pre-miRNA Information
pre-miRNA hsa-mir-1303   
Genomic Coordinates chr5: 154685776 - 154685861
Synonyms MIRN1303, hsa-mir-1303, MIR1303
Description Homo sapiens miR-1303 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1303
Sequence 52| UUUAGAGACGGGGUCUUGCUCU |73
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 5 + 154685830 23291724, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs370437195 6 dbSNP
rs1195001383 7 dbSNP
rs546614687 8 dbSNP
rs762579883 9 dbSNP
rs766041486 10 dbSNP
rs751079975 12 dbSNP
rs888516744 13 dbSNP
rs566454487 14 dbSNP
rs766973220 15 dbSNP
rs1474274822 17 dbSNP
rs753222192 18 dbSNP
rs1230907999 19 dbSNP
rs756552638 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PPIC   
Synonyms CYPC
Description peptidylprolyl isomerase C
Transcript NM_000943   
Expression
Putative miRNA Targets on PPIC
3'UTR of PPIC
(miRNA target sites are highlighted)
>PPIC|NM_000943|3'UTR
   1 CACAACTGGCAGAAAACAAGGATATGCTTTGGCAGGGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGTGTTGTCTTTC
  81 AATTATTTGCTTTTTTTTTTTTACTTTCTTTTTGTATTCTATCCCAGATCACAGGAAAGTTATAAAAATCAAACCGTCAC
 161 CCTTTAGTTTGCTTGAACTTTAGTAAACCACCTGCTTAGGGACTTTGAACTTAAATATATCCCCTTCCTCAAGTGGTGCT
 241 ATTTTAAAACTAAAAAAAACTTTGAATTGGCTATTTTTTTAATGCAATATTTTTTTTCTGAATTCATTATGATCCCCATA
 321 TTGGGTAATGCTGAACATTTATCTGAAACAGATGAGGATATTATTATTTTGTATCCAAACAGAAATTCAGATAAAGGGAA
 401 ATTTGACTAGTGTAATCTGAGATATGTCATAGGGATTTCTTTCTGACAAAAGGGTGCTTTGCTGTTCTTTATATTAAATA
 481 CTTTTAGATCAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' ucuCGUUCUGGGGCAGAGAUUu 5'
             |||| |:::: |:|||:| 
Target 5' aatGCAATATTTTTTTTCTGAa 3'
281 - 302 131.00 -9.40
2
miRNA  3' ucucgUUCUGGGGCAGAGAUUu 5'
               ::||:::| |:|||:| 
Target 5' tcataGGGATTTC-TTTCTGAc 3'
427 - 447 120.00 -9.40
3
miRNA  3' ucucguucuggGGC-AGAGAUuu 5'
                     |:| |||:||  
Target 5' agggtgctttgCTGTTCTTTAta 3'
451 - 473 107.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN5068179 2 COSMIC
COSN30483451 21 COSMIC
COSN6510237 41 COSMIC
COSN20050036 66 COSMIC
COSN20050034 67 COSMIC
COSN30470072 80 COSMIC
COSN1306243 91 COSMIC
COSN24787946 108 COSMIC
COSN15665927 109 COSMIC
COSN30162499 119 COSMIC
COSN22088707 155 COSMIC
COSN26574747 156 COSMIC
COSN31548185 265 COSMIC
COSN31563790 273 COSMIC
COSN28767871 380 COSMIC
COSN16730628 428 COSMIC
COSN14791497 567 COSMIC
COSN29323315 603 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1407480023 6 dbSNP
rs1446109445 7 dbSNP
rs367741833 13 dbSNP
rs754818746 19 dbSNP
rs370559562 21 dbSNP
rs766018743 22 dbSNP
rs760961856 24 dbSNP
rs966611319 32 dbSNP
rs1022532778 34 dbSNP
rs750629331 36 dbSNP
rs146229593 37 dbSNP
rs776662400 37 dbSNP
rs397999141 38 dbSNP
rs889673529 38 dbSNP
rs534440216 39 dbSNP
rs750956100 39 dbSNP
rs1276792180 41 dbSNP
rs1402259967 44 dbSNP
rs566741336 44 dbSNP
rs757629304 44 dbSNP
rs1341630855 46 dbSNP
rs1476610386 46 dbSNP
rs371305785 48 dbSNP
rs1389183109 64 dbSNP
rs546924735 64 dbSNP
rs10552214 67 dbSNP
rs1165001978 68 dbSNP
rs1366095543 68 dbSNP
rs1404740701 68 dbSNP
rs1427190555 68 dbSNP
rs1431234627 68 dbSNP
rs1491249003 68 dbSNP
rs70988555 68 dbSNP
rs776432929 68 dbSNP
rs879117036 68 dbSNP
rs759094553 69 dbSNP
rs1328194378 71 dbSNP
rs1401011719 72 dbSNP
rs374923857 73 dbSNP
rs1388165287 78 dbSNP
rs1433233167 86 dbSNP
rs1217395423 103 dbSNP
rs528773387 103 dbSNP
rs879309374 103 dbSNP
rs1293309453 104 dbSNP
rs1052129559 108 dbSNP
rs375067091 112 dbSNP
rs1375782890 113 dbSNP
rs1313748779 127 dbSNP
rs984369909 133 dbSNP
rs1436758212 134 dbSNP
rs1184789583 135 dbSNP
rs952975270 143 dbSNP
rs1373856169 146 dbSNP
rs1472911038 148 dbSNP
rs370088217 155 dbSNP
rs41471149 156 dbSNP
rs1470852697 157 dbSNP
rs1338876227 158 dbSNP
rs1462534862 160 dbSNP
rs994767969 162 dbSNP
rs960255813 170 dbSNP
rs940769022 181 dbSNP
rs144971686 188 dbSNP
rs1049679405 194 dbSNP
rs751815540 201 dbSNP
rs567307852 202 dbSNP
rs764327393 207 dbSNP
rs1327466828 215 dbSNP
rs1225754707 220 dbSNP
rs45605533 221 dbSNP
rs1010767619 232 dbSNP
rs893751784 239 dbSNP
rs568220009 240 dbSNP
rs990495191 246 dbSNP
rs1252110486 250 dbSNP
rs939035257 255 dbSNP
rs935135822 259 dbSNP
rs1176608534 260 dbSNP
rs1189639407 260 dbSNP
rs1481256607 260 dbSNP
rs1378411095 261 dbSNP
rs927614009 273 dbSNP
rs1465770575 274 dbSNP
rs901018027 280 dbSNP
rs1277469134 281 dbSNP
rs977862191 283 dbSNP
rs966848797 287 dbSNP
rs1340832647 290 dbSNP
rs1307902023 296 dbSNP
rs1041158533 298 dbSNP
rs1349184091 298 dbSNP
rs942504488 298 dbSNP
rs910883156 307 dbSNP
rs569167704 309 dbSNP
rs745623572 310 dbSNP
rs1230658907 317 dbSNP
rs983818433 320 dbSNP
rs1342193106 322 dbSNP
rs45560934 327 dbSNP
rs989695576 333 dbSNP
rs918821021 336 dbSNP
rs953991548 353 dbSNP
rs1191533297 357 dbSNP
rs1355858600 358 dbSNP
rs1266453724 362 dbSNP
rs1431258020 369 dbSNP
rs1294965268 372 dbSNP
rs15577 380 dbSNP
rs1338966840 384 dbSNP
rs1333729034 390 dbSNP
rs1369235826 395 dbSNP
rs565854333 396 dbSNP
rs998049379 410 dbSNP
rs901890796 412 dbSNP
rs1035868498 415 dbSNP
rs1398682685 419 dbSNP
rs1297191658 426 dbSNP
rs1166670643 428 dbSNP
rs980589450 436 dbSNP
rs1294830317 442 dbSNP
rs1018883508 443 dbSNP
rs1465513194 447 dbSNP
rs1004994190 464 dbSNP
rs1419191378 464 dbSNP
rs1167632264 467 dbSNP
rs374302222 467 dbSNP
rs868222264 472 dbSNP
rs1206681800 478 dbSNP
rs45561935 485 dbSNP
rs1236582437 497 dbSNP
rs1450391259 499 dbSNP
rs1011555424 502 dbSNP
rs1425668673 506 dbSNP
rs891814866 512 dbSNP
rs1349825650 518 dbSNP
rs1049245498 522 dbSNP
rs1456708811 525 dbSNP
rs532211426 534 dbSNP
rs1247720959 537 dbSNP
rs999457043 539 dbSNP
rs1318161782 549 dbSNP
rs900963151 553 dbSNP
rs1311840638 556 dbSNP
rs1319928240 557 dbSNP
rs776092278 559 dbSNP
rs76739889 560 dbSNP
rs528160347 562 dbSNP
rs35413555 567 dbSNP
rs1055425984 568 dbSNP
rs1208302915 573 dbSNP
rs1246448830 581 dbSNP
rs770898737 582 dbSNP
rs1355322876 587 dbSNP
rs746832553 595 dbSNP
rs1283860194 600 dbSNP
rs927645304 603 dbSNP
rs1042046703 604 dbSNP
rs1443122648 617 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 5480.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUUu 5'
            ||::||||||:|||||||| 
Target 5' auAGUGAGACCCUGUCUCUAA- 3'
14 - 34
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 5480.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' ucUCGUUCUGGGGCAGAGAUUu 5'
            ||::||||||:|||||||| 
Target 5' auAGUGAGACCCUGUCUCUAA- 3'
15 - 35
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000306442.4 | 3UTR | CAGCCUGGGCAACAUAGUGAGACCCUGUCUCUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000306442.4 | 3UTR | CCAGCCUGGGCAACAUAGUGAGACCCUGUCUCUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.438 1.6e-2 0.492 7.3e-3 24 Click to see details
GSE32688 Pancreatic cancer -0.223 1.1e-1 -0.233 1.0e-1 32 Click to see details
GSE28260 Renal cortex and medulla 0.28 1.8e-1 0.275 1.8e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells 0.097 3.3e-1 0.090 3.4e-1 24 Click to see details
GSE38226 Liver fibrosis -0.07 3.8e-1 -0.070 3.8e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.055 4.0e-1 0.012 4.8e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells -0.005 4.9e-1 -0.015 4.7e-1 23 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
186 hsa-miR-1303 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035871 SOAT1 sterol O-acyltransferase 1 1 1
MIRT035872 FHOD3 formin homology 2 domain containing 3 1 1
MIRT035873 RPL7A ribosomal protein L7a 1 1
MIRT035874 NCAPD2 non-SMC condensin I complex subunit D2 1 1
MIRT035875 RPS8 ribosomal protein S8 1 1
MIRT035876 AHNAK AHNAK nucleoprotein 1 1
MIRT035877 ACTB actin beta 1 1
MIRT035878 DEF8 differentially expressed in FDCP 8 homolog 1 1
MIRT035879 MET MET proto-oncogene, receptor tyrosine kinase 1 1
MIRT035880 MED13 mediator complex subunit 13 1 1
MIRT035881 FAT3 FAT atypical cadherin 3 1 1
MIRT035882 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 1 1
MIRT035883 RPS16 ribosomal protein S16 1 1
MIRT035884 CDK6 cyclin dependent kinase 6 1 1
MIRT035885 GEMIN5 gem nuclear organelle associated protein 5 1 1
MIRT035886 PITRM1 pitrilysin metallopeptidase 1 1 1
MIRT035887 PRRC2A proline rich coiled-coil 2A 1 1
MIRT035888 KIAA0226 RUN and cysteine rich domain containing beclin 1 interacting protein 1 1
MIRT035889 MLLT6 MLLT6, PHD finger containing 1 1
MIRT035890 EIF3I eukaryotic translation initiation factor 3 subunit I 1 1
MIRT035891 FASN fatty acid synthase 1 1
MIRT035892 LEPREL4 prolyl 3-hydroxylase family member 4 (non-enzymatic) 1 1
MIRT035893 HSCB HscB mitochondrial iron-sulfur cluster cochaperone 1 1
MIRT035894 PSME4 proteasome activator subunit 4 1 1
MIRT035895 FRS2 fibroblast growth factor receptor substrate 2 1 1
MIRT035896 ZNF264 zinc finger protein 264 1 1
MIRT035897 HYLS1 HYLS1, centriolar and ciliogenesis associated 1 1
MIRT035898 USP54 ubiquitin specific peptidase 54 1 1
MIRT035899 L1TD1 LINE1 type transposase domain containing 1 1 1
MIRT035900 OR51E2 olfactory receptor family 51 subfamily E member 2 1 1
MIRT053762 CLDN18 claudin 18 3 1
MIRT060730 RPS3 ribosomal protein S3 2 2
MIRT083986 RAB22A RAB22A, member RAS oncogene family 2 2
MIRT098550 TBPL1 TATA-box binding protein like 1 2 6
MIRT134983 TWF1 twinfilin actin binding protein 1 2 4
MIRT136956 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT222065 PURB purine rich element binding protein B 2 2
MIRT239574 UBN2 ubinuclein 2 2 4
MIRT261820 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT264698 C11ORF57 chromosome 11 open reading frame 57 2 4
MIRT308476 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT377481 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT442304 NEU3 neuraminidase 3 2 2
MIRT446083 SLC30A10 solute carrier family 30 member 10 2 2
MIRT449606 PRPF4 pre-mRNA processing factor 4 2 2
MIRT453767 NUCB1 nucleobindin 1 2 10
MIRT455603 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT455913 KIF2C kinesin family member 2C 2 2
MIRT460091 ZYG11B zyg-11 family member B, cell cycle regulator 2 4
MIRT460866 UBE2S ubiquitin conjugating enzyme E2 S 2 2
MIRT461339 NUP133 nucleoporin 133 2 2
MIRT463769 YOD1 YOD1 deubiquitinase 2 2
MIRT466368 THAP1 THAP domain containing 1 2 4
MIRT467168 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT468703 SDHD succinate dehydrogenase complex subunit D 2 2
MIRT469122 RNF126 ring finger protein 126 2 2
MIRT472426 NCBP2 nuclear cap binding protein subunit 2 2 4
MIRT479420 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT484260 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT485468 IL6ST interleukin 6 signal transducer 2 10
MIRT490237 H2AFZ H2A histone family member Z 2 6
MIRT491002 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492127 SUMO2 small ubiquitin-like modifier 2 2 2
MIRT499169 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT499825 PCSK9 proprotein convertase subtilisin/kexin type 9 2 8
MIRT501794 NRAS NRAS proto-oncogene, GTPase 2 2
MIRT503441 GINS4 GINS complex subunit 4 2 4
MIRT503688 MAVS mitochondrial antiviral signaling protein 2 5
MIRT506926 IGDCC4 immunoglobulin superfamily DCC subclass member 4 2 6
MIRT511430 HOXA10 homeobox A10 2 6
MIRT512415 LAYN layilin 2 4
MIRT513791 NIPAL3 NIPA like domain containing 3 2 4
MIRT516163 NTMT1 N-terminal Xaa-Pro-Lys N-methyltransferase 1 2 4
MIRT516513 PARK2 parkin RBR E3 ubiquitin protein ligase 2 2
MIRT516915 HINFP histone H4 transcription factor 2 2
MIRT517102 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT517350 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT518019 ABHD15 abhydrolase domain containing 15 2 2
MIRT520945 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT525250 RNF213 ring finger protein 213 2 2
MIRT530634 PPIC peptidylprolyl isomerase C 2 4
MIRT530671 CHRNB1 cholinergic receptor nicotinic beta 1 subunit 2 4
MIRT531563 ILDR1 immunoglobulin like domain containing receptor 1 2 2
MIRT538205 CYR61 cysteine rich angiogenic inducer 61 2 2
MIRT538419 COLEC10 collectin subfamily member 10 2 2
MIRT541964 ZNF485 zinc finger protein 485 2 2
MIRT543088 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT543257 ZNF662 zinc finger protein 662 2 2
MIRT543589 KIAA1549 KIAA1549 2 2
MIRT543955 RNF20 ring finger protein 20 2 2
MIRT544043 C9orf64 chromosome 9 open reading frame 64 2 4
MIRT548064 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548240 FBXW7 F-box and WD repeat domain containing 7 2 2
MIRT548442 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 2
MIRT548623 DAZAP1 DAZ associated protein 1 2 4
MIRT548770 COLEC12 collectin subfamily member 12 2 2
MIRT549506 HDDC2 HD domain containing 2 2 4
MIRT551924 AKAP8 A-kinase anchoring protein 8 2 4
MIRT555656 PGRMC1 progesterone receptor membrane component 1 2 2
MIRT556286 MAP3K5 mitogen-activated protein kinase kinase kinase 5 2 2
MIRT557012 HOXD13 homeobox D13 2 4
MIRT563907 CLSPN claspin 2 2
MIRT565527 SON SON DNA binding protein 2 2
MIRT568000 COMMD2 COMM domain containing 2 2 2
MIRT569831 PLA2G16 phospholipase A2 group XVI 2 4
MIRT573905 PARP1 poly(ADP-ribose) polymerase 1 2 2
MIRT616589 KLHL9 kelch like family member 9 2 2
MIRT617137 ZNF556 zinc finger protein 556 2 2
MIRT617400 API5 apoptosis inhibitor 5 2 2
MIRT617455 CCS copper chaperone for superoxide dismutase 2 2
MIRT617799 ZNF793 zinc finger protein 793 2 2
MIRT618190 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT618303 GNE glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase 2 2
MIRT618329 ZNF813 zinc finger protein 813 2 2
MIRT618820 PHF20 PHD finger protein 20 2 2
MIRT619153 PPDPF pancreatic progenitor cell differentiation and proliferation factor 2 2
MIRT619530 ZNF708 zinc finger protein 708 2 2
MIRT619849 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT620806 SLC26A2 solute carrier family 26 member 2 2 2
MIRT621312 YIPF4 Yip1 domain family member 4 2 2
MIRT621358 GUCA1B guanylate cyclase activator 1B 2 2
MIRT621366 ART4 ADP-ribosyltransferase 4 (Dombrock blood group) 2 2
MIRT621547 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT621883 TAOK1 TAO kinase 1 2 2
MIRT622451 RNF19B ring finger protein 19B 2 2
MIRT623404 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT623587 IPO9 importin 9 2 2
MIRT623974 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT624086 DPP8 dipeptidyl peptidase 8 2 2
MIRT624108 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT632486 RNF8 ring finger protein 8 2 2
MIRT634057 PLIN3 perilipin 3 2 2
MIRT634657 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT640682 MCUR1 mitochondrial calcium uniporter regulator 1 2 2
MIRT641242 CENPN centromere protein N 2 2
MIRT642260 ZNF677 zinc finger protein 677 2 2
MIRT642954 RELA RELA proto-oncogene, NF-kB subunit 2 2
MIRT644326 IPP intracisternal A particle-promoted polypeptide 2 2
MIRT644632 ICA1L islet cell autoantigen 1 like 2 2
MIRT645721 POLR3A RNA polymerase III subunit A 2 2
MIRT647850 LYPLA1 lysophospholipase I 2 2
MIRT649281 NEK8 NIMA related kinase 8 2 2
MIRT650038 VHL von Hippel-Lindau tumor suppressor 2 2
MIRT650354 RRP36 ribosomal RNA processing 36 2 2
MIRT651144 ZNF384 zinc finger protein 384 2 2
MIRT651778 UTP6 UTP6, small subunit processome component 2 2
MIRT652576 TLCD2 TLC domain containing 2 2 2
MIRT654621 PTPRJ protein tyrosine phosphatase, receptor type J 2 2
MIRT656023 MYO5A myosin VA 2 2
MIRT656105 MSRB3 methionine sulfoxide reductase B3 2 2
MIRT657749 GMEB1 glucocorticoid modulatory element binding protein 1 2 2
MIRT657924 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT658848 DUSP19 dual specificity phosphatase 19 2 2
MIRT659100 DENND6A DENN domain containing 6A 2 2
MIRT659153 DCX doublecortin 2 2
MIRT660870 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT661941 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT663577 C10orf32 BLOC-1 related complex subunit 7 2 2
MIRT664625 WDPCP WD repeat containing planar cell polarity effector 2 4
MIRT666562 RHOBTB3 Rho related BTB domain containing 3 2 2
MIRT669992 GPR156 G protein-coupled receptor 156 2 4
MIRT670445 RSBN1L round spermatid basic protein 1 like 2 2
MIRT670853 IFNAR1 interferon alpha and beta receptor subunit 1 2 4
MIRT671942 SPPL3 signal peptide peptidase like 3 2 2
MIRT674269 LMOD3 leiomodin 3 2 2
MIRT674424 MIOX myo-inositol oxygenase 2 4
MIRT674982 ATP5G1 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C1 (subunit 9) 2 2
MIRT675038 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT675309 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT675641 TTPAL alpha tocopherol transfer protein like 2 2
MIRT688688 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT689369 ZNF101 zinc finger protein 101 2 2
MIRT689605 AKAP6 A-kinase anchoring protein 6 2 2
MIRT691715 LARS leucyl-tRNA synthetase 2 2
MIRT695473 TRAT1 T-cell receptor associated transmembrane adaptor 1 2 2
MIRT695530 MAP4K2 mitogen-activated protein kinase kinase kinase kinase 2 2 2
MIRT695878 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT696586 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT703007 HEATR5A HEAT repeat containing 5A 2 2
MIRT707942 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT709765 GPR183 G protein-coupled receptor 183 2 2
MIRT710332 ZNF669 zinc finger protein 669 2 2
MIRT713249 ZFP30 ZFP30 zinc finger protein 2 2
MIRT716613 RBM18 RNA binding motif protein 18 2 2
MIRT733414 BAG2 BCL2 associated athanogene 2 2 0
MIRT756135 THSD7A thrombospondin type 1 domain containing 7A 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-1303 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-1303 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1303 Rituximab sensitive High Diffuse Large B-Cell Lymphoma cell line (DB, NU-DHL-1, NU-DUL-1, MC-116, SU-DHL-4, SU-DHL-5, FARAGE, HBL-1, OCI-Ly3, OCI-Ly7, OCI-Ly8, OCI-Ly19, RIVA, SU-DHL-8, U2932)
hsa-miR-1303 Etoposide 36462 NSC141540 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vinorelbine 44424639 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Vincristine 5978 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant High Colorectal Cancer cell line (HCT8)
hsa-mir-1303 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-1303 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-1303 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1303 Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-1303 Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-1303 Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-1303 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-1303 Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-1303 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-1303 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-1303 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission