pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-4436b-1 |
Genomic Coordinates | chr2: 110086433 - 110086523 |
Description | Homo sapiens miR-4436b-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-4436b-2 |
Genomic Coordinates | chr2: 110284853 - 110284943 |
Description | Homo sapiens miR-4436b-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||
---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-4436b-3p | ||||||
Sequence | 60| CAGGGCAGGAAGAAGUGGACAA |81 | ||||||
Evidence | Experimental | ||||||
Experiments | Illumina | ||||||
SNPs in miRNA |
|
||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |
---|---|
Gene Symbol | TDGF1P3 |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 6998.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000296145.5 | 3UTR | CCCUCUCCCAAAAAACUACUUCUUUUUUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
87 hsa-miR-4436b-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066957 | ATXN7L3B | ataxin 7 like 3B | ![]() |
![]() |
2 | 8 | ||||||
MIRT119284 | NABP1 | nucleic acid binding protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT128915 | KMT2A | lysine methyltransferase 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT150116 | MIDN | midnolin | ![]() |
![]() |
2 | 2 | ||||||
MIRT173040 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT253117 | BCL2L12 | BCL2 like 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT256997 | RGMB | repulsive guidance molecule family member b | ![]() |
![]() |
2 | 2 | ||||||
MIRT259746 | SNX12 | sorting nexin 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT267278 | TMEM109 | transmembrane protein 109 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441934 | C1orf109 | chromosome 1 open reading frame 109 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443625 | CPSF2 | cleavage and polyadenylation specific factor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT445757 | AGO1 | argonaute 1, RISC catalytic component | ![]() |
![]() |
2 | 2 | ||||||
MIRT447835 | CTIF | cap binding complex dependent translation initiation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT451230 | ZNF444 | zinc finger protein 444 | ![]() |
![]() |
2 | 2 | ||||||
MIRT451966 | TMPRSS5 | transmembrane protease, serine 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT453127 | HOXC4 | homeobox C4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454604 | RPL13A | ribosomal protein L13a | ![]() |
![]() |
2 | 2 | ||||||
MIRT455176 | SUV39H1 | suppressor of variegation 3-9 homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455547 | GJB1 | gap junction protein beta 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458197 | ATP6V0A2 | ATPase H+ transporting V0 subunit a2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458356 | NOC2L | NOC2 like nucleolar associated transcriptional repressor | ![]() |
![]() |
2 | 2 | ||||||
MIRT458923 | DNM2 | dynamin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461013 | SYT7 | synaptotagmin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461643 | ZSWIM4 | zinc finger SWIM-type containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461997 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT462367 | BCL7B | BCL tumor suppressor 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT464915 | TXNIP | thioredoxin interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT466311 | TIMM22 | translocase of inner mitochondrial membrane 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466591 | TBC1D2B | TBC1 domain family member 2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT467045 | SRSF1 | serine and arginine rich splicing factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468750 | SDC2 | syndecan 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468943 | RPS24 | ribosomal protein S24 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469474 | REEP5 | receptor accessory protein 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469913 | PTRF | caveolae associated protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473325 | MEX3A | mex-3 RNA binding family member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT473643 | MARK2 | microtubule affinity regulating kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474064 | LMNB2 | lamin B2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT474357 | KMT2D | lysine methyltransferase 2D | ![]() |
![]() |
2 | 2 | ||||||
MIRT475394 | ICMT | isoprenylcysteine carboxyl methyltransferase | ![]() |
![]() |
2 | 4 | ||||||
MIRT476335 | GLTSCR1L | BRD4 interacting chromatin remodeling complex associated protein like | ![]() |
![]() |
2 | 2 | ||||||
MIRT478651 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479585 | CDC42SE1 | CDC42 small effector 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT479943 | CBX5 | chromobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482001 | AMOTL2 | angiomotin like 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT482043 | AMER1 | APC membrane recruitment protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT483070 | EXT2 | exostosin glycosyltransferase 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484323 | KCNH1 | potassium voltage-gated channel subfamily H member 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT487528 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489636 | ALS2CL | ALS2 C-terminal like | ![]() |
![]() |
2 | 2 | ||||||
MIRT490693 | SSTR1 | somatostatin receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490871 | UPK2 | uroplakin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT492582 | PPM1L | protein phosphatase, Mg2+/Mn2+ dependent 1L | ![]() |
![]() |
2 | 2 | ||||||
MIRT492945 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT498675 | SOD2 | superoxide dismutase 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT499349 | RAB25 | RAB25, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT502338 | GIGYF1 | GRB10 interacting GYF protein 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT502976 | CCNL1 | cyclin L1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT503706 | NUP62 | nucleoporin 62 | ![]() |
![]() |
2 | 2 | ||||||
MIRT505567 | SMUG1 | single-strand-selective monofunctional uracil-DNA glycosylase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT507808 | CDKN1B | cyclin dependent kinase inhibitor 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT513242 | FBXO41 | F-box protein 41 | ![]() |
![]() |
2 | 6 | ||||||
MIRT513586 | EVX1 | even-skipped homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT525036 | FRK | fyn related Src family tyrosine kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT531035 | TDGF1P3 | teratocarcinoma-derived growth factor 1 pseudogene 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531939 | RBMS2 | RNA binding motif single stranded interacting protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534912 | PUM2 | pumilio RNA binding family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT535717 | N4BP1 | NEDD4 binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT540498 | ZMAT4 | zinc finger matrin-type 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT541465 | AURKA | aurora kinase A | ![]() |
![]() |
2 | 2 | ||||||
MIRT554328 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561572 | SLC6A9 | solute carrier family 6 member 9 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564715 | ZNF322P1 | zinc finger protein 322 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT576176 | Hmox1 | heme oxygenase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT629712 | XKR4 | XK related 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT636182 | THBD | thrombomodulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT646315 | MPHOSPH8 | M-phase phosphoprotein 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649174 | IQSEC1 | IQ motif and Sec7 domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT666945 | PMEPA1 | prostate transmembrane protein, androgen induced 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684057 | FOLR1 | folate receptor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT687585 | MAU2 | MAU2 sister chromatid cohesion factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT689953 | ZNF185 | zinc finger protein 185 with LIM domain | ![]() |
![]() |
2 | 2 | ||||||
MIRT704071 | SRCAP | Snf2 related CREBBP activator protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT704327 | DCUN1D5 | defective in cullin neddylation 1 domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT705406 | ATP1B3 | ATPase Na+/K+ transporting subunit beta 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT710488 | CDH5 | cadherin 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718241 | LCE1A | late cornified envelope 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT723182 | CDCA4 | cell division cycle associated 4 | ![]() |
![]() |
2 | 2 |