pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1303 |
Genomic Coordinates | chr5: 154685776 - 154685861 |
Synonyms | MIRN1303, hsa-mir-1303, MIR1303 |
Description | Homo sapiens miR-1303 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1303 | ||||||||||||||||||||||||||||||||||||||||||
Sequence | 52| UUUAGAGACGGGGUCUUGCUCU |73 | ||||||||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PPIC | ||||||||||||||||||||
Synonyms | CYPC | ||||||||||||||||||||
Description | peptidylprolyl isomerase C | ||||||||||||||||||||
Transcript | NM_000943 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PPIC | |||||||||||||||||||||
3'UTR of PPIC (miRNA target sites are highlighted) |
>PPIC|NM_000943|3'UTR 1 CACAACTGGCAGAAAACAAGGATATGCTTTGGCAGGGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGTGTTGTCTTTC 81 AATTATTTGCTTTTTTTTTTTTACTTTCTTTTTGTATTCTATCCCAGATCACAGGAAAGTTATAAAAATCAAACCGTCAC 161 CCTTTAGTTTGCTTGAACTTTAGTAAACCACCTGCTTAGGGACTTTGAACTTAAATATATCCCCTTCCTCAAGTGGTGCT 241 ATTTTAAAACTAAAAAAAACTTTGAATTGGCTATTTTTTTAATGCAATATTTTTTTTCTGAATTCATTATGATCCCCATA 321 TTGGGTAATGCTGAACATTTATCTGAAACAGATGAGGATATTATTATTTTGTATCCAAACAGAAATTCAGATAAAGGGAA 401 ATTTGACTAGTGTAATCTGAGATATGTCATAGGGATTTCTTTCTGACAAAAGGGTGCTTTGCTGTTCTTTATATTAAATA 481 CTTTTAGATCAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 5480.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 5480.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000306442.4 | 3UTR | CAGCCUGGGCAACAUAGUGAGACCCUGUCUCUAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000306442.4 | 3UTR | CCAGCCUGGGCAACAUAGUGAGACCCUGUCUCUAA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT035871 | SOAT1 | sterol O-acyltransferase 1 | ![]() |
1 | 1 | |||||||
MIRT035872 | FHOD3 | formin homology 2 domain containing 3 | ![]() |
1 | 1 | |||||||
MIRT035873 | RPL7A | ribosomal protein L7a | ![]() |
1 | 1 | |||||||
MIRT035874 | NCAPD2 | non-SMC condensin I complex subunit D2 | ![]() |
1 | 1 | |||||||
MIRT035875 | RPS8 | ribosomal protein S8 | ![]() |
1 | 1 | |||||||
MIRT035876 | AHNAK | AHNAK nucleoprotein | ![]() |
1 | 1 | |||||||
MIRT035877 | ACTB | actin beta | ![]() |
1 | 1 | |||||||
MIRT035878 | DEF8 | differentially expressed in FDCP 8 homolog | ![]() |
1 | 1 | |||||||
MIRT035879 | MET | MET proto-oncogene, receptor tyrosine kinase | ![]() |
1 | 1 | |||||||
MIRT035880 | MED13 | mediator complex subunit 13 | ![]() |
1 | 1 | |||||||
MIRT035881 | FAT3 | FAT atypical cadherin 3 | ![]() |
1 | 1 | |||||||
MIRT035882 | HUWE1 | HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase | ![]() |
1 | 1 | |||||||
MIRT035883 | RPS16 | ribosomal protein S16 | ![]() |
1 | 1 | |||||||
MIRT035884 | CDK6 | cyclin dependent kinase 6 | ![]() |
1 | 1 | |||||||
MIRT035885 | GEMIN5 | gem nuclear organelle associated protein 5 | ![]() |
1 | 1 | |||||||
MIRT035886 | PITRM1 | pitrilysin metallopeptidase 1 | ![]() |
1 | 1 | |||||||
MIRT035887 | PRRC2A | proline rich coiled-coil 2A | ![]() |
1 | 1 | |||||||
MIRT035888 | KIAA0226 | RUN and cysteine rich domain containing beclin 1 interacting protein | ![]() |
1 | 1 | |||||||
MIRT035889 | MLLT6 | MLLT6, PHD finger containing | ![]() |
1 | 1 | |||||||
MIRT035890 | EIF3I | eukaryotic translation initiation factor 3 subunit I | ![]() |
1 | 1 | |||||||
MIRT035891 | FASN | fatty acid synthase | ![]() |
1 | 1 | |||||||
MIRT035892 | LEPREL4 | prolyl 3-hydroxylase family member 4 (non-enzymatic) | ![]() |
1 | 1 | |||||||
MIRT035893 | HSCB | HscB mitochondrial iron-sulfur cluster cochaperone | ![]() |
1 | 1 | |||||||
MIRT035894 | PSME4 | proteasome activator subunit 4 | ![]() |
1 | 1 | |||||||
MIRT035895 | FRS2 | fibroblast growth factor receptor substrate 2 | ![]() |
1 | 1 | |||||||
MIRT035896 | ZNF264 | zinc finger protein 264 | ![]() |
1 | 1 | |||||||
MIRT035897 | HYLS1 | HYLS1, centriolar and ciliogenesis associated | ![]() |
1 | 1 | |||||||
MIRT035898 | USP54 | ubiquitin specific peptidase 54 | ![]() |
1 | 1 | |||||||
MIRT035899 | L1TD1 | LINE1 type transposase domain containing 1 | ![]() |
1 | 1 | |||||||
MIRT035900 | OR51E2 | olfactory receptor family 51 subfamily E member 2 | ![]() |
1 | 1 | |||||||
MIRT053762 | CLDN18 | claudin 18 | ![]() |
![]() |
![]() |
3 | 1 | |||||
MIRT060730 | RPS3 | ribosomal protein S3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT083986 | RAB22A | RAB22A, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT098550 | TBPL1 | TATA-box binding protein like 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT134983 | TWF1 | twinfilin actin binding protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT136956 | FNDC3A | fibronectin type III domain containing 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT222065 | PURB | purine rich element binding protein B | ![]() |
![]() |
2 | 2 | ||||||
MIRT239574 | UBN2 | ubinuclein 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT261820 | BUB3 | BUB3, mitotic checkpoint protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT264698 | C11ORF57 | chromosome 11 open reading frame 57 | ![]() |
![]() |
2 | 4 | ||||||
MIRT308476 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT377481 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT442304 | NEU3 | neuraminidase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT446083 | SLC30A10 | solute carrier family 30 member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449606 | PRPF4 | pre-mRNA processing factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453767 | NUCB1 | nucleobindin 1 | ![]() |
![]() |
2 | 10 | ||||||
MIRT455603 | SRSF3 | serine and arginine rich splicing factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455913 | KIF2C | kinesin family member 2C | ![]() |
![]() |
2 | 2 | ||||||
MIRT460091 | ZYG11B | zyg-11 family member B, cell cycle regulator | ![]() |
![]() |
2 | 4 | ||||||
MIRT460866 | UBE2S | ubiquitin conjugating enzyme E2 S | ![]() |
![]() |
2 | 2 | ||||||
MIRT461339 | NUP133 | nucleoporin 133 | ![]() |
![]() |
2 | 2 | ||||||
MIRT463769 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT466368 | THAP1 | THAP domain containing 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT467168 | SPTY2D1 | SPT2 chromatin protein domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468703 | SDHD | succinate dehydrogenase complex subunit D | ![]() |
![]() |
2 | 2 | ||||||
MIRT469122 | RNF126 | ring finger protein 126 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472426 | NCBP2 | nuclear cap binding protein subunit 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT479420 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 8 | ||||||
MIRT484260 | FAM177A1 | family with sequence similarity 177 member A1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT485468 | IL6ST | interleukin 6 signal transducer | ![]() |
![]() |
2 | 10 | ||||||
MIRT490237 | H2AFZ | H2A histone family member Z | ![]() |
![]() |
2 | 6 | ||||||
MIRT491002 | ATF7IP | activating transcription factor 7 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT492127 | SUMO2 | small ubiquitin-like modifier 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT499169 | RBPJL | recombination signal binding protein for immunoglobulin kappa J region like | ![]() |
![]() |
2 | 2 | ||||||
MIRT499825 | PCSK9 | proprotein convertase subtilisin/kexin type 9 | ![]() |
![]() |
2 | 8 | ||||||
MIRT501794 | NRAS | NRAS proto-oncogene, GTPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT503441 | GINS4 | GINS complex subunit 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT503688 | MAVS | mitochondrial antiviral signaling protein | ![]() |
![]() |
2 | 5 | ||||||
MIRT506926 | IGDCC4 | immunoglobulin superfamily DCC subclass member 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT511430 | HOXA10 | homeobox A10 | ![]() |
![]() |
2 | 6 | ||||||
MIRT512415 | LAYN | layilin | ![]() |
![]() |
2 | 4 | ||||||
MIRT513791 | NIPAL3 | NIPA like domain containing 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516163 | NTMT1 | N-terminal Xaa-Pro-Lys N-methyltransferase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT516513 | PARK2 | parkin RBR E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT516915 | HINFP | histone H4 transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT517102 | NDUFV3 | NADH:ubiquinone oxidoreductase subunit V3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517350 | NLRP9 | NLR family pyrin domain containing 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518019 | ABHD15 | abhydrolase domain containing 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT520945 | SRSF10 | serine and arginine rich splicing factor 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525250 | RNF213 | ring finger protein 213 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530634 | PPIC | peptidylprolyl isomerase C | ![]() |
![]() |
2 | 4 | ||||||
MIRT530671 | CHRNB1 | cholinergic receptor nicotinic beta 1 subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT531563 | ILDR1 | immunoglobulin like domain containing receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538205 | CYR61 | cysteine rich angiogenic inducer 61 | ![]() |
![]() |
2 | 2 | ||||||
MIRT538419 | COLEC10 | collectin subfamily member 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT541964 | ZNF485 | zinc finger protein 485 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543088 | KNSTRN | kinetochore localized astrin/SPAG5 binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT543257 | ZNF662 | zinc finger protein 662 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543589 | KIAA1549 | KIAA1549 | ![]() |
![]() |
2 | 2 | ||||||
MIRT543955 | RNF20 | ring finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT544043 | C9orf64 | chromosome 9 open reading frame 64 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548064 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548240 | FBXW7 | F-box and WD repeat domain containing 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548442 | EIF1AX | eukaryotic translation initiation factor 1A, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT548623 | DAZAP1 | DAZ associated protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT548770 | COLEC12 | collectin subfamily member 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT549506 | HDDC2 | HD domain containing 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT551924 | AKAP8 | A-kinase anchoring protein 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT555656 | PGRMC1 | progesterone receptor membrane component 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT556286 | MAP3K5 | mitogen-activated protein kinase kinase kinase 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT557012 | HOXD13 | homeobox D13 | ![]() |
![]() |
2 | 4 | ||||||
MIRT563907 | CLSPN | claspin | ![]() |
![]() |
2 | 2 | ||||||
MIRT565527 | SON | SON DNA binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT568000 | COMMD2 | COMM domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569831 | PLA2G16 | phospholipase A2 group XVI | ![]() |
![]() |
2 | 4 | ||||||
MIRT573905 | PARP1 | poly(ADP-ribose) polymerase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT616589 | KLHL9 | kelch like family member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617137 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617400 | API5 | apoptosis inhibitor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT617455 | CCS | copper chaperone for superoxide dismutase | ![]() |
![]() |
2 | 2 | ||||||
MIRT617799 | ZNF793 | zinc finger protein 793 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618190 | MACC1 | MACC1, MET transcriptional regulator | ![]() |
![]() |
2 | 2 | ||||||
MIRT618303 | GNE | glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT618329 | ZNF813 | zinc finger protein 813 | ![]() |
![]() |
2 | 2 | ||||||
MIRT618820 | PHF20 | PHD finger protein 20 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619153 | PPDPF | pancreatic progenitor cell differentiation and proliferation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT619530 | ZNF708 | zinc finger protein 708 | ![]() |
![]() |
2 | 2 | ||||||
MIRT619849 | KIR3DX1 | killer cell immunoglobulin like receptor, three Ig domains X1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT620806 | SLC26A2 | solute carrier family 26 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621312 | YIPF4 | Yip1 domain family member 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621358 | GUCA1B | guanylate cyclase activator 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT621366 | ART4 | ADP-ribosyltransferase 4 (Dombrock blood group) | ![]() |
![]() |
2 | 2 | ||||||
MIRT621547 | ZMYM1 | zinc finger MYM-type containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621883 | TAOK1 | TAO kinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT622451 | RNF19B | ring finger protein 19B | ![]() |
![]() |
2 | 2 | ||||||
MIRT623404 | KREMEN1 | kringle containing transmembrane protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623587 | IPO9 | importin 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT623974 | FAM63A | MINDY lysine 48 deubiquitinase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624086 | DPP8 | dipeptidyl peptidase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT624108 | DNAH10OS | dynein axonemal heavy chain 10 opposite strand | ![]() |
![]() |
2 | 2 | ||||||
MIRT632486 | RNF8 | ring finger protein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634057 | PLIN3 | perilipin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT634657 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640682 | MCUR1 | mitochondrial calcium uniporter regulator 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641242 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT642260 | ZNF677 | zinc finger protein 677 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642954 | RELA | RELA proto-oncogene, NF-kB subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT644326 | IPP | intracisternal A particle-promoted polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT644632 | ICA1L | islet cell autoantigen 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT645721 | POLR3A | RNA polymerase III subunit A | ![]() |
![]() |
2 | 2 | ||||||
MIRT647850 | LYPLA1 | lysophospholipase I | ![]() |
![]() |
2 | 2 | ||||||
MIRT649281 | NEK8 | NIMA related kinase 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT650038 | VHL | von Hippel-Lindau tumor suppressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT650354 | RRP36 | ribosomal RNA processing 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651144 | ZNF384 | zinc finger protein 384 | ![]() |
![]() |
2 | 2 | ||||||
MIRT651778 | UTP6 | UTP6, small subunit processome component | ![]() |
![]() |
2 | 2 | ||||||
MIRT652576 | TLCD2 | TLC domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT654621 | PTPRJ | protein tyrosine phosphatase, receptor type J | ![]() |
![]() |
2 | 2 | ||||||
MIRT656023 | MYO5A | myosin VA | ![]() |
![]() |
2 | 2 | ||||||
MIRT656105 | MSRB3 | methionine sulfoxide reductase B3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657749 | GMEB1 | glucocorticoid modulatory element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657924 | GATSL2 | cytosolic arginine sensor for mTORC1 subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658848 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT659100 | DENND6A | DENN domain containing 6A | ![]() |
![]() |
2 | 2 | ||||||
MIRT659153 | DCX | doublecortin | ![]() |
![]() |
2 | 2 | ||||||
MIRT660870 | ADRBK2 | G protein-coupled receptor kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT661941 | FAHD1 | fumarylacetoacetate hydrolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT663577 | C10orf32 | BLOC-1 related complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT664625 | WDPCP | WD repeat containing planar cell polarity effector | ![]() |
![]() |
2 | 4 | ||||||
MIRT666562 | RHOBTB3 | Rho related BTB domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT669992 | GPR156 | G protein-coupled receptor 156 | ![]() |
![]() |
2 | 4 | ||||||
MIRT670445 | RSBN1L | round spermatid basic protein 1 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT670853 | IFNAR1 | interferon alpha and beta receptor subunit 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT671942 | SPPL3 | signal peptide peptidase like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674269 | LMOD3 | leiomodin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT674424 | MIOX | myo-inositol oxygenase | ![]() |
![]() |
2 | 4 | ||||||
MIRT674982 | ATP5G1 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) | ![]() |
![]() |
2 | 2 | ||||||
MIRT675038 | BACE2 | beta-site APP-cleaving enzyme 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT675309 | C2orf68 | chromosome 2 open reading frame 68 | ![]() |
![]() |
2 | 2 | ||||||
MIRT675641 | TTPAL | alpha tocopherol transfer protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT688688 | CPS1 | carbamoyl-phosphate synthase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689369 | ZNF101 | zinc finger protein 101 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689605 | AKAP6 | A-kinase anchoring protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT691715 | LARS | leucyl-tRNA synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT695473 | TRAT1 | T-cell receptor associated transmembrane adaptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695530 | MAP4K2 | mitogen-activated protein kinase kinase kinase kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695878 | CACNG8 | calcium voltage-gated channel auxiliary subunit gamma 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT696586 | ORMDL2 | ORMDL sphingolipid biosynthesis regulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT703007 | HEATR5A | HEAT repeat containing 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707942 | PHKA1 | phosphorylase kinase regulatory subunit alpha 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709765 | GPR183 | G protein-coupled receptor 183 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710332 | ZNF669 | zinc finger protein 669 | ![]() |
![]() |
2 | 2 | ||||||
MIRT713249 | ZFP30 | ZFP30 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT716613 | RBM18 | RNA binding motif protein 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT733414 | BAG2 | BCL2 associated athanogene 2 | ![]() |
![]() |
2 | 0 | ||||||
MIRT756135 | THSD7A | thrombospondin type 1 domain containing 7A | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|