miRTarBase - #MIRT531210


—
pre-miRNA Information
pre-miRNA hsa-mir-1199   
Genomic Coordinates chr19: 14073361 - 14073479
Description Homo sapiens miR-1199 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1199-5p
Sequence 21| CCUGAGCCCGGGCCGCGCAG |40
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1438702968 5 dbSNP
rs757334792 6 dbSNP
rs1159152107 9 dbSNP
rs1365081692 10 dbSNP
rs1451155091 12 dbSNP
rs934105122 17 dbSNP
Putative Targets

Gene Information
Gene Symbol PLA2G4D   
Synonyms cPLA2delta
Description phospholipase A2 group IVD
Transcript NM_178034   
Expression
Putative miRNA Targets on PLA2G4D
3'UTR of PLA2G4D
(miRNA target sites are highlighted)		 
>PLA2G4D|NM_178034|3'UTR
   1 GGTTGCTCAGAGGCTGCAGGACCCTCCAGGGCCTGCGGGCATAACCTGATCTGTAGCTGGGCTCAGCCACAGGCCTTCCT
  81 GGTTGGAGTTCTGGGCTCTCCCAGGCCTGGGTGGCCTCTGTAGCTGGTCTCACTGCCCAGAGGGAACTGCACACACAGAC
 161 TTCTCTCTTACGTTCATGGCTGGCTTGAGATGAGTTGAAAATAACTTCGCCAGGCCAGTGTGTAGAACAGCTGGTCCAAC
 241 CAGACAGACTTTCACACCACAATTACTTCCATGCCTGAGCAGGATAGATTTGAAGTGCAAGCCGGAGGCAGCAGATCAGG
 321 AGTAGGGACAGGAAGGACAGGGGATGCCTGACCTGACAGGTGGCTTCAGGCCTCGGGAATCACAAGACATCCTGAACACA
 401 TTGCCTCCTCATCTTCTTCCTGCTCCTCCACCTCCTCCTCTCCTTGTCCTTCTCCTCTTTGTCCTCCTGCTTTCCGTATC
 481 CAAGTCTTGTACTTGTTTAAATTTATTCCTAAATATTTTATTCTTTTTGATAAGTGGAGTTACTTTCTTAATTTCATTTA
 561 GATTATTCATTGCTATTTTATAGAAATACAATGGATTTTTAAATGTTGATCTTGTATTCCGCAATCTTGCTGAAGTTGTT
 641 TACCGGCTCTAATACTTTTGCGGATTTCTTAGAATTTTCTGTAGACAGATCATGCCATCTCCAAATAGAGATGGTTTTAC
 721 TTCTTCCTGTCTGATCTGAATGCCTTTTATTTATTTTTCCCAATTGCCCTGAGCAGTACAATGATGAACACACGTTTCAA
 801 GAGCAGACATCTTGTCTTGTTCCTGACTCTGACAAGAAAGCATAAGTCTCTCACCATTTAGTGTGATTTTAGCTGTGGGT
 881 TTTTCTTGGACATCCTTATCAGGTTGAGAAAGTTCTCTTTTATTTCTAGTTTATTGAGTGTTTTATGATGAAACGGTGTT
 961 AGGTTTTGTCAAGTGATTTTTCTGTGTCTATGGGCATGATCATGTGGTTTTGTCGTGTATTTTATTAATGTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacGCGCCGGGCCCGAGUCc 5'
             :|: | |:|||||||| 
Target 5' atcTGTAG-CTGGGCTCAGc 3'
 49 - 67 152.00 -19.40
2 
miRNA  3' gacgcgccgggccCGAGUCc 5'
                       |||||| 
Target 5' ---------ggttGCTCAGa 3'
 1 - 11 120.00 -7.80
3 
miRNA  3' gacgCGCCGGGCCCGAGucc 5'
              | | :|:||||||   
Target 5' gttgGAGTTCTGGGCTCtcc 3'
 82 - 101 116.00 -16.52
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30539701 5 COSMIC
COSN30142615 10 COSMIC
COSN30498812 28 COSMIC
COSN1676026 189 COSMIC
COSN22449065 248 COSMIC
COSN9624859 750 COSMIC
COSN26270909 823 COSMIC
COSN26616244 933 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs767685181 3 dbSNP
rs759722214 4 dbSNP
rs759704219 6 dbSNP
rs752007123 13 dbSNP
rs774414741 15 dbSNP
rs1204385366 20 dbSNP
rs1022988094 22 dbSNP
rs558372548 23 dbSNP
rs1012944786 27 dbSNP
rs202006301 29 dbSNP
rs773518016 30 dbSNP
rs180765637 36 dbSNP
rs767863748 37 dbSNP
rs1041751991 38 dbSNP
rs1392397781 39 dbSNP
rs1274369688 40 dbSNP
rs759837734 45 dbSNP
rs769785133 47 dbSNP
rs890692788 49 dbSNP
rs556104600 52 dbSNP
rs1321844357 59 dbSNP
rs781763935 62 dbSNP
rs1354525666 73 dbSNP
rs1052032334 82 dbSNP
rs1293680152 107 dbSNP
rs1481485124 112 dbSNP
rs535406696 114 dbSNP
rs774878747 117 dbSNP
rs569655421 121 dbSNP
rs1237757891 131 dbSNP
rs1397961587 134 dbSNP
rs1360158121 142 dbSNP
rs1414588677 144 dbSNP
rs922095676 145 dbSNP
rs1163281007 146 dbSNP
rs1375303134 147 dbSNP
rs1037451826 149 dbSNP
rs941822578 154 dbSNP
rs1399028825 156 dbSNP
rs1444092027 157 dbSNP
rs549588147 160 dbSNP
rs1379254812 163 dbSNP
rs1395002483 165 dbSNP
rs533080407 171 dbSNP
rs570542415 172 dbSNP
rs1218963509 176 dbSNP
rs917803540 181 dbSNP
rs571572454 183 dbSNP
rs899107063 202 dbSNP
rs990700534 205 dbSNP
rs1038664153 208 dbSNP
rs943071481 209 dbSNP
rs1180202068 224 dbSNP
rs911638855 227 dbSNP
rs1264420236 234 dbSNP
rs1478445665 241 dbSNP
rs1170652552 247 dbSNP
rs987183992 253 dbSNP
rs934811320 255 dbSNP
rs924783987 257 dbSNP
rs1177773954 258 dbSNP
rs1359395154 260 dbSNP
rs1465050728 262 dbSNP
rs1300592491 267 dbSNP
rs979011421 268 dbSNP
rs1425165128 271 dbSNP
rs368951097 273 dbSNP
rs1277566166 286 dbSNP
rs547233160 288 dbSNP
rs1225134766 290 dbSNP
rs1279521516 293 dbSNP
rs1311865584 303 dbSNP
rs138341029 304 dbSNP
rs1262541740 326 dbSNP
rs561617597 343 dbSNP
rs1020809054 344 dbSNP
rs1010212358 346 dbSNP
rs548103146 349 dbSNP
rs1211666107 351 dbSNP
rs1482167262 352 dbSNP
rs991486445 357 dbSNP
rs1481589544 358 dbSNP
rs1192144300 359 dbSNP
rs1425384318 364 dbSNP
rs189914801 375 dbSNP
rs1273523218 381 dbSNP
rs960033313 388 dbSNP
rs1361892729 389 dbSNP
rs1035745905 394 dbSNP
rs766761159 397 dbSNP
rs1297445837 400 dbSNP
rs886250993 411 dbSNP
rs1358557468 414 dbSNP
rs1406503526 416 dbSNP
rs1026548887 417 dbSNP
rs1030547144 420 dbSNP
rs1217654903 422 dbSNP
rs996468406 423 dbSNP
rs994710147 425 dbSNP
rs899078588 426 dbSNP
rs1038966037 427 dbSNP
rs1490992573 429 dbSNP
rs941756486 433 dbSNP
rs1295207298 435 dbSNP
rs942999265 437 dbSNP
rs1189088912 442 dbSNP
rs1381795833 445 dbSNP
rs113313259 455 dbSNP
rs1378357141 458 dbSNP
rs1051429491 460 dbSNP
rs118112982 464 dbSNP
rs917623265 471 dbSNP
rs543543695 475 dbSNP
rs1043602888 476 dbSNP
rs1239465897 480 dbSNP
rs1307204293 487 dbSNP
rs937960152 490 dbSNP
rs1440754336 495 dbSNP
rs578084351 501 dbSNP
rs1289865744 520 dbSNP
rs1395915415 523 dbSNP
rs1207074636 533 dbSNP
rs1239578831 535 dbSNP
rs925100526 538 dbSNP
rs1177682018 539 dbSNP
rs947621074 556 dbSNP
rs916128202 558 dbSNP
rs1473530173 571 dbSNP
rs991750549 580 dbSNP
rs1412993087 593 dbSNP
rs960002728 594 dbSNP
rs1460853168 609 dbSNP
rs1356508496 613 dbSNP
rs114616913 620 dbSNP
rs1169242141 621 dbSNP
rs966961407 624 dbSNP
rs1342330408 627 dbSNP
rs541598118 644 dbSNP
rs1284055554 645 dbSNP
rs1249299298 649 dbSNP
rs982827213 651 dbSNP
rs1354904933 654 dbSNP
rs951533393 658 dbSNP
rs112559635 661 dbSNP
rs186288729 662 dbSNP
rs1317730324 671 dbSNP
rs989301570 675 dbSNP
rs1255820933 685 dbSNP
rs150474520 690 dbSNP
rs1030368894 695 dbSNP
rs1236791471 701 dbSNP
rs55936516 706 dbSNP
rs1479569345 710 dbSNP
rs1424066334 712 dbSNP
rs1250560924 725 dbSNP
rs1464959531 728 dbSNP
rs1228341041 730 dbSNP
rs748326638 738 dbSNP
rs1168720894 742 dbSNP
rs1404623232 748 dbSNP
rs182087059 766 dbSNP
rs890094437 767 dbSNP
rs575931586 781 dbSNP
rs1338822635 791 dbSNP
rs900777602 793 dbSNP
rs777017997 797 dbSNP
rs1340287627 798 dbSNP
rs1217202579 802 dbSNP
rs1355456728 803 dbSNP
rs1372361632 808 dbSNP
rs1200483575 809 dbSNP
rs1277268210 811 dbSNP
rs556163071 819 dbSNP
rs539154923 827 dbSNP
rs570478653 829 dbSNP
rs998559216 835 dbSNP
rs1477333868 846 dbSNP
rs1390182823 852 dbSNP
rs1191273727 858 dbSNP
rs547096100 863 dbSNP
rs752604874 871 dbSNP
rs1172250120 872 dbSNP
rs886614918 883 dbSNP
rs768458948 888 dbSNP
rs538203910 895 dbSNP
rs1047471797 903 dbSNP
rs1360458705 905 dbSNP
rs947504324 908 dbSNP
rs896143284 912 dbSNP
rs1332089388 919 dbSNP
rs916097111 928 dbSNP
rs746750554 929 dbSNP
rs1056036522 936 dbSNP
rs141568580 938 dbSNP
rs567945548 941 dbSNP
rs1453339449 945 dbSNP
rs779948260 949 dbSNP
rs983182275 953 dbSNP
rs1286597139 954 dbSNP
rs548066596 955 dbSNP
rs531674452 963 dbSNP
rs1269160204 968 dbSNP
rs1452029504 969 dbSNP
rs148306885 974 dbSNP
rs745871664 985 dbSNP
rs1205671208 986 dbSNP
rs143235310 994 dbSNP
rs963152551 996 dbSNP
rs1017407489 1002 dbSNP
rs533182467 1004 dbSNP
rs564537523 1005 dbSNP
rs567055587 1006 dbSNP
rs1386576713 1012 dbSNP
rs954613310 1014 dbSNP
rs1030279827 1015 dbSNP
rs763655040 1029 dbSNP
rs974717351 1037 dbSNP
rs190794338 1050 dbSNP
rs1043172513 1060 dbSNP
rs1267213310 1066 dbSNP
rs1356721031 1070 dbSNP
rs550418677 1074 dbSNP
rs1006924305 1078 dbSNP
rs950906126 1079 dbSNP
rs1026928647 1083 dbSNP
rs1237609660 1084 dbSNP
rs1437980744 1086 dbSNP
rs1167455477 1098 dbSNP
rs1013272448 1103 dbSNP
rs1335706197 1104 dbSNP
rs1457683109 1105 dbSNP
rs186686251 1115 dbSNP
rs1054816453 1135 dbSNP
rs1412105698 1137 dbSNP
rs1372013324 1140 dbSNP
rs1331698084 1141 dbSNP
rs1310755745 1146 dbSNP
rs1433729313 1152 dbSNP
rs1001793315 1155 dbSNP
rs1043643066 1156 dbSNP
rs1271016798 1156 dbSNP
rs903534291 1156 dbSNP
rs1173849249 1157 dbSNP
rs1451515235 1158 dbSNP
rs1257679957 1160 dbSNP
rs945318112 1160 dbSNP
rs1479660209 1161 dbSNP
rs1183701819 1162 dbSNP
rs1363197069 1170 dbSNP
rs75059123 1170 dbSNP
rs1411774221 1172 dbSNP
rs35927982 1172 dbSNP
rs397936425 1172 dbSNP
rs927857144 1172 dbSNP
rs1167563229 1173 dbSNP
rs1394539450 1173 dbSNP
rs1182626462 1174 dbSNP
rs1461719855 1176 dbSNP
rs1459992690 1182 dbSNP
rs1473485925 1185 dbSNP
rs1304105837 1186 dbSNP
rs1255157545 1192 dbSNP
rs1291435096 1193 dbSNP
rs1187411165 1199 dbSNP
rs1219016671 1200 dbSNP
rs1277761315 1201 dbSNP
rs1306004306 1202 dbSNP
rs1212570795 1214 dbSNP
rs894252977 1215 dbSNP
rs1256629225 1217 dbSNP
rs1055961659 1219 dbSNP
rs938866625 1222 dbSNP
rs1209331922 1230 dbSNP
rs1478317054 1233 dbSNP
rs1193440916 1238 dbSNP
rs1418295223 1239 dbSNP
rs907447474 1250 dbSNP
rs1426349572 1256 dbSNP
rs1177845141 1257 dbSNP
rs1047311863 1259 dbSNP
rs1280764014 1261 dbSNP
rs562302698 1264 dbSNP
rs1433623706 1267 dbSNP
rs1310924490 1269 dbSNP
rs542147638 1273 dbSNP
rs753437393 1283 dbSNP
rs1400328317 1284 dbSNP
rs1297329675 1289 dbSNP
rs919949530 1290 dbSNP
rs530600198 1291 dbSNP
rs1221148645 1297 dbSNP
rs974102315 1298 dbSNP
rs1302308957 1299 dbSNP
rs1269392977 1300 dbSNP
rs942769615 1301 dbSNP
rs1353891806 1302 dbSNP
rs1293064478 1303 dbSNP
rs923320872 1304 dbSNP
rs1488918233 1306 dbSNP
rs911335742 1307 dbSNP
rs1216589412 1312 dbSNP
rs141318108 1315 dbSNP
rs1489711481 1316 dbSNP
rs954582706 1320 dbSNP
rs1030630823 1321 dbSNP
rs964668291 1327 dbSNP
rs113298158 1328 dbSNP
rs1171225331 1334 dbSNP
rs1381675277 1334 dbSNP
rs1453224456 1334 dbSNP
rs1420198730 1336 dbSNP
rs1398518762 1337 dbSNP
rs1343199127 1343 dbSNP
rs1438358624 1343 dbSNP
rs967425631 1347 dbSNP
rs1294266585 1350 dbSNP
rs1367212219 1353 dbSNP
rs1384148568 1358 dbSNP
rs1438747466 1359 dbSNP
rs1021272720 1360 dbSNP
rs865945123 1371 dbSNP
rs1011277670 1373 dbSNP
rs752233697 1374 dbSNP
rs1282839173 1376 dbSNP
rs951058887 1385 dbSNP
rs1222811106 1402 dbSNP
rs1159745881 1411 dbSNP
rs1458759176 1420 dbSNP
rs1026587438 1424 dbSNP
rs894223412 1432 dbSNP
rs1439832547 1447 dbSNP
rs1157864147 1453 dbSNP
rs539375660 1454 dbSNP
rs1406841012 1459 dbSNP
rs1165251174 1478 dbSNP
rs1033352589 1483 dbSNP
rs755826978 1493 dbSNP
rs1239469559 1494 dbSNP
rs879489468 1498 dbSNP
rs1278224368 1499 dbSNP
rs1381993765 1499 dbSNP
rs751843282 1499 dbSNP
rs1446554640 1507 dbSNP
rs1333233869 1513 dbSNP
rs1211419182 1518 dbSNP
rs1259604546 1521 dbSNP
rs549493212 1522 dbSNP
rs1180502754 1523 dbSNP
rs1051033457 1524 dbSNP
rs1231059154 1524 dbSNP
rs139138179 1524 dbSNP
rs930259453 1526 dbSNP
rs1474137529 1531 dbSNP
rs7182261 1536 dbSNP
rs1401309947 1537 dbSNP
rs1409401885 1540 dbSNP
rs1326910685 1541 dbSNP
rs1361006766 1541 dbSNP
rs1211053064 1546 dbSNP
rs560540250 1547 dbSNP
rs1038319874 1556 dbSNP
rs551757414 1557 dbSNP
rs116482468 1562 dbSNP
rs144777732 1586 dbSNP
rs950762964 1593 dbSNP
rs1194925004 1598 dbSNP
rs919470906 1599 dbSNP
rs1443713432 1609 dbSNP
rs1356609301 1611 dbSNP
rs1285653122 1621 dbSNP
rs933121921 1630 dbSNP
rs528842953 1657 dbSNP
rs977681951 1665 dbSNP
rs762603503 1668 dbSNP
rs140978061 1669 dbSNP
rs1166439264 1674 dbSNP
rs960861498 1675 dbSNP
rs1437134488 1677 dbSNP
rs1033841433 1687 dbSNP
rs1312728905 1697 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 283748.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacGCGCCGGGCCCGAGUCc 5'
             :|: | |:|||||||| 
Target 5' aucUGUAG-CUGGGCUCAG- 3'
 		4 - 21
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacGCGCCGGGCCCGAgucc 5'
             :|: | |:|||||    
Target 5' aucUGUAG-CUGGGCU---- 3'
 		4 - 18
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000290472.3 | 3UTR | CUGAUCUGUAGCUGGGCUCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
75 hsa-miR-1199-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT130735 GATAD2B GATA zinc finger domain containing 2B 2 4
MIRT134908 CCND2 cyclin D2 2 2
MIRT273033 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT276644 KPNA3 karyopherin subunit alpha 3 2 6
MIRT446532 OAS2 2'-5'-oligoadenylate synthetase 2 2 2
MIRT456270 TDRKH tudor and KH domain containing 2 12
MIRT494455 BTG2 BTG anti-proliferation factor 2 2 2
MIRT494966 USP46 ubiquitin specific peptidase 46 2 2
MIRT496690 KREMEN1 kringle containing transmembrane protein 1 2 2
MIRT496698 RGS11 regulator of G protein signaling 11 2 2
MIRT504377 IRF4 interferon regulatory factor 4 2 6
MIRT510981 PFN2 profilin 2 2 6
MIRT512549 MFN2 mitofusin 2 2 6
MIRT513640 TP53INP2 tumor protein p53 inducible nuclear protein 2 2 2
MIRT514017 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 4
MIRT514075 MTRNR2L6 MT-RNR2-like 6 2 2
MIRT515302 C15orf38-AP3S2 C15orf38-AP3S2 readthrough 2 4
MIRT517286 AP3S2 adaptor related protein complex 3 sigma 2 subunit 2 4
MIRT519076 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT520780 TCF23 transcription factor 23 2 2
MIRT522487 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT528857 PKP1 plakophilin 1 2 2
MIRT529080 PATE2 prostate and testis expressed 2 2 2
MIRT531210 PLA2G4D phospholipase A2 group IVD 2 2
MIRT533989 TAB3 TGF-beta activated kinase 1 and MAP3K7 binding protein 3 2 2
MIRT537025 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT537499 FAM168B family with sequence similarity 168 member B 2 2
MIRT553127 UBE2Z ubiquitin conjugating enzyme E2 Z 2 2
MIRT555592 PIP5K1C phosphatidylinositol-4-phosphate 5-kinase type 1 gamma 2 2
MIRT556371 LUZP1 leucine zipper protein 1 2 2
MIRT569746 C2orf71 chromosome 2 open reading frame 71 2 2
MIRT570150 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT571244 FADS6 fatty acid desaturase 6 2 2
MIRT573066 TRIB1 tribbles pseudokinase 1 2 2
MIRT575534 Map4 microtubule-associated protein 4 2 2
MIRT575778 Tnfrsf10b tumor necrosis factor receptor superfamily, member 10b 2 2
MIRT616559 ZNF512B zinc finger protein 512B 2 2
MIRT630079 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT631480 KLHL21 kelch like family member 21 2 2
MIRT632174 CCL22 C-C motif chemokine ligand 22 2 2
MIRT638398 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT641193 ISG20L2 interferon stimulated exonuclease gene 20 like 2 2 2
MIRT642563 TEX9 testis expressed 9 2 2
MIRT642938 KRTAP5-9 keratin associated protein 5-9 2 2
MIRT649704 ZNF175 zinc finger protein 175 2 2
MIRT652114 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT652274 TOMM20 translocase of outer mitochondrial membrane 20 2 2
MIRT655216 PFKM phosphofructokinase, muscle 2 2
MIRT682779 ZNF852 zinc finger protein 852 2 2
MIRT683002 MUC20 mucin 20, cell surface associated 2 2
MIRT684321 GTF3C4 general transcription factor IIIC subunit 4 2 2
MIRT689436 CYB561 cytochrome b561 2 2
MIRT693848 ZNF107 zinc finger protein 107 2 2
MIRT696716 TAX1BP3 Tax1 binding protein 3 2 2
MIRT698598 TEX261 testis expressed 261 2 2
MIRT699974 RREB1 ras responsive element binding protein 1 2 2
MIRT703311 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT706797 RAI1 retinoic acid induced 1 2 2
MIRT709005 CD109 CD109 molecule 2 2
MIRT709182 TBC1D10B TBC1 domain family member 10B 2 2
MIRT709836 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT711628 CORO1C coronin 1C 2 2
MIRT712635 RNF103-CHMP3 RNF103-CHMP3 readthrough 2 2
MIRT713695 CYB5R4 cytochrome b5 reductase 4 2 2
MIRT713753 SLC9A8 solute carrier family 9 member A8 2 2
MIRT714909 CHMP3 charged multivesicular body protein 3 2 2
MIRT716372 CBLL1 Cbl proto-oncogene like 1 2 2
MIRT718304 XPOT exportin for tRNA 2 2
MIRT718714 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718741 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT719442 NPTX2 neuronal pentraxin 2 2 2
MIRT720897 OTUD4 OTU deubiquitinase 4 2 2
MIRT722450 RXFP4 relaxin/insulin like family peptide receptor 4 2 2
MIRT723883 VKORC1 vitamin K epoxide reductase complex subunit 1 2 2
MIRT724587 SYNJ2BP synaptojanin 2 binding protein 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1199 (S)-3,5-dihydroxyphenylglycine (DHPG) NULL 443586 Quantitative real-time PCR mouse brain 22309833 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-1199-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-1199-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)

Error report submission