miRTarBase - #MIRT531048


—
pre-miRNA Information
pre-miRNA hsa-mir-4680   
Genomic Coordinates chr10: 110898090 - 110898155
Description Homo sapiens miR-4680 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4680-5p
Sequence 5| AGAACUCUUGCAGUCUUAGAUGU |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1274530692 2 dbSNP
rs780271274 5 dbSNP
rs1461423681 7 dbSNP
rs749729920 8 dbSNP
rs1252920446 10 dbSNP
rs201739274 11 dbSNP
rs774971106 19 dbSNP
rs748132091 22 dbSNP
rs773643180 22 dbSNP
rs1235425484 23 dbSNP
Putative Targets

Gene Information
Gene Symbol TIPARP   
Synonyms ARTD14, PARP7, pART14
Description TCDD inducible poly(ADP-ribose) polymerase
Transcript NM_001184717   
Other Transcripts NM_001184718 , NM_015508   
Expression
Putative miRNA Targets on TIPARP
3'UTR of TIPARP
(miRNA target sites are highlighted)		 
>TIPARP|NM_001184717|3'UTR
   1 AAAATCTTGGTACTGCTAAATTATTTGATATGAACTCAATCCAGCATTTGTAGCAGGTTTTGAATGGGTGGGACTGGGTG
  81 GGGAACAGCATTGGACATTAATAGGGCACTTTTCAGACCCATTTTTTAAAGTGCTAGAAAATGCTTTTTTTAAAAAAAAA
 161 ATACAAGTTTTAAAATGACCACTTACTCTTTAATTATTTACTAATTGCTAGTGTACTCAGTGTGGAAAAGACTACAGATT
 241 ACACACTCTTTTCATTCACACTTGTACATATAGACAGCAATGTTATTAGGAGCATTAAATTAAAAAACTGAACAGCCTAA
 321 TTTAAATGTGGCTTGGGCCTGGTAGAAGTTTGACCAAATGGAATGGAGGCTGTGAGCAATGTGAGGATTCTATTTATTTA
 401 TTTACGTTTGATAAAACTTACTGGAACTAGTACTACCATGCGTATTCCCTGTCCAAAGCATCACTGCTTTGGTATAGTAT
 481 AAGTTCATGAAATTCTGGTGGGTAGAAAGAAATTTTTATTTCTATCAGCAGTACTAAAATGTATCAGCCAACCAGAGAAC
 561 ATCAGTGACTTTAACTTCTGCAGAGTTTGCCCCAGAATTCAGAGTTCTATTTAGAGGAAGTTAAAACAACAACAAAAAAC
 641 AACCATTTGAAAAATTTTTGTCACCAGCAAAACTTTTCACTAATTAGTGATATGAAATGTGATTTTTGTGTTGTTAAACT
 721 TCAGCTTTGGAAAACTCAGTCTCTTTCATTATCATCCATTCCAATTTGAAGGAGTTGGGCAGCTAATTTGGTTAAAGGCA
 801 GTCTTGAGGGTTAGAAGTATTACTTCCTTTTCGGGTTCCAGACCTAGCTTGTGACTGAAAGTTTTAGAAAAAGGAAGTAC
 881 ATCTATAGCCAAATTGATAAGGTTATTACTGTGTTTTGCACAAAGTATATTAGCAAAAGTATTTGCTGGAATTATTGGTA
 961 GATGGCAGTCCCACTCCTACACCTGCTTTGTCAGATACAGCTGGGTTCCCTGGCTGACTCTGTACCTTACTTACACTACT
1041 TACTTAATAGAAACACAAACTTGGAAATTGTGCCAGTGGTCCAGCTGGAGCACAACGTTTGGTGAATATGCTGTTTCCTC
1121 AGTTCAGAGAGGTAGCAACTAGGTAAACTCCTTATAAAAAGCAAATACCTGGATTTACAAAAGTGAAAGTAGTTGTTCAC
1201 AAAAGAATTCGCCATGGAATTCTTTCAGTTACCAAGCTCTCCTGGTAATGTTTGTGGTTATATCATTTACACAAAACTTT
1281 TCAGGAACTTCTGTGTTGTTTAAGCAAGATGTATCTGTACTGATGTCTCAGTGAATCAGTCTGTTTATTAAGCACTTATC
1361 AGGGCTTCCACACACTTATTTATTTTGCCCTAGTTAATCCTGTTGTTTGCTGCCATTGGCATGAAATGGCCAACTGTGGC
1441 TGTTACAGTTCTTTCATTCAATTATAACTTGTAAACCAGTGACTCCTAATCTTTTTCAAGTTAAGACACCTTACCATTGC
1521 TTATTTGGTTTTATGAGACTTGTTCCTTTTTTTCTCCCTAAGGAAAAAGAAAGCTTTATGACATATTTATTTTTTTAATA
1601 AAACTAAGCAAAAATAAAACTTATGGTAATTCTTTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguagauUCUGACGUUCUCAAGa 5'
                 ||| | | ||||||| 
Target 5' ttgccccAGAATTC-AGAGTTCt 3'
 587 - 608 151.00 -10.20
2 
miRNA  3' ugUAGAUUCUGACGUUCUCAAGa 5'
            | ||: |:|||: | ||||| 
Target 5' ccAACTGTGGCTGTTACAGTTCt 3'
 1430 - 1452 137.00 -15.60
3 
miRNA  3' uguAGAUUCUGACGUUCUCAAga 5'
             || ||  :|| |:|||||  
Target 5' catTCCAA-TTTGAAGGAGTTgg 3'
 757 - 778 123.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM3005256 5 COSMIC
COSN30141581 8 COSMIC
COSN26998622 17 COSMIC
COSN30178663 32 COSMIC
COSN30140860 67 COSMIC
COSN30510544 82 COSMIC
COSN30488444 83 COSMIC
COSN30488506 84 COSMIC
COSN26259801 128 COSMIC
COSN14042638 152 COSMIC
COSN30112907 152 COSMIC
COSN4812743 154 COSMIC
COSN29656715 162 COSMIC
COSN8488547 613 COSMIC
COSN31538684 646 COSMIC
COSN2839480 653 COSMIC
COSN31536436 655 COSMIC
COSN31545679 763 COSMIC
COSN26465522 1044 COSMIC
COSN6738019 1112 COSMIC
COSN30542399 1130 COSMIC
COSN20090928 1206 COSMIC
COSN31549470 1211 COSMIC
COSN23449485 1264 COSMIC
COSN22820338 1284 COSMIC
COSN20099332 1571 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs774049285 7 dbSNP
rs370232193 11 dbSNP
rs1246418367 15 dbSNP
rs1186977376 19 dbSNP
rs1183120080 21 dbSNP
rs775954799 22 dbSNP
rs1235736451 23 dbSNP
rs374475004 25 dbSNP
rs562371398 31 dbSNP
rs761445789 32 dbSNP
rs753797387 33 dbSNP
rs757482002 36 dbSNP
rs1468861855 38 dbSNP
rs765540359 40 dbSNP
rs1318358588 41 dbSNP
rs893899136 46 dbSNP
rs945412983 52 dbSNP
rs1018102946 69 dbSNP
rs1297709429 71 dbSNP
rs1169809641 72 dbSNP
rs906557093 73 dbSNP
rs1003527858 77 dbSNP
rs1033950073 79 dbSNP
rs895374544 82 dbSNP
rs1370357620 86 dbSNP
rs963907364 95 dbSNP
rs1306339525 102 dbSNP
rs1431878954 104 dbSNP
rs1467124319 108 dbSNP
rs1162629189 114 dbSNP
rs1371467111 118 dbSNP
rs1393480979 118 dbSNP
rs995013761 121 dbSNP
rs1422181839 122 dbSNP
rs973806793 122 dbSNP
rs1183552941 128 dbSNP
rs1475388430 132 dbSNP
rs1250801614 139 dbSNP
rs1027787879 145 dbSNP
rs1202513264 145 dbSNP
rs532925719 149 dbSNP
rs551671501 151 dbSNP
rs1015328657 152 dbSNP
rs1286835604 152 dbSNP
rs1350193995 152 dbSNP
rs374266585 152 dbSNP
rs879227495 152 dbSNP
rs346003 153 dbSNP
rs185161634 154 dbSNP
rs939581509 161 dbSNP
rs1456417021 175 dbSNP
rs1351721255 180 dbSNP
rs1166746406 185 dbSNP
rs992860803 189 dbSNP
rs567836268 198 dbSNP
rs1271779810 244 dbSNP
rs752441256 246 dbSNP
rs1473473617 266 dbSNP
rs866063690 269 dbSNP
rs553431844 271 dbSNP
rs948246044 272 dbSNP
rs1222744209 277 dbSNP
rs1267515938 279 dbSNP
rs1213838150 281 dbSNP
rs1329073253 283 dbSNP
rs1266825752 288 dbSNP
rs1230602921 289 dbSNP
rs932535207 293 dbSNP
rs1043888432 300 dbSNP
rs1485012537 315 dbSNP
rs749702732 319 dbSNP
rs1385311319 329 dbSNP
rs1186078643 333 dbSNP
rs915093918 335 dbSNP
rs935421383 338 dbSNP
rs1294172988 339 dbSNP
rs1387777604 349 dbSNP
rs1052407652 356 dbSNP
rs1156917247 361 dbSNP
rs1264011092 364 dbSNP
rs1458571483 365 dbSNP
rs1478813773 369 dbSNP
rs1185747164 373 dbSNP
rs1431084075 384 dbSNP
rs879107354 389 dbSNP
rs1193680827 391 dbSNP
rs1464091406 393 dbSNP
rs771056676 406 dbSNP
rs139831555 407 dbSNP
rs774410852 428 dbSNP
rs1351771069 430 dbSNP
rs1255781700 431 dbSNP
rs1424241442 432 dbSNP
rs1008137186 436 dbSNP
rs550229724 439 dbSNP
rs1018638209 440 dbSNP
rs1042890241 442 dbSNP
rs1452626102 443 dbSNP
rs906594524 447 dbSNP
rs190015130 448 dbSNP
rs899650691 449 dbSNP
rs571587850 458 dbSNP
rs995316511 461 dbSNP
rs1055099646 480 dbSNP
rs1361937057 499 dbSNP
rs1173906222 510 dbSNP
rs1026833176 512 dbSNP
rs951079472 515 dbSNP
rs1004375465 516 dbSNP
rs895404199 519 dbSNP
rs538991297 522 dbSNP
rs995128239 525 dbSNP
rs1035361537 527 dbSNP
rs1355369354 534 dbSNP
rs1256146283 535 dbSNP
rs1199058932 542 dbSNP
rs960010653 544 dbSNP
rs1229316785 546 dbSNP
rs1281245613 552 dbSNP
rs1315274635 560 dbSNP
rs1204740815 569 dbSNP
rs1027899264 570 dbSNP
rs992403030 575 dbSNP
rs916805649 579 dbSNP
rs886634611 580 dbSNP
rs1005031582 589 dbSNP
rs1015775773 591 dbSNP
rs1394022400 594 dbSNP
rs1377080906 603 dbSNP
rs1313039361 605 dbSNP
rs1428724168 607 dbSNP
rs1368376866 609 dbSNP
rs965127612 610 dbSNP
rs1215355926 620 dbSNP
rs1475476875 625 dbSNP
rs1286956976 633 dbSNP
rs969623949 635 dbSNP
rs1368375179 638 dbSNP
rs979533545 641 dbSNP
rs976395437 645 dbSNP
rs1425883411 655 dbSNP
rs1027906067 656 dbSNP
rs1204628710 657 dbSNP
rs925457002 662 dbSNP
rs935427183 666 dbSNP
rs1208806612 670 dbSNP
rs1256810225 681 dbSNP
rs1264758365 681 dbSNP
rs1473089545 685 dbSNP
rs3732824 694 dbSNP
rs1242527498 698 dbSNP
rs989385885 709 dbSNP
rs746128440 712 dbSNP
rs1409055219 713 dbSNP
rs1052982647 716 dbSNP
rs915145590 723 dbSNP
rs1409991310 725 dbSNP
rs1389426781 734 dbSNP
rs912550967 738 dbSNP
rs945221888 740 dbSNP
rs565705653 742 dbSNP
rs1428667708 751 dbSNP
rs944061244 760 dbSNP
rs1039747045 762 dbSNP
rs867706893 763 dbSNP
rs576344199 765 dbSNP
rs772260354 776 dbSNP
rs75565959 782 dbSNP
rs1182843790 784 dbSNP
rs928048832 792 dbSNP
rs1265380393 802 dbSNP
rs1048221502 803 dbSNP
rs1211775887 806 dbSNP
rs775523968 818 dbSNP
rs1273778311 829 dbSNP
rs886980943 833 dbSNP
rs1326839491 834 dbSNP
rs1280885802 836 dbSNP
rs760548093 844 dbSNP
rs1442487303 859 dbSNP
rs1329942924 871 dbSNP
rs1432391241 876 dbSNP
rs1035869136 878 dbSNP
rs939380517 881 dbSNP
rs1442517599 882 dbSNP
rs1395831695 884 dbSNP
rs1455940267 886 dbSNP
rs959834166 889 dbSNP
rs763726830 891 dbSNP
rs344053 892 dbSNP
rs76663214 895 dbSNP
rs543733073 901 dbSNP
rs555647138 902 dbSNP
rs1195540977 903 dbSNP
rs1469000253 915 dbSNP
rs1371668466 917 dbSNP
rs1208063676 919 dbSNP
rs1223542413 923 dbSNP
rs181919770 935 dbSNP
rs1463325052 937 dbSNP
rs1286102264 944 dbSNP
rs1022592142 947 dbSNP
rs1224186688 957 dbSNP
rs761824571 969 dbSNP
rs916619455 970 dbSNP
rs1272769237 972 dbSNP
rs930616496 975 dbSNP
rs142446415 978 dbSNP
rs1356122065 981 dbSNP
rs1433548775 982 dbSNP
rs151331780 987 dbSNP
rs562568032 989 dbSNP
rs13095160 992 dbSNP
rs1423295745 992 dbSNP
rs988226105 997 dbSNP
rs912615908 1000 dbSNP
rs1389635122 1001 dbSNP
rs1443028095 1005 dbSNP
rs187348713 1014 dbSNP
rs1243841030 1019 dbSNP
rs1231074723 1021 dbSNP
rs757938048 1023 dbSNP
rs1212585979 1024 dbSNP
rs1039692854 1025 dbSNP
rs1296212880 1026 dbSNP
rs921270574 1030 dbSNP
rs1364666270 1033 dbSNP
rs997929741 1037 dbSNP
rs766090588 1039 dbSNP
rs1028017406 1041 dbSNP
rs1415642157 1043 dbSNP
rs1178917005 1047 dbSNP
rs371727238 1057 dbSNP
rs1370251431 1059 dbSNP
rs1166791394 1060 dbSNP
rs1411777047 1068 dbSNP
rs1010505629 1080 dbSNP
rs1446583256 1082 dbSNP
rs751108906 1087 dbSNP
rs1379507537 1093 dbSNP
rs1048377788 1095 dbSNP
rs886935397 1096 dbSNP
rs544555380 1097 dbSNP
rs966621261 1098 dbSNP
rs978334359 1110 dbSNP
rs1485794315 1121 dbSNP
rs1273525186 1140 dbSNP
rs1201793624 1142 dbSNP
rs927859943 1151 dbSNP
rs1274446105 1156 dbSNP
rs1004427724 1173 dbSNP
rs1056978143 1178 dbSNP
rs1220994197 1179 dbSNP
rs1270869063 1180 dbSNP
rs895520336 1199 dbSNP
rs990930548 1200 dbSNP
rs1415854302 1202 dbSNP
rs1012621292 1206 dbSNP
rs1306427776 1209 dbSNP
rs868326404 1211 dbSNP
rs930647490 1212 dbSNP
rs904230283 1215 dbSNP
rs1001059128 1218 dbSNP
rs1032579449 1226 dbSNP
rs956995916 1227 dbSNP
rs988687111 1228 dbSNP
rs1475443141 1229 dbSNP
rs1466931024 1248 dbSNP
rs1175146887 1249 dbSNP
rs560420760 1273 dbSNP
rs940914176 1282 dbSNP
rs1041023886 1283 dbSNP
rs1333330965 1292 dbSNP
rs1275642996 1312 dbSNP
rs1019788882 1318 dbSNP
rs1234232864 1320 dbSNP
rs965804533 1323 dbSNP
rs115731404 1328 dbSNP
rs1305055968 1329 dbSNP
rs78471510 1340 dbSNP
rs1418086083 1344 dbSNP
rs1465578717 1347 dbSNP
rs1171951369 1349 dbSNP
rs1293013822 1354 dbSNP
rs931333171 1356 dbSNP
rs1434455390 1361 dbSNP
rs1402951483 1367 dbSNP
rs984138582 1368 dbSNP
rs1461730092 1369 dbSNP
rs1410956362 1371 dbSNP
rs1156415953 1374 dbSNP
rs908424531 1374 dbSNP
rs1420488753 1377 dbSNP
rs1408346917 1378 dbSNP
rs996282821 1403 dbSNP
rs1255400539 1406 dbSNP
rs1323201666 1411 dbSNP
rs939960019 1422 dbSNP
rs1331887741 1428 dbSNP
rs1049487851 1434 dbSNP
rs1259321680 1443 dbSNP
rs1241713128 1455 dbSNP
rs1317714576 1456 dbSNP
rs1438784639 1460 dbSNP
rs1300910429 1462 dbSNP
rs1232123774 1465 dbSNP
rs1268497316 1477 dbSNP
rs1339860540 1481 dbSNP
rs1057326944 1483 dbSNP
rs1327755309 1492 dbSNP
rs1259866270 1498 dbSNP
rs1387888750 1510 dbSNP
rs1286895290 1515 dbSNP
rs895689436 1517 dbSNP
rs561353878 1520 dbSNP
rs1345393872 1521 dbSNP
rs1021924361 1540 dbSNP
rs1174954439 1545 dbSNP
rs1451962434 1554 dbSNP
rs1396378934 1561 dbSNP
rs34067563 1566 dbSNP
rs397874274 1566 dbSNP
rs531920745 1570 dbSNP
rs200055469 1571 dbSNP
rs966778340 1573 dbSNP
rs1207242401 1583 dbSNP
rs1290213069 1584 dbSNP
rs1044153397 1586 dbSNP
rs1486412973 1587 dbSNP
rs999484788 1589 dbSNP
rs1035337395 1590 dbSNP
rs1350066405 1590 dbSNP
rs1304233458 1592 dbSNP
rs960551407 1597 dbSNP
rs1325751429 1623 dbSNP
rs1293406862 1630 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 25976.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000295924.7 | 3UTR | UCUAUUUAGAGGAAGUUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
133 hsa-miR-4680-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT378771 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT393867 ZDHHC21 zinc finger DHHC-type containing 21 2 4
MIRT446684 C2CD2 C2 calcium dependent domain containing 2 2 2
MIRT447600 MRPL3 mitochondrial ribosomal protein L3 2 2
MIRT450708 RNF152 ring finger protein 152 2 2
MIRT450784 PAPOLG poly(A) polymerase gamma 2 2
MIRT454623 COL23A1 collagen type XXIII alpha 1 chain 2 8
MIRT461620 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT462695 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT475530 HOXA3 homeobox A3 2 8
MIRT475739 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT489676 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT490610 SLC47A1 solute carrier family 47 member 1 2 2
MIRT493628 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT496152 RPS15A ribosomal protein S15a 2 2
MIRT499232 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT501496 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT507163 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT512389 MTRNR2L1 MT-RNR2-like 1 2 4
MIRT514626 MTRNR2L7 MT-RNR2-like 7 2 2
MIRT517474 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT525332 CNGB1 cyclic nucleotide gated channel beta 1 2 2
MIRT526685 BAK1 BCL2 antagonist/killer 1 2 2
MIRT527317 CCR2 C-C motif chemokine receptor 2 2 2
MIRT527608 EYS eyes shut homolog (Drosophila) 2 2
MIRT528794 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531048 TIPARP TCDD inducible poly(ADP-ribose) polymerase 2 2
MIRT532254 TBPL2 TATA-box binding protein like 2 2 2
MIRT533801 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT535887 MLEC malectin 2 2
MIRT540704 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT544645 PHF8 PHD finger protein 8 2 4
MIRT545760 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT555310 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 2
MIRT555877 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT559507 ARID5B AT-rich interaction domain 5B 2 2
MIRT560448 SLC30A7 solute carrier family 30 member 7 2 2
MIRT561262 ZIK1 zinc finger protein interacting with K protein 1 2 2
MIRT561795 PAWR pro-apoptotic WT1 regulator 2 2
MIRT567007 KLHL15 kelch like family member 15 2 2
MIRT569298 SURF6 surfeit 6 2 2
MIRT570606 MTRNR2L11 MT-RNR2-like 11 2 2
MIRT572888 ADCY2 adenylate cyclase 2 2 2
MIRT573119 ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif 18 2 2
MIRT608332 ZNF670 zinc finger protein 670 2 6
MIRT614942 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT615324 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT618441 ZNF800 zinc finger protein 800 2 2
MIRT620110 HARBI1 harbinger transposase derived 1 2 2
MIRT626008 ZNF517 zinc finger protein 517 2 2
MIRT626626 SLC30A6 solute carrier family 30 member 6 2 2
MIRT627842 POU3F1 POU class 3 homeobox 1 2 2
MIRT628386 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT629305 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT629864 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630444 IDE insulin degrading enzyme 2 2
MIRT631854 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT633173 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT633477 ZNF724P zinc finger protein 724 2 2
MIRT634395 PLSCR1 phospholipid scramblase 1 2 2
MIRT635538 TRIM72 tripartite motif containing 72 2 2
MIRT635821 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT636169 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636797 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT637952 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT645136 HES2 hes family bHLH transcription factor 2 2 2
MIRT645667 ADK adenosine kinase 2 2
MIRT646148 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT647004 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT648187 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT650090 TERF2 telomeric repeat binding factor 2 2 2
MIRT650329 RTN2 reticulon 2 2 2
MIRT654224 RNF165 ring finger protein 165 2 2
MIRT654545 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT656457 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT656828 KLF8 Kruppel like factor 8 2 2
MIRT657112 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT657930 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT659375 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT659833 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT662108 LACTB lactamase beta 2 4
MIRT662789 TBC1D25 TBC1 domain family member 25 2 2
MIRT669501 ARL3 ADP ribosylation factor like GTPase 3 2 2
MIRT669759 ZNF101 zinc finger protein 101 2 4
MIRT669800 GAN gigaxonin 2 2
MIRT670050 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670299 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670388 EMP2 epithelial membrane protein 2 2 2
MIRT672862 C22orf29 retrotransposon Gag like 10 2 2
MIRT672890 FXN frataxin 2 2
MIRT673210 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT674001 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674163 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT674502 TIRAP TIR domain containing adaptor protein 2 2
MIRT675470 NUBPL nucleotide binding protein like 2 2
MIRT675671 TMOD2 tropomodulin 2 2 2
MIRT676006 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT676074 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676386 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676764 SNX2 sorting nexin 2 2 2
MIRT676896 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT676978 ZNF708 zinc finger protein 708 2 2
MIRT677236 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677369 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677464 PDLIM3 PDZ and LIM domain 3 2 2
MIRT678081 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678093 ATCAY ATCAY, caytaxin 2 2
MIRT678324 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678417 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678521 ZNF347 zinc finger protein 347 2 2
MIRT678700 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT678829 PDE6A phosphodiesterase 6A 2 2
MIRT679991 RUNDC1 RUN domain containing 1 2 2
MIRT680751 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT681249 ZNF383 zinc finger protein 383 2 2
MIRT681422 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT681948 SLC19A3 solute carrier family 19 member 3 2 2
MIRT689278 C5AR2 complement component 5a receptor 2 2 2
MIRT690389 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT691845 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT693863 IYD iodotyrosine deiodinase 2 2
MIRT696002 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT701930 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT702341 KLHL7 kelch like family member 7 2 2
MIRT703557 FKBP14 FK506 binding protein 14 2 2
MIRT705033 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT706341 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT709671 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT711212 EFHB EF-hand domain family member B 2 2
MIRT718342 PURA purine rich element binding protein A 2 2
MIRT722755 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723535 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 2
MIRT724498 BFAR bifunctional apoptosis regulator 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4680-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission