protein 550 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615669 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT617974 | DOCK4 | dedicator of cytokinesis 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619150 | ZNF326 | zinc finger protein 326 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619608 | MKKS | McKusick-Kaufman syndrome | ![]() |
![]() |
2 | 2 | ||||||
MIRT621053 | DGKD | diacylglycerol kinase delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT623665 | HRK | harakiri, BCL2 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT624883 | AASDHPPT | aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase | ![]() |
![]() |
2 | 2 | ||||||
MIRT624939 | MARCH2 | membrane associated ring-CH-type finger 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634198 | TMOD2 | tropomodulin 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT636727 | AGO2 | argonaute 2, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT637741 | POLR3K | RNA polymerase III subunit K | ![]() |
![]() |
2 | 2 | ||||||
MIRT638002 | ZC3H13 | zinc finger CCCH-type containing 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640395 | ZNF785 | zinc finger protein 785 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640505 | ANTXR1 | anthrax toxin receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641293 | SLAMF1 | signaling lymphocytic activation molecule family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641863 | STOML1 | stomatin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642600 | C14orf180 | chromosome 14 open reading frame 180 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642895 | CASP1 | caspase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643967 | FHL2 | four and a half LIM domains 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT645237 | KCTD12 | potassium channel tetramerization domain containing 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT646621 | CENPL | centromere protein L | ![]() |
![]() |
2 | 2 | ||||||
MIRT648620 | CYB561A3 | cytochrome b561 family member A3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648908 | ZNF551 | zinc finger protein 551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649439 | HIBADH | 3-hydroxyisobutyrate dehydrogenase | ![]() |
![]() |
2 | 2 | ||||||
MIRT650637 | LTF | lactotransferrin | ![]() |
![]() |
2 | 2 | ||||||
MIRT650971 | STARD3NL | STARD3 N-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT651067 | ZNF518B | zinc finger protein 518B | ![]() |
![]() |
2 | 4 | ||||||
MIRT652384 | TMEM55A | phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT653958 | SEPN1 | selenoprotein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT656885 | KIF1C | kinesin family member 1C | ![]() |
![]() |
2 | 2 | ||||||
MIRT657965 | GAPVD1 | GTPase activating protein and VPS9 domains 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658080 | FOXR2 | forkhead box R2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT662570 | IL2RA | interleukin 2 receptor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT663089 | METTL10 | EEF1A lysine methyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683705 | ZNF195 | zinc finger protein 195 | ![]() |
![]() |
2 | 2 | ||||||
MIRT683835 | ZNF682 | zinc finger protein 682 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706811 | APOL4 | apolipoprotein L4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT707575 | DYNC2LI1 | dynein cytoplasmic 2 light intermediate chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708606 | ZNF260 | zinc finger protein 260 | ![]() |
![]() |
2 | 2 | ||||||
MIRT708859 | TMSB4X | thymosin beta 4, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT709861 | PDIK1L | PDLIM1 interacting kinase 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT709987 | RBM41 | RNA binding motif protein 41 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710098 | KPNA5 | karyopherin subunit alpha 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710211 | ENAH | ENAH, actin regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT710868 | B3GALNT1 | beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT710986 | SUSD5 | sushi domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711460 | RNF145 | ring finger protein 145 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712302 | PGM2L1 | phosphoglucomutase 2 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713609 | SYTL4 | synaptotagmin like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713789 | MAK16 | MAK16 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT715480 | MYO9B | myosin IXB | ![]() |
![]() |
2 | 2 | ||||||
MIRT716328 | POU5F1 | POU class 5 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT717252 | TMEM246 | transmembrane protein 246 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718077 | CLIC5 | chloride intracellular channel 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718463 | EED | embryonic ectoderm development | ![]() |
![]() |
2 | 2 | ||||||
MIRT718645 | NKPD1 | NTPase KAP family P-loop domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718982 | PIGO | phosphatidylinositol glycan anchor biosynthesis class O | ![]() |
![]() |
2 | 2 | ||||||
MIRT721078 | RPS9 | ribosomal protein S9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721419 | SEC24A | SEC24 homolog A, COPII coat complex component | ![]() |
![]() |
2 | 2 | ||||||
MIRT721863 | CENPJ | centromere protein J | ![]() |
![]() |
2 | 2 | ||||||
MIRT722492 | PNKD | paroxysmal nonkinesigenic dyskinesia | ![]() |
![]() |
2 | 2 | ||||||
MIRT723391 | CALN1 | calneuron 1 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|