pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6787 |
Genomic Coordinates | chr17: 82236668 - 82236728 |
Description | Homo sapiens miR-6787 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6787-5p | ||||||||||||||||||||||||||||||||||||
Sequence | 6| UGGCGGGGGUAGAGCUGGCUGC |27 | ||||||||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SIGLEC12 | ||||||||||||||||||||
Synonyms | S2V, SIGLECL1, SLG, Siglec-XII | ||||||||||||||||||||
Description | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ||||||||||||||||||||
Transcript | NM_033329 | ||||||||||||||||||||
Other Transcripts | NM_053003 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SIGLEC12 | |||||||||||||||||||||
3'UTR of SIGLEC12 (miRNA target sites are highlighted) |
>SIGLEC12|NM_033329|3'UTR 1 GAAACTGCAGAGACTCAGGCCTGTTTGAGGGCTCACGACCCCTGCAGCAAAGAAGCCCGAGACTGATTCCTTTAGAATTA 81 ACAGCCCTCCATGCTGTGCAACAGGACATCAGAACTTATTCCTCTTGTCAAACTGAAAATGCGTGCCTGATGACCAAACT 161 CTCCCTTTCTCCATCCAATCGGTCCACACTCCCCGCCCCCGGCCTCTGGTACCCACCATTCTCTTCTCTACTTCTCTGAG 241 GTCGACTATTTTAGGTTCCAAATATAGTGAGATCGTAGAGTGTTTGTCTCTCTGTACCTGGCTTATTTCACTCAACATAA 321 TGTTCTCTAGGTTCATCCGTGTTGTTCCAAATAACAGAATAATGTATTGAATATTTCAAAATGGCTAAAAGAGAGGAGTT 401 TAAATGTTGTCACC Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 89858.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000291707.3 | 3UTR | CUCCCCGCCCCCGGCCUC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
90 hsa-miR-6787-5p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT449091 | XPO6 | exportin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449991 | PSMG1 | proteasome assembly chaperone 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454608 | MYADM | myeloid associated differentiation marker | ![]() |
![]() |
2 | 2 | ||||||
MIRT456116 | VAV3 | vav guanine nucleotide exchange factor 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT457064 | TOR4A | torsin family 4 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT461023 | SDF4 | stromal cell derived factor 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT467197 | SPRY4 | sprouty RTK signaling antagonist 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471711 | OTUB1 | OTU deubiquitinase, ubiquitin aldehyde binding 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472566 | NACC1 | nucleus accumbens associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476079 | GRB2 | growth factor receptor bound protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT480150 | CALR | calreticulin | ![]() |
![]() |
2 | 2 | ||||||
MIRT483027 | KHSRP | KH-type splicing regulatory protein | ![]() |
![]() |
2 | 4 | ||||||
MIRT483498 | STMN3 | stathmin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT483728 | THSD4 | thrombospondin type 1 domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484550 | BARHL1 | BarH like homeobox 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT484684 | PACSIN1 | protein kinase C and casein kinase substrate in neurons 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486059 | CTDNEP1 | CTD nuclear envelope phosphatase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486116 | INO80E | INO80 complex subunit E | ![]() |
![]() |
2 | 2 | ||||||
MIRT486313 | SIPA1 | signal-induced proliferation-associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486525 | CLCN7 | chloride voltage-gated channel 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT486857 | DPF1 | double PHD fingers 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487352 | PHF15 | jade family PHD finger 2 | ![]() |
1 | 1 | |||||||
MIRT487582 | FAM83H | family with sequence similarity 83 member H | ![]() |
![]() |
2 | 4 | ||||||
MIRT487792 | GPR20 | G protein-coupled receptor 20 | ![]() |
![]() |
2 | 4 | ||||||
MIRT488104 | POU3F1 | POU class 3 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT488786 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489361 | SYNGR1 | synaptogyrin 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489387 | RAB11B | RAB11B, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT489680 | SCAMP4 | secretory carrier membrane protein 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489731 | GNAI2 | G protein subunit alpha i2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT489750 | TACC3 | transforming acidic coiled-coil containing protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490029 | PCSK4 | proprotein convertase subtilisin/kexin type 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490379 | LHFPL3 | LHFPL tetraspan subfamily member 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490580 | SLC47A1 | solute carrier family 47 member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490753 | SRCIN1 | SRC kinase signaling inhibitor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491187 | JUND | JunD proto-oncogene, AP-1 transcription factor subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT491301 | VGF | VGF nerve growth factor inducible | ![]() |
![]() |
2 | 2 | ||||||
MIRT491462 | HOXB8 | homeobox B8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491702 | PDZD4 | PDZ domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT491724 | RTN4R | reticulon 4 receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT491737 | SEMA3F | semaphorin 3F | ![]() |
![]() |
2 | 2 | ||||||
MIRT491984 | UNK | unkempt family zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT492844 | NRGN | neurogranin | ![]() |
![]() |
2 | 2 | ||||||
MIRT492936 | NEUROD2 | neuronal differentiation 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT493713 | H2AFX | H2A histone family member X | ![]() |
![]() |
2 | 2 | ||||||
MIRT494623 | ASB6 | ankyrin repeat and SOCS box containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT494703 | ARHGAP31 | Rho GTPase activating protein 31 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495602 | NKX2-5 | NK2 homeobox 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT495750 | PDE4C | phosphodiesterase 4C | ![]() |
![]() |
2 | 4 | ||||||
MIRT500367 | ZNF385A | zinc finger protein 385A | ![]() |
![]() |
2 | 2 | ||||||
MIRT501161 | SLC10A7 | solute carrier family 10 member 7 | ![]() |
![]() |
2 | 6 | ||||||
MIRT501702 | PCGF3 | polycomb group ring finger 3 | ![]() |
![]() |
2 | 6 | ||||||
MIRT504922 | PDRG1 | p53 and DNA damage regulated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT517945 | TRIM59 | tripartite motif containing 59 | ![]() |
![]() |
2 | 2 | ||||||
MIRT524212 | DDI2 | DNA damage inducible 1 homolog 2 | ![]() |
![]() |
2 | 6 | ||||||
MIRT531186 | SIGLEC12 | sialic acid binding Ig like lectin 12 (gene/pseudogene) | ![]() |
![]() |
2 | 2 | ||||||
MIRT531972 | C12orf49 | chromosome 12 open reading frame 49 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558055 | EVI5L | ecotropic viral integration site 5 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT560482 | LACE1 | AFG1 like ATPase | ![]() |
![]() |
2 | 2 | ||||||
MIRT563217 | FXN | frataxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569095 | FSCN1 | fascin actin-bundling protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569522 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT569531 | CTTN | cortactin | ![]() |
![]() |
2 | 2 | ||||||
MIRT569848 | RGS5 | regulator of G protein signaling 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570738 | ANKRD52 | ankyrin repeat domain 52 | ![]() |
![]() |
2 | 2 | ||||||
MIRT574140 | MARVELD1 | MARVEL domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT615994 | DHTKD1 | dehydrogenase E1 and transketolase domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT628493 | ZNF556 | zinc finger protein 556 | ![]() |
![]() |
2 | 2 | ||||||
MIRT633451 | KLLN | killin, p53-regulated DNA replication inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT649054 | SLC1A2 | solute carrier family 1 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT649340 | HEXA | hexosaminidase subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT670226 | PTCHD1 | patched domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT670666 | KIAA1551 | KIAA1551 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671452 | CDH7 | cadherin 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT671729 | ZNF451 | zinc finger protein 451 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690285 | ZNF154 | zinc finger protein 154 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700575 | PRSS22 | protease, serine 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701411 | NKRF | NFKB repressing factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT711877 | VASP | vasodilator stimulated phosphoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT712082 | UNC13A | unc-13 homolog A | ![]() |
![]() |
2 | 2 | ||||||
MIRT712523 | CYTH2 | cytohesin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712751 | GMDS | GDP-mannose 4,6-dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT714681 | PRX | periaxin | ![]() |
![]() |
2 | 2 | ||||||
MIRT714718 | VPS8 | VPS8, CORVET complex subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT717508 | HRNR | hornerin | ![]() |
![]() |
2 | 2 | ||||||
MIRT717650 | THBS2 | thrombospondin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT719592 | PIAS4 | protein inhibitor of activated STAT 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT720521 | PTGR2 | prostaglandin reductase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT721295 | C3orf36 | chromosome 3 open reading frame 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT724922 | VPS18 | VPS18, CORVET/HOPS core subunit | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|