miRTarBase - #MIRT531284


—
pre-miRNA Information
pre-miRNA hsa-mir-3689e   
Genomic Coordinates chr9: 134850570 - 134850641
Description Homo sapiens miR-3689e stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3689e
Sequence 7| UGUGAUAUCAUGGUUCCUGGGA |28
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs796680971 2 dbSNP
rs1260021280 4 dbSNP
rs951515835 6 dbSNP
rs1244734523 9 dbSNP
rs1286185090 10 dbSNP
rs922384128 14 dbSNP
rs1485140592 16 dbSNP
Putative Targets

Gene Information
Gene Symbol SLC7A7   
Synonyms LAT3, LPI, MOP-2, Y+LAT1, y+LAT-1
Description solute carrier family 7 member 7
Transcript NM_001126105   
Other Transcripts NM_001126106   
Expression
Putative miRNA Targets on SLC7A7
3'UTR of SLC7A7
(miRNA target sites are highlighted)		 
>SLC7A7|NM_001126105|3'UTR
   1 ACACCATCTGGAATCCTGATGTGGAAAGCAGGGGTTTCTGGTCTACTGGCTAGAGCTAAGGAAGTTGAAAAGGAAAGCTC
  81 ACTTCTTTGGAGGCACCTGTCCAGAAGCCTGGCCTAGGCAGCTTCAACCTTTGAACTTACTTTTTGAAATGAAAAGTAAT
 161 TTATTTGTTTTGCTACATACTGTTCCAGACTTTTAAAGGGGACAATGAAGGTGACTGTGGGGAGGAGCATGTCAGGTTTG
 241 GGCTTGGTTGTTTTAGAAGCACCTGGGTGTGCCTACCTACTCCTCTTTTCTTTTAAAAGGGCCCACAATGCTCCAATTTC
 321 CTGTCTCCTTTAGAGAGACATGAAACTATCACAGGTGCTGGATGACAATAAAAGTTTATGTTCCTAAAAAAAAAAAAAAA
 401 AAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGGUC-CUUGGUAC--U-AUAGUGu 5'
            ::|| ||: ||||  | |||||| 
Target 5' ctTTAGAGAGACATGAAACTATCACa 3'
 328 - 353 130.00 -15.90
2 
miRNA  3' agggUCCUUGGUACUAUAGUgu 5'
              ||||:|    ||:|||  
Target 5' ggggAGGAGC----ATGTCAgg 3'
 219 - 236 116.00 -9.70
3 
miRNA  3' agGGUCCUUGGUACUAUAgugu 5'
            :| ||||:| ||||:|    
Target 5' caTCTGGAATCCTGATGTggaa 3'
 5 - 26 100.00 -14.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
391214 8 ClinVar
312808 16 ClinVar
883231 114 ClinVar
312807 141 ClinVar
882082 205 ClinVar
882081 225 ClinVar
882080 227 ClinVar
882079 235 ClinVar
312806 246 ClinVar
882078 272 ClinVar
312805 327 ClinVar
COSN30669516 14 COSMIC
COSN1165840 29 COSMIC
COSN15619073 32 COSMIC
COSN30135561 33 COSMIC
COSN31558436 85 COSMIC
COSN30138462 158 COSMIC
COSN21143605 167 COSMIC
COSN20092812 211 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1279546828 3 dbSNP
rs755180352 5 dbSNP
rs369547368 6 dbSNP
rs1425438218 7 dbSNP
rs1057524005 8 dbSNP
rs1176332045 10 dbSNP
rs375108350 16 dbSNP
rs1236781926 18 dbSNP
rs907074483 20 dbSNP
rs372275755 21 dbSNP
rs1490189839 24 dbSNP
rs946362615 28 dbSNP
rs929919094 31 dbSNP
rs758601802 32 dbSNP
rs1434744135 33 dbSNP
rs750961059 40 dbSNP
rs141956976 41 dbSNP
rs765770374 43 dbSNP
rs1160337820 44 dbSNP
rs757850594 52 dbSNP
rs1374914314 54 dbSNP
rs754178526 55 dbSNP
rs1447186300 56 dbSNP
rs1382873758 59 dbSNP
rs1456911554 60 dbSNP
rs1293823028 62 dbSNP
rs764394389 65 dbSNP
rs760339503 70 dbSNP
rs1390078795 71 dbSNP
rs1467518337 72 dbSNP
rs770021080 77 dbSNP
rs914925950 77 dbSNP
rs1242964940 81 dbSNP
rs919816978 83 dbSNP
rs748594740 88 dbSNP
rs1157705103 89 dbSNP
rs775050915 90 dbSNP
rs767004080 94 dbSNP
rs1180920211 96 dbSNP
rs1321265906 97 dbSNP
rs759116860 98 dbSNP
rs1255904294 100 dbSNP
rs1245590914 103 dbSNP
rs773857612 110 dbSNP
rs1267502891 111 dbSNP
rs1484514027 112 dbSNP
rs1256707074 115 dbSNP
rs1237370349 119 dbSNP
rs1215937632 124 dbSNP
rs148149467 134 dbSNP
rs762821525 139 dbSNP
rs1029895284 140 dbSNP
rs545489205 141 dbSNP
rs1339724489 142 dbSNP
rs1310293594 144 dbSNP
rs530836172 146 dbSNP
rs573116829 146 dbSNP
rs1397764018 150 dbSNP
rs185065615 150 dbSNP
rs747232531 151 dbSNP
rs1164836470 152 dbSNP
rs1297074276 155 dbSNP
rs1417262171 157 dbSNP
rs1362072328 159 dbSNP
rs1369881505 160 dbSNP
rs780489702 160 dbSNP
rs1015646125 161 dbSNP
rs1006053484 163 dbSNP
rs755492313 167 dbSNP
rs888426408 167 dbSNP
rs543316493 177 dbSNP
rs1335387305 179 dbSNP
rs1185832105 181 dbSNP
rs1379049625 195 dbSNP
rs568241315 195 dbSNP
rs1314976999 197 dbSNP
rs1022986147 198 dbSNP
rs1218269859 203 dbSNP
rs574414124 205 dbSNP
rs181280202 210 dbSNP
rs1200292234 215 dbSNP
rs1265420206 224 dbSNP
rs555934632 225 dbSNP
rs1355878942 226 dbSNP
rs754340252 227 dbSNP
rs1246659736 235 dbSNP
rs571315064 239 dbSNP
rs886050404 246 dbSNP
rs1322276280 248 dbSNP
rs939164060 250 dbSNP
rs1423880424 253 dbSNP
rs147164177 254 dbSNP
rs756490569 255 dbSNP
rs1341899155 256 dbSNP
rs534724772 261 dbSNP
rs1467022043 267 dbSNP
rs1305052621 268 dbSNP
rs143575981 272 dbSNP
rs767091960 274 dbSNP
rs1161852301 275 dbSNP
rs1459719008 279 dbSNP
rs1279150527 283 dbSNP
rs1419217942 286 dbSNP
rs1220283137 287 dbSNP
rs946469883 287 dbSNP
rs1311345922 290 dbSNP
rs1210731853 293 dbSNP
rs1022475965 295 dbSNP
rs915017898 295 dbSNP
rs1012442448 300 dbSNP
rs1425933233 302 dbSNP
rs1194438994 305 dbSNP
rs1451279669 306 dbSNP
rs1265468435 311 dbSNP
rs985071558 316 dbSNP
rs1211426558 324 dbSNP
rs1316409471 325 dbSNP
rs1478614098 327 dbSNP
rs886050403 327 dbSNP
rs1257180102 328 dbSNP
rs548588130 331 dbSNP
rs958390933 332 dbSNP
rs1216776417 333 dbSNP
rs45452091 335 dbSNP
rs1319879323 339 dbSNP
rs1278316538 344 dbSNP
rs1424917608 347 dbSNP
rs1231829326 348 dbSNP
rs529128022 350 dbSNP
rs774773037 351 dbSNP
rs1329009182 353 dbSNP
rs113138294 354 dbSNP
rs1343939154 355 dbSNP
rs1325040557 356 dbSNP
rs1386989075 361 dbSNP
rs35323339 362 dbSNP
rs1395747309 369 dbSNP
rs1331068394 371 dbSNP
rs932360277 374 dbSNP
rs1464557031 377 dbSNP
rs773963485 380 dbSNP
rs977418370 382 dbSNP
rs188480200 386 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 9056.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggguccuugguacuAUAGUGu 5'
                         |||||| 
Target 5' --------------cUAUCACa 3'
 		1 - 8
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000285850.7 | 3UTR | CUAUCACAGGUGCUGGAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
45 hsa-miR-3689e Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT112233 MDM4 MDM4, p53 regulator 2 2
MIRT188658 FAM76A family with sequence similarity 76 member A 2 2
MIRT200913 ZNF264 zinc finger protein 264 2 4
MIRT210597 KBTBD8 kelch repeat and BTB domain containing 8 2 6
MIRT299209 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT317526 SLC39A7 solute carrier family 39 member 7 2 2
MIRT355852 SGMS2 sphingomyelin synthase 2 2 4
MIRT443050 THRB thyroid hormone receptor beta 2 2
MIRT446629 SDC3 syndecan 3 2 2
MIRT449407 TRIM5 tripartite motif containing 5 2 2
MIRT463559 ZBTB39 zinc finger and BTB domain containing 39 2 6
MIRT465701 TNFAIP1 TNF alpha induced protein 1 2 2
MIRT472686 MYCBP MYC binding protein 2 4
MIRT493285 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT499336 RAB25 RAB25, member RAS oncogene family 2 2
MIRT501721 OVOL1 ovo like transcriptional repressor 1 2 2
MIRT507975 BCL2L13 BCL2 like 13 2 4
MIRT511809 HDGF heparin binding growth factor 2 6
MIRT516709 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 4
MIRT527851 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT531284 SLC7A7 solute carrier family 7 member 7 2 2
MIRT531892 INVS inversin 2 8
MIRT536805 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT537805 EFNB2 ephrin B2 2 4
MIRT544333 LPGAT1 lysophosphatidylglycerol acyltransferase 1 2 2
MIRT547140 PGM3 phosphoglucomutase 3 2 2
MIRT547427 MED4 mediator complex subunit 4 2 2
MIRT563352 ZNF181 zinc finger protein 181 2 2
MIRT564847 ZBED3 zinc finger BED-type containing 3 2 2
MIRT566424 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 2
MIRT572510 KIAA0232 KIAA0232 2 2
MIRT574680 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT608818 ONECUT3 one cut homeobox 3 2 6
MIRT608884 CLIC6 chloride intracellular channel 6 2 2
MIRT608957 GIMAP1 GTPase, IMAP family member 1 2 4
MIRT609010 HPS3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 2 2
MIRT641429 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT661839 ZNF587B zinc finger protein 587B 2 2
MIRT690649 RPF2 ribosome production factor 2 homolog 2 2
MIRT704617 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT708712 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT710661 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 2
MIRT711258 TPCN2 two pore segment channel 2 2 2
MIRT714647 FSTL1 follistatin like 1 2 2
MIRT718516 COL19A1 collagen type XIX alpha 1 chain 2 2

Error report submission