miRTarBase - #MIRT531276


—
pre-miRNA Information
pre-miRNA hsa-mir-103b-1   
Genomic Coordinates chr5: 168560904 - 168560965
Description Homo sapiens miR-103b-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-103b-2   
Genomic Coordinates chr20: 3917502 - 3917563
Description Homo sapiens miR-103b-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-103b
Sequence 1| UCAUAGCCCUGUACAAUGCUGCU |23
Evidence Experimental
Experiments ChIP-seq
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN28198041 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs369221403 4 dbSNP
rs1283132774 7 dbSNP
rs1222085747 10 dbSNP
rs572980521 14 dbSNP
rs748411363 15 dbSNP
rs769854452 23 dbSNP
Putative Targets

Gene Information
Gene Symbol PPIL3   
Synonyms CYPJ
Description peptidylprolyl isomerase like 3
Transcript NM_032472   
Other Transcripts NM_130906   
Expression
Putative miRNA Targets on PPIL3
3'UTR of PPIL3
(miRNA target sites are highlighted)		 
>PPIL3|NM_032472|3'UTR
   1 CTATGATAGACCTGGACAAATAACTTGACAAATTGCTGGAACACACTTATTGTGGTTTACCCGGTTTTAATTATGTCAGA
  81 GATTGCATCATCCTTCTGCTTGTTTACAACTATGATCTTCTATGAAATGGTGGTACCAAGGGGCGCCCAACAGCTTTTAT
 161 CCCCATTCTTAGAGCATATTCTTTATTATAATGATTATCCAACATATTTCTTTAATTTTAATACAAAAAATACATCATTT
 241 AATTTTTGTTACATATGAACATTCATTTTTAAATGCTCAGCCTCAAGTGCAGGCATTTTTGAGTGGCCTGATTACATATT
 321 CCTCCCACAGCAAGTCCGTATCCTGGAAGTGTTATTTTATAATAAAATTTAAAAAGTTTTAAAGAATTAAATCGTAGGAC
 401 AAATTAATTAAAATATTGTGTAAAATTACCTTCAGGCTAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucgucgUAA--CAUGUCCCGAUacu 5'
                |||   | || |||||   
Target 5' tgtaaaATTACCTTCA-GGCTAaaa 3'
 419 - 442 106.00 -5.02
2 
miRNA  3' ucGUCGUAAC--AUGUCCCGAUACu 5'
            | || |||  ||||   ||||| 
Target 5' ttCTGC-TTGTTTACA--ACTATGa 3'
 94 - 115 101.00 -9.60
3 
miRNA  3' ucGUCGUA--ACAUGUCCCGAUAcu 5'
            |||| |   ||:|| ||| ||  
Target 5' ctCAGCCTCAAGTGCA-GGC-ATtt 3'
 276 - 298 90.00 -11.71
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20057356 34 COSMIC
COSN16127747 39 COSMIC
COSN30571102 41 COSMIC
COSN31523399 48 COSMIC
COSN28877407 78 COSMIC
COSN510159 87 COSMIC
COSN31514335 88 COSMIC
COSN30500738 99 COSMIC
COSN30593973 116 COSMIC
COSN32053473 120 COSMIC
COSN28869111 144 COSMIC
COSN30170645 163 COSMIC
COSN31486760 193 COSMIC
COSN4801096 336 COSMIC
COSN20097681 401 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs768242863 3 dbSNP
rs11892119 6 dbSNP
rs1221439844 11 dbSNP
rs951370233 19 dbSNP
rs1029894212 20 dbSNP
rs777018329 29 dbSNP
rs771386177 45 dbSNP
rs1450781772 46 dbSNP
rs1273275810 49 dbSNP
rs150825161 50 dbSNP
rs369908436 52 dbSNP
rs561798296 58 dbSNP
rs1265246320 59 dbSNP
rs1367718081 60 dbSNP
rs910902498 62 dbSNP
rs1317878352 63 dbSNP
rs546101376 77 dbSNP
rs1010660750 79 dbSNP
rs1432969658 85 dbSNP
rs985380782 87 dbSNP
rs1293336382 93 dbSNP
rs947339415 98 dbSNP
rs1208971230 104 dbSNP
rs764275580 109 dbSNP
rs1351173470 110 dbSNP
rs1357114905 112 dbSNP
rs1268929544 120 dbSNP
rs893440679 122 dbSNP
rs1327415657 126 dbSNP
rs1292175888 128 dbSNP
rs1052140892 135 dbSNP
rs572070437 143 dbSNP
rs1437328980 144 dbSNP
rs200873336 145 dbSNP
rs1194625945 147 dbSNP
rs1322171072 159 dbSNP
rs1444520531 163 dbSNP
rs374603361 176 dbSNP
rs1386519476 179 dbSNP
rs1184614403 188 dbSNP
rs1387525584 190 dbSNP
rs1389841336 196 dbSNP
rs1385923500 203 dbSNP
rs955885173 210 dbSNP
rs1332234023 231 dbSNP
rs1380527516 232 dbSNP
rs141453565 255 dbSNP
rs1410823362 261 dbSNP
rs982630321 264 dbSNP
rs1236598018 277 dbSNP
rs1259799280 278 dbSNP
rs535081496 289 dbSNP
rs1172634900 314 dbSNP
rs1478739754 316 dbSNP
rs1375822101 324 dbSNP
rs574137569 328 dbSNP
rs1206409043 333 dbSNP
rs970743350 337 dbSNP
rs1460467116 338 dbSNP
rs754797915 359 dbSNP
rs948200292 364 dbSNP
rs1012503742 375 dbSNP
rs888659826 393 dbSNP
rs555752160 394 dbSNP
rs1249651353 396 dbSNP
rs1206658971 397 dbSNP
rs145843683 412 dbSNP
rs1471254605 413 dbSNP
rs1463686648 414 dbSNP
rs1171016800 422 dbSNP
rs1405497349 423 dbSNP
rs1267794721 426 dbSNP
rs1470344090 430 dbSNP
rs1337376294 434 dbSNP
rs537701706 438 dbSNP
rs1408134869 439 dbSNP
rs1027246837 442 dbSNP
rs994305399 449 dbSNP
rs1305978066 450 dbSNP
rs1347253624 452 dbSNP
rs897331989 456 dbSNP
rs1240805240 458 dbSNP
rs78753173 462 dbSNP
rs1366630317 463 dbSNP
rs1203733030 467 dbSNP
rs943813990 469 dbSNP
rs889450171 487 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 53938.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ucgucguaACAUGUCCCG---AUACu 5'
                  ||||:| ||:   |||| 
Target 5' -------gUGUAUAAGGUAUAUAUGa 3'
 		1 - 19
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000286175.8 | 3UTR | GUGUAUAAGGUAUAUAUGAAACGUAAAUGAACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.275 1.8e-1 0.330 1.4e-1 13 Click to see details
GSE28544 Breast cancer -0.044 4.2e-1 0.067 3.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
53 hsa-miR-103b Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT218386 E2F3 E2F transcription factor 3 2 2
MIRT404221 RPL7L1 ribosomal protein L7 like 1 2 2
MIRT441502 SPG20 spartin 2 6
MIRT444124 ZNRF3 zinc and ring finger 3 2 2
MIRT454236 OSBPL10 oxysterol binding protein like 10 2 4
MIRT457919 ZNF212 zinc finger protein 212 2 2
MIRT462254 LAMA4 laminin subunit alpha 4 2 2
MIRT463176 ZNF281 zinc finger protein 281 2 2
MIRT472355 TSPAN1 tetraspanin 1 2 2
MIRT474133 LIN54 lin-54 DREAM MuvB core complex component 2 4
MIRT494946 IFFO2 intermediate filament family orphan 2 2 2
MIRT497403 NPY4R neuropeptide Y receptor Y4 2 2
MIRT497641 GLDN gliomedin 2 2
MIRT505340 TMEM245 transmembrane protein 245 2 6
MIRT505680 SESTD1 SEC14 and spectrin domain containing 1 2 6
MIRT510706 SREK1IP1 SREK1 interacting protein 1 2 6
MIRT512198 C1orf43 chromosome 1 open reading frame 43 2 2
MIRT522089 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 4
MIRT525074 FRK fyn related Src family tyrosine kinase 2 2
MIRT531276 PPIL3 peptidylprolyl isomerase like 3 2 2
MIRT535119 PLXNA2 plexin A2 2 2
MIRT540836 GNAT1 G protein subunit alpha transducin 1 2 4
MIRT541018 WIPI2 WD repeat domain, phosphoinositide interacting 2 2 2
MIRT545752 CA12 carbonic anhydrase 12 2 4
MIRT546404 SRP9 signal recognition particle 9 2 2
MIRT547991 HCFC2 host cell factor C2 2 4
MIRT554502 SAE1 SUMO1 activating enzyme subunit 1 2 2
MIRT558360 DMTF1 cyclin D binding myb like transcription factor 1 2 2
MIRT558863 CD2AP CD2 associated protein 2 2
MIRT559939 ZNF567 zinc finger protein 567 2 2
MIRT566300 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 2 2
MIRT567490 FOXK1 forkhead box K1 2 2
MIRT617139 ZNF556 zinc finger protein 556 2 2
MIRT625400 AKR7L aldo-keto reductase family 7 like (gene/pseudogene) 2 2
MIRT626491 CEP89 centrosomal protein 89 2 2
MIRT629487 GSN gelsolin 2 4
MIRT638456 PLXDC2 plexin domain containing 2 2 2
MIRT648498 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT654845 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT664587 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT664977 TDRD1 tudor domain containing 1 2 2
MIRT665028 ELK1 ELK1, ETS transcription factor 2 2
MIRT666043 STON2 stonin 2 2 2
MIRT668863 CRY2 cryptochrome circadian clock 2 2 2
MIRT669297 C17orf85 nuclear cap binding subunit 3 2 2
MIRT680975 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT682267 RS1 retinoschisin 1 2 2
MIRT685283 KIAA1143 KIAA1143 2 2
MIRT693375 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT701785 MSL1 male specific lethal 1 homolog 2 2
MIRT709373 SPECC1 sperm antigen with calponin homology and coiled-coil domains 1 2 2
MIRT715154 IL12B interleukin 12B 2 2
MIRT734499 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-103b Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-103b Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-103b Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission