miRTarBase - #MIRT530713


—
pre-miRNA Information
pre-miRNA hsa-mir-155   
Genomic Coordinates chr21: 25573980 - 25574044
Description Homo sapiens miR-155 stem-loop
Comment Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-155-3p
Sequence 43| CUCCUACAUAUUAGCAUUAACA |64
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1181188719 6 dbSNP
rs759895287 7 dbSNP
rs200351615 8 dbSNP
rs377265631 10 dbSNP
rs1038360714 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Decrease Blood and urinary supernatants Quantitative real-time PCR
BA4I1F miR-155 Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Kidney tissue Quantitative real-time PCR
Gene Information
Gene Symbol ORMDL3   
Synonyms -
Description ORMDL sphingolipid biosynthesis regulator 3
Transcript NM_139280   
Expression
Putative miRNA Targets on ORMDL3
3'UTR of ORMDL3
(miRNA target sites are highlighted)		 
>ORMDL3|NM_139280|3'UTR
   1 GAGTGCAGCCCCTTCCCCTGCCCAGGGTGGCAGGGGAGGGGTAGGGTAAAAGGCATGTGCTGCAACACTGAAGACAGAAA
  81 GAAGAAGCCTCTGGACACTGCCAGAGATGGGGGTTGAGCCTCTGGCCTAATTTCCCCCCTCGCTTCCCCCAGTAGCCAAC
 161 TTGGAGTAGCTTGTAGTGGGGTTGGGGTAGGCCCCCTGGGCTCTGACCTTTTCTGAATTTTTTGATCTTTTCCTTTTGCT
 241 TTTTGAATAGAGACTCCATGGAGTTGGTCATGGAATGGGCTGGGCTCCTGGGCTGAACATGGACCACGCAGTTGCGACAG
 321 GAGGCCAGGGGAAAAACCCCTGCTCACTTGTTTGCCCTCAGGCAGCCAAAGCACTTTAACCCCTGCATAGGGAGCAGAGG
 401 GCGGTACGGCTTCTGGATTGTTTCACTGTGATTCCTAGGTTTTTTCGATGCCACGCAGTGTGTGCTTTTGTGTATGGAAG
 481 CAAGTGTGGGATGGGTCTTTGCCTTTCTGGGTAGGGAGCTGTCTAATCCAAGTCCCAGGCTTTTGGCAGCTTCTCTGCAA
 561 CCCACCGTGGGTCCTGGTTGGGAGTGGGGAGGGTCAGGTTGGGGAAAGATGGGGTAGAGTGTAGATGGCTTGGTTCCAGA
 641 GGTGAGGGGGCCAGGGCTGCTGCCATCCTGGCCTGGTGGAGGTTGGGGAGCTGTAGGAGAGCTAGTGAGTCGAGACTTAG
 721 AAGAATGGGGCCACATAGCAGCAGAGGACTGGTGTAAGGGAGGGAGGGGTAGGGACAGAAGCTAGACCCAATCTCCTTTG
 801 GGATGTGGGCAGGGAGGGAAGCAGGCTTGGAGGGTTAATTTACCCACAGAATGTGATAGTAATAGGGGAGGGAGGCTGCT
 881 GTGGGTTTAACTCCTGGGTTGGCTGTTGGGTAGACAGGTGGGGAAAAGGCCCGTGAGTCATTGTAAGCACAGGTCCAACT
 961 TGGCCCTGACTCCTGCGGGGGTATGGGGAAGCTGTGACAGAAACGATGGGTGCTGTGGTCCTCTGCAGGCCCTCACCCCT
1041 TAACTTCCTCATACAGACTGGCACTGGGCAGGGCCTCTCATGTGGCAGCCACATGTGGCGTTGTGAGGCCACCCCATGTG
1121 GGGTCTGTGGTGAGAGTCCTGTAGGATCCCTGCTCAAGCAGCACAGAGGAAGGGGCAAGACGTGGCCTGTAGGCACTGTC
1201 TCAGCCTGCAGAGAAGAAAGTGAGGCCGGGAGCCTGAGCCTGGGCTGGAGCCTTCTCCCCTCCCCAGTTGGACTAGGGGC
1281 AGTGTTAATTTTGAAAAGGTGTGGGTCCCTGTGTCCTCTTCCAGGGGTCCAAGGGAACGGGAGAGGTCACTGGGCCTGTT
1361 TTCTCCCTCCTGACCCTGCATCTCCCACCCCGTGTATCATAGGGAACTTTCACCTTAAAATCTTTCTAAGCAAAGTGTGA
1441 ATAGGATTTTTACTCCCTTTGTACAGTATTCTGAGAAACGCAAATAAAAGGGCAACATGTTTCTGTTTCAAAAAAAAAAA
1521 AAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acaAUUACGAUUA-UACAUCCUc 5'
             |::||  |:|  ||||||| 
Target 5' ctgTGGTGAGAGTCCTGTAGGAt 3'
 1125 - 1147 151.00 -11.20
2 
miRNA  3' acaauuACGAUUAUACAUCCUc 5'
                ||  :|  ||||||| 
Target 5' ggaggtTGGGGAGCTGTAGGAg 3'
 678 - 699 144.00 -14.90
3 
miRNA  3' acAAUUACGAUUAUACAUCCUc 5'
            | :| || || :|||:||| 
Target 5' taTGGAAGC-AA-GTGTGGGAt 3'
 473 - 492 134.00 -8.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN7166266 28 COSMIC
COSN20078923 32 COSMIC
COSN30118283 63 COSMIC
COSN30526267 69 COSMIC
COSN30526266 70 COSMIC
COSN30458217 89 COSMIC
COSN13718303 91 COSMIC
COSN5839784 117 COSMIC
COSN30483997 120 COSMIC
COSN30479186 135 COSMIC
COSN30471807 156 COSMIC
COSN26987599 188 COSMIC
COSN31579548 201 COSMIC
COSN24007903 205 COSMIC
COSN30504808 211 COSMIC
COSN30466587 232 COSMIC
COSN1196454 298 COSMIC
COSN31606651 446 COSMIC
COSN29548114 798 COSMIC
COSN31607920 1422 COSMIC
COSN17230253 1501 COSMIC
rs78199107 1053 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs745548251 5 dbSNP
rs376425393 6 dbSNP
rs1333127743 8 dbSNP
rs371773587 9 dbSNP
rs752117707 17 dbSNP
rs200485738 19 dbSNP
rs201193746 21 dbSNP
rs1188742862 22 dbSNP
rs1476363105 24 dbSNP
rs1249211695 25 dbSNP
rs1180926288 27 dbSNP
rs752201304 28 dbSNP
rs1327210025 29 dbSNP
rs1276230013 30 dbSNP
rs745912639 31 dbSNP
rs764842185 31 dbSNP
rs759220734 32 dbSNP
rs778998027 33 dbSNP
rs771363109 37 dbSNP
rs776362559 38 dbSNP
rs766175646 39 dbSNP
rs908824814 41 dbSNP
rs1286698725 42 dbSNP
rs1401336433 44 dbSNP
rs1409504581 45 dbSNP
rs1351332481 47 dbSNP
rs1331023857 49 dbSNP
rs192181497 52 dbSNP
rs1270378920 53 dbSNP
rs1340988400 54 dbSNP
rs189127887 56 dbSNP
rs1420600177 57 dbSNP
rs1055690181 62 dbSNP
rs921453561 63 dbSNP
rs1251130354 69 dbSNP
rs975525191 81 dbSNP
rs1193135634 85 dbSNP
rs756483461 94 dbSNP
rs536139544 96 dbSNP
rs1259069493 97 dbSNP
rs1476478562 103 dbSNP
rs965465623 106 dbSNP
rs1419242563 113 dbSNP
rs1346745088 118 dbSNP
rs1167706052 120 dbSNP
rs1392969080 121 dbSNP
rs1440862549 134 dbSNP
rs1318352638 136 dbSNP
rs1019639178 137 dbSNP
rs73985228 138 dbSNP
rs753110203 139 dbSNP
rs111593324 141 dbSNP
rs535128852 142 dbSNP
rs142530116 147 dbSNP
rs758688886 148 dbSNP
rs1334025152 150 dbSNP
rs893697475 156 dbSNP
rs777644973 159 dbSNP
rs921007068 160 dbSNP
rs1448878984 179 dbSNP
rs1414202093 187 dbSNP
rs1191282507 199 dbSNP
rs975198832 200 dbSNP
rs1054993834 203 dbSNP
rs1190465117 210 dbSNP
rs1160617985 217 dbSNP
rs77622760 223 dbSNP
rs78146877 224 dbSNP
rs1416171058 227 dbSNP
rs62067038 231 dbSNP
rs1455152831 233 dbSNP
rs1159658275 244 dbSNP
rs1386491281 246 dbSNP
rs552373010 248 dbSNP
rs977639794 258 dbSNP
rs749942983 263 dbSNP
rs937954209 272 dbSNP
rs1416283276 275 dbSNP
rs1354582440 281 dbSNP
rs1417290317 288 dbSNP
rs1419894840 305 dbSNP
rs138036558 306 dbSNP
rs563486118 307 dbSNP
rs192211039 308 dbSNP
rs529932183 315 dbSNP
rs908205573 316 dbSNP
rs1213310122 318 dbSNP
rs1048038628 343 dbSNP
rs931579958 350 dbSNP
rs1206597556 359 dbSNP
rs1183149818 365 dbSNP
rs1366109409 366 dbSNP
rs1468131979 375 dbSNP
rs894672642 381 dbSNP
rs1260555588 382 dbSNP
rs1436121478 397 dbSNP
rs879414336 402 dbSNP
rs750860352 403 dbSNP
rs558923956 407 dbSNP
rs921506129 408 dbSNP
rs975578967 431 dbSNP
rs35012605 440 dbSNP
rs540581415 444 dbSNP
rs761753357 446 dbSNP
rs755764979 447 dbSNP
rs939892348 451 dbSNP
rs141337010 453 dbSNP
rs186245794 454 dbSNP
rs921119990 455 dbSNP
rs1253146270 460 dbSNP
rs1436532785 465 dbSNP
rs967449932 467 dbSNP
rs1395153406 470 dbSNP
rs1455237342 474 dbSNP
rs1171335293 484 dbSNP
rs1394140330 491 dbSNP
rs543481664 500 dbSNP
rs1462205033 514 dbSNP
rs975144302 515 dbSNP
rs1394084962 521 dbSNP
rs1390683000 526 dbSNP
rs1326573116 542 dbSNP
rs1320360506 543 dbSNP
rs1383041393 548 dbSNP
rs1301490891 549 dbSNP
rs575782125 557 dbSNP
rs1022056755 563 dbSNP
rs1384492664 566 dbSNP
rs1011562656 569 dbSNP
rs1288107150 571 dbSNP
rs1254229960 574 dbSNP
rs768443340 577 dbSNP
rs943781032 585 dbSNP
rs957965068 588 dbSNP
rs183021183 589 dbSNP
rs376762676 590 dbSNP
rs760528966 592 dbSNP
rs1428683366 598 dbSNP
rs1371125993 602 dbSNP
rs906369564 607 dbSNP
rs1046189616 612 dbSNP
rs1165535505 613 dbSNP
rs1004386940 619 dbSNP
rs1438667486 620 dbSNP
rs886835085 622 dbSNP
rs1194669873 630 dbSNP
rs544567239 633 dbSNP
rs1428788181 642 dbSNP
rs1298069154 649 dbSNP
rs775250357 650 dbSNP
rs1048566055 652 dbSNP
rs1274230549 669 dbSNP
rs930964940 672 dbSNP
rs879921362 674 dbSNP
rs990849055 679 dbSNP
rs1264280883 691 dbSNP
rs1485947758 707 dbSNP
rs536159923 711 dbSNP
rs1470057447 712 dbSNP
rs1002884956 715 dbSNP
rs1459761096 719 dbSNP
rs1274355991 720 dbSNP
rs1349354369 733 dbSNP
rs1039925697 738 dbSNP
rs1454415130 739 dbSNP
rs944261241 740 dbSNP
rs1360080365 743 dbSNP
rs971473587 745 dbSNP
rs1014843802 746 dbSNP
rs1357762626 751 dbSNP
rs1312706393 756 dbSNP
rs912725400 760 dbSNP
rs977587758 763 dbSNP
rs1258469519 765 dbSNP
rs1487731145 766 dbSNP
rs575145751 767 dbSNP
rs1259278955 768 dbSNP
rs553420152 769 dbSNP
rs1181182930 770 dbSNP
rs1420835283 778 dbSNP
rs148284438 779 dbSNP
rs570805696 791 dbSNP
rs1419256460 792 dbSNP
rs1432641486 792 dbSNP
rs558819576 792 dbSNP
rs537545564 798 dbSNP
rs1302747731 800 dbSNP
rs1374642563 808 dbSNP
rs943728544 809 dbSNP
rs1304164867 820 dbSNP
rs970608450 825 dbSNP
rs115025206 826 dbSNP
rs1282075839 828 dbSNP
rs778886278 834 dbSNP
rs945732201 837 dbSNP
rs1209109752 838 dbSNP
rs1233263580 839 dbSNP
rs1169173129 854 dbSNP
rs75290103 865 dbSNP
rs1372156516 871 dbSNP
rs550134531 875 dbSNP
rs879366935 876 dbSNP
rs1439226429 881 dbSNP
rs529946228 885 dbSNP
rs1455298961 893 dbSNP
rs886884945 894 dbSNP
rs1397162166 901 dbSNP
rs1026734816 911 dbSNP
rs565602676 913 dbSNP
rs1467552300 914 dbSNP
rs899515975 918 dbSNP
rs1275666402 929 dbSNP
rs958960460 930 dbSNP
rs1039306684 932 dbSNP
rs944312631 933 dbSNP
rs1444915320 938 dbSNP
rs891364105 941 dbSNP
rs1375507866 942 dbSNP
rs1441051798 948 dbSNP
rs1305027286 951 dbSNP
rs1338755276 956 dbSNP
rs1249685887 957 dbSNP
rs1218290191 963 dbSNP
rs1273363762 967 dbSNP
rs1309108098 971 dbSNP
rs1202340677 972 dbSNP
rs547009353 976 dbSNP
rs749480228 977 dbSNP
rs946233705 979 dbSNP
rs867207675 980 dbSNP
rs1172220152 981 dbSNP
rs1303930437 1003 dbSNP
rs990239982 1004 dbSNP
rs937368152 1005 dbSNP
rs369228978 1006 dbSNP
rs1329294042 1007 dbSNP
rs1400153946 1015 dbSNP
rs143014308 1018 dbSNP
rs573362836 1021 dbSNP
rs564882614 1025 dbSNP
rs1328863460 1026 dbSNP
rs971083692 1027 dbSNP
rs1270479950 1029 dbSNP
rs1166154558 1032 dbSNP
rs1436251098 1034 dbSNP
rs1024876558 1039 dbSNP
rs1257213177 1043 dbSNP
rs1335349946 1049 dbSNP
rs78199107 1053 dbSNP
rs1275065808 1061 dbSNP
rs1173433996 1064 dbSNP
rs1198413419 1070 dbSNP
rs951241075 1074 dbSNP
rs1477213279 1093 dbSNP
rs995398376 1095 dbSNP
rs899752154 1100 dbSNP
rs1183254891 1102 dbSNP
rs1437745597 1103 dbSNP
rs1027200202 1107 dbSNP
rs73985227 1113 dbSNP
rs563882311 1115 dbSNP
rs781667238 1116 dbSNP
rs1348908778 1122 dbSNP
rs766404102 1125 dbSNP
rs1167811358 1132 dbSNP
rs141993539 1134 dbSNP
rs1404285119 1138 dbSNP
rs1007829891 1141 dbSNP
rs1346548443 1143 dbSNP
rs945815720 1148 dbSNP
rs528896290 1153 dbSNP
rs1041965865 1158 dbSNP
rs1355867010 1177 dbSNP
rs867052997 1181 dbSNP
rs1010869129 1182 dbSNP
rs574149774 1185 dbSNP
rs1442906504 1187 dbSNP
rs1209268913 1195 dbSNP
rs927541184 1198 dbSNP
rs1054602981 1200 dbSNP
rs981698099 1209 dbSNP
rs971519391 1211 dbSNP
rs553733703 1214 dbSNP
rs541698035 1227 dbSNP
rs371753698 1228 dbSNP
rs952244387 1250 dbSNP
rs1311830571 1257 dbSNP
rs1412397999 1262 dbSNP
rs1410694843 1266 dbSNP
rs147581849 1268 dbSNP
rs927350036 1282 dbSNP
rs964742334 1283 dbSNP
rs1417416240 1296 dbSNP
rs1018204283 1298 dbSNP
rs1045787051 1299 dbSNP
rs1416429213 1301 dbSNP
rs1332084237 1305 dbSNP
rs1339767974 1307 dbSNP
rs1470110951 1309 dbSNP
rs3169574 1318 dbSNP
rs569770640 1319 dbSNP
rs1356022495 1323 dbSNP
rs1486006212 1323 dbSNP
rs1285629903 1324 dbSNP
rs946513348 1325 dbSNP
rs76986394 1326 dbSNP
rs1254547452 1327 dbSNP
rs1020550595 1329 dbSNP
rs1442280502 1329 dbSNP
rs1365012992 1332 dbSNP
rs1437348487 1338 dbSNP
rs7942 1339 dbSNP
rs951335021 1350 dbSNP
rs1170528645 1353 dbSNP
rs919778963 1358 dbSNP
rs1391887712 1365 dbSNP
rs1330894185 1373 dbSNP
rs1379169684 1375 dbSNP
rs146958576 1377 dbSNP
rs2278894 1380 dbSNP
rs937004790 1384 dbSNP
rs547407370 1385 dbSNP
rs1017976370 1390 dbSNP
rs3169572 1391 dbSNP
rs1045948183 1395 dbSNP
rs1196880844 1400 dbSNP
rs769142459 1402 dbSNP
rs1456049780 1405 dbSNP
rs955074515 1412 dbSNP
rs1020328385 1425 dbSNP
rs1044668 1426 dbSNP
rs1253092625 1430 dbSNP
rs141712028 1437 dbSNP
rs893348131 1439 dbSNP
rs984026871 1441 dbSNP
rs1445422766 1442 dbSNP
rs1054655649 1444 dbSNP
rs1376854676 1452 dbSNP
rs760295874 1461 dbSNP
rs1462344125 1468 dbSNP
rs1044675 1471 dbSNP
rs1397965553 1479 dbSNP
rs753395358 1487 dbSNP
rs1465067285 1490 dbSNP
rs1346565458 1497 dbSNP
rs145809834 1505 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 94103.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acaAUUACGAUUA-UACAUCCuc 5'
             |::||  |:|  ||||||  
Target 5' ---UGGUGAGAGUCCUGUAGG-- 3'
 		1 - 18
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000304046.2 | 3UTR | UGGUGAGAGUCCUGUAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.67 1.7e-4 0.666 1.9e-4 24 Click to see details
GSE28260 Renal cortex and medulla -0.773 9.7e-4 -0.736 2.1e-3 13 Click to see details
GSE38226 Liver fibrosis -0.604 1.9e-3 -0.497 1.1e-2 21 Click to see details
GSE32688 Pancreatic cancer -0.454 4.5e-3 -0.389 1.4e-2 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.514 6.1e-3 -0.606 1.1e-3 23 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.493 1.4e-2 -0.132 2.9e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.231 2.0e-2 -0.188 4.9e-2 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.371 3.7e-2 0.388 3.1e-2 24 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.75 4.3e-2 0.771 3.6e-2 6 Click to see details
GSE19536 Breast cancer -0.168 4.7e-2 -0.183 3.4e-2 100 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.332 5.2e-2 -0.338 4.9e-2 25 Click to see details
GSE19350 CNS germ cell tumors -0.272 2.0e-1 0.040 4.5e-1 12 Click to see details
GSE21687 Ependynoma primary tumors -0.078 2.7e-1 -0.086 2.5e-1 64 Click to see details
GSE19783 ER+ ER+ breast cancer 0.138 2.8e-1 -0.042 4.3e-1 20 Click to see details
GSE19783 ER+ ER+ breast cancer 0.138 2.8e-1 -0.042 4.3e-1 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.855 0.07 -1.000 0.5 4 Click to see details
LIHC -0.288 0.17 -0.363 0.11 13 Click to see details
KIRC -0.281 0.22 -0.491 0.07 10 Click to see details
UCEC -0.445 0.23 -0.300 0.31 5 Click to see details
LUSC 0.178 0.23 0.033 0.45 20 Click to see details
HNSC -0.196 0.23 -0.168 0.27 16 Click to see details
BRCA -0.178 0.26 -0.068 0.4 15 Click to see details
CHOL -0.616 0.29 -0.500 0.33 3 Click to see details
PRAD -0.286 0.32 -0.100 0.44 5 Click to see details
THCA 0.083 0.35 -0.024 0.46 23 Click to see details
ESCA 0.206 0.4 0.000 0.5 4 Click to see details
STAD -0.081 0.4 -0.014 0.48 12 Click to see details
KIRP -0.105 0.43 0.000 0.5 5 Click to see details
KIRP -0.105 0.43 0.000 0.5 5 Click to see details
KIRP -0.105 0.43 0.000 0.5 5 Click to see details
KIRP -0.105 0.43 0.000 0.5 5 Click to see details
73 hsa-miR-155-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT005808 IRAK3 interleukin 1 receptor associated kinase 3 4 1
MIRT082844 ZNF460 zinc finger protein 460 2 4
MIRT256047 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT437787 PTEN phosphatase and tensin homolog 2 1
MIRT456168 ZDHHC6 zinc finger DHHC-type containing 6 2 2
MIRT464916 TXNIP thioredoxin interacting protein 2 4
MIRT475559 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT499608 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 8
MIRT504220 MYO6 myosin VI 2 4
MIRT504256 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT507642 CREBRF CREB3 regulatory factor 2 2
MIRT522858 KIAA1551 KIAA1551 2 2
MIRT527505 MYD88 myeloid differentiation primary response 88 5 2
MIRT530713 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT532851 ZNF699 zinc finger protein 699 2 2
MIRT535952 MIA3 MIA family member 3, ER export factor 2 2
MIRT539041 ATXN1L ataxin 1 like 2 4
MIRT556391 LUC7L LUC7 like 2 2
MIRT558617 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT559869 ATXN3 ataxin 3 2 2
MIRT569208 SHC3 SHC adaptor protein 3 2 2
MIRT573122 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT575076 Ddit4 DNA-damage-inducible transcript 4 2 2
MIRT607597 ABCF3 ATP binding cassette subfamily F member 3 2 6
MIRT609386 PHEX phosphate regulating endopeptidase homolog X-linked 2 2
MIRT610550 MDN1 midasin AAA ATPase 1 2 2
MIRT612390 TCF7L2 transcription factor 7 like 2 2 2
MIRT612910 GTDC1 glycosyltransferase like domain containing 1 2 6
MIRT613314 ARL5C ADP ribosylation factor like GTPase 5C 2 2
MIRT613356 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 4
MIRT613541 CLMP CXADR like membrane protein 2 2
MIRT617029 SYT6 synaptotagmin 6 2 2
MIRT618044 MRVI1 murine retrovirus integration site 1 homolog 2 2
MIRT619307 KIRREL kirre like nephrin family adhesion molecule 1 2 2
MIRT623209 MTFR1L mitochondrial fission regulator 1 like 2 2
MIRT625448 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT634551 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT640740 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT640906 RAB13 RAB13, member RAS oncogene family 2 2
MIRT644025 ZNF792 zinc finger protein 792 2 2
MIRT651489 WT1 Wilms tumor 1 2 2
MIRT652037 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT669093 CDK6 cyclin dependent kinase 6 2 2
MIRT696720 WNT3 Wnt family member 3 2 2
MIRT698085 TPM1 tropomyosin 1 2 2
MIRT703284 GID4 GID complex subunit 4 homolog 2 2
MIRT707183 ARHGEF33 Rho guanine nucleotide exchange factor 33 2 2
MIRT710362 CREB5 cAMP responsive element binding protein 5 2 2
MIRT713501 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT717153 LRRC3C leucine rich repeat containing 3C 2 2
MIRT719038 ATP1A1 ATPase Na+/K+ transporting subunit alpha 1 2 2
MIRT719489 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT720284 DPYSL3 dihydropyrimidinase like 3 2 2
MIRT732474 NLRP3 NLR family pyrin domain containing 3 2 0
MIRT732620 MS multiple sclerosis 1 0
MIRT732968 TGFBR2 transforming growth factor beta receptor 2 3 0
MIRT733063 AGTR1 angiotensin II receptor type 1 3 0
MIRT733206 ADAM10 ADAM metallopeptidase domain 10 1 0
MIRT733302 CRP C-reactive protein 2 0
MIRT734202 PDCD4 programmed cell death 4 3 0
MIRT734467 SIRT1 sirtuin 1 2 0
MIRT734701 Foxo3 forkhead box O3 1 0
MIRT734889 SP4 Sp4 transcription factor 2 0
MIRT735047 BATF basic leucine zipper ATF-like transcription factor 1 0
MIRT735048 SPI1 Spi-1 proto-oncogene 1 0
MIRT735734 PICALM phosphatidylinositol binding clathrin assembly protein 3 0
MIRT735944 TNF tumor necrosis factor 1 0
MIRT736131 MYLK myosin light chain kinase 2 0
MIRT736780 FOXP3 forkhead box P3 1 0
MIRT736781 CEBPB CCAAT/enhancer binding protein beta 1 0
MIRT736858 WEE1 WEE1 G2 checkpoint kinase 2 0
MIRT736873 TLR3 toll like receptor 3 2 0
MIRT736902 CFH complement factor H 2 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-155 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-155 Cyclophosphamide approved 2907 Quantitative real-time PCR p53+/+ pregnant mice 20170545 2010 down-regulated
miR-155 Estrogen NULL NULL Microarray mouse uterus 20720260 2010 up-regulated
miR-155 Estrogen NULL NULL Quantitative real-time PCR mouse uterus 20720260 2010 up-regulated
miR-155 Camptothecin NULL 24360 Microarray human cancer cells 24252850 2014 down-regulated
miR-155 Cocaine NULL 446220 Quantitative real-time PCR monocyte derived dendritic cells 24391808 2014 down-regulated
miR-155 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miR-155 Triptolide NULL 107985 Quantitative real-time PCR peripheral blood mononuclear cells (PBMCs) of RA (rheumatoid arthritis) 24909288 2014 down-regulated
miR-155 Medpor NULL NULL Microarray osteoblast-like cells line (MG-63) 18408260 2008 up-regulated
miR-155 Lithium (Li) approved 3028194 Quantitative real-time PCR lymphoblastoid cell lines (LCLs) 19254429 2009 up-regulated
miR-155 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 down-regulated
miR-155 Bisphenol A NULL 6623 Microarray immortalized cytotrophoblast cell lines HTR-8 20417706 2010 up-regulated
miR-155 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-155 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-155 Gemcitabine approved 60750 Quantitative real-time PCR pancreatic cancer 21738581 2011 down-regulated
miR-155 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-155 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 up-regulated
miR-155 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 up-regulated
miR-155 Glucocorticoid NULL NULL Microarray RAW264.7 cells 22326887 2012 down-regulated
miR-155 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-155 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-155 Glucocorticoid NULL NULL TaqMan low-density array Eosinophilic esophagitis 22815788 2012 up-regulated
miR-155 Adrenaline approved 5816 Quantitative real-time PCR colon cancer HT29 cells 23036199 2012 up-regulated
miR-155 Leptin NULL NULL Quantitative real-time PCR muscles 20800581 2010 down-regulated
miR-155 Morphine approved 5288826 Microarray human monocyte-derived macrophages (h-mdms) infection with HIV-1 20564181 2010 up-regulated
miR-155 Sinomenine NULL 5459308 Quantitative real-time PCR Colitis 24066068 2013 down-regualted
miR-155 Praziquantel approved 4891 Quantitative real-time PCR liver cell lines 25051829 2014 down-regualted
miR-155 Uric acid NULL 1175 Quantitative real-time PCR endothelial cells 23996753 2013 up-regualted
miR-155 Hydroxychloroquine approved 3652 Microarray mesangial cells 24121037 2013 down-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-155 Tripterygium wilfordii Hook F resistant tissue
hsa-mir-155 Doxorubicin 31703 NSC123127 approved resistant cell line (W1)
hsa-mir-155 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-155 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-155-3p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (HCT-116)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H358, H1993)
hsa-miR-155-3p Paclitaxel 36314 NSC125973 approved sensitive Low Breast Cancer cell line (MCF-7, SKBR3, MDA-MB-231)
hsa-miR-155-3p Temozolomide 5394 NSC362856 approved resistant Low Glioblastoma cell line (A172, U87)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-155-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-155-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-155-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-155-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-155-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-155-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission