pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3689e |
Genomic Coordinates | chr9: 134850570 - 134850641 |
Description | Homo sapiens miR-3689e stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3689e | ||||||||||||||||||||||||
Sequence | 7| UGUGAUAUCAUGGUUCCUGGGA |28 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Illumina | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SLC7A7 | ||||||||||||||||||||
Synonyms | LAT3, LPI, MOP-2, Y+LAT1, y+LAT-1 | ||||||||||||||||||||
Description | solute carrier family 7 member 7 | ||||||||||||||||||||
Transcript | NM_001126105 | ||||||||||||||||||||
Other Transcripts | NM_001126106 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SLC7A7 | |||||||||||||||||||||
3'UTR of SLC7A7 (miRNA target sites are highlighted) |
>SLC7A7|NM_001126105|3'UTR 1 ACACCATCTGGAATCCTGATGTGGAAAGCAGGGGTTTCTGGTCTACTGGCTAGAGCTAAGGAAGTTGAAAAGGAAAGCTC 81 ACTTCTTTGGAGGCACCTGTCCAGAAGCCTGGCCTAGGCAGCTTCAACCTTTGAACTTACTTTTTGAAATGAAAAGTAAT 161 TTATTTGTTTTGCTACATACTGTTCCAGACTTTTAAAGGGGACAATGAAGGTGACTGTGGGGAGGAGCATGTCAGGTTTG 241 GGCTTGGTTGTTTTAGAAGCACCTGGGTGTGCCTACCTACTCCTCTTTTCTTTTAAAAGGGCCCACAATGCTCCAATTTC 321 CTGTCTCCTTTAGAGAGACATGAAACTATCACAGGTGCTGGATGACAATAAAAGTTTATGTTCCTAAAAAAAAAAAAAAA 401 AAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 9056.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000285850.7 | 3UTR | CUAUCACAGGUGCUGGAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
45 hsa-miR-3689e Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT112233 | MDM4 | MDM4, p53 regulator | 2 | 2 | ||||||||
MIRT188658 | FAM76A | family with sequence similarity 76 member A | 2 | 2 | ||||||||
MIRT200913 | ZNF264 | zinc finger protein 264 | 2 | 4 | ||||||||
MIRT210597 | KBTBD8 | kelch repeat and BTB domain containing 8 | 2 | 6 | ||||||||
MIRT299209 | CSRNP3 | cysteine and serine rich nuclear protein 3 | 2 | 2 | ||||||||
MIRT317526 | SLC39A7 | solute carrier family 39 member 7 | 2 | 2 | ||||||||
MIRT355852 | SGMS2 | sphingomyelin synthase 2 | 2 | 4 | ||||||||
MIRT443050 | THRB | thyroid hormone receptor beta | 2 | 2 | ||||||||
MIRT446629 | SDC3 | syndecan 3 | 2 | 2 | ||||||||
MIRT449407 | TRIM5 | tripartite motif containing 5 | 2 | 2 | ||||||||
MIRT463559 | ZBTB39 | zinc finger and BTB domain containing 39 | 2 | 6 | ||||||||
MIRT465701 | TNFAIP1 | TNF alpha induced protein 1 | 2 | 2 | ||||||||
MIRT472686 | MYCBP | MYC binding protein | 2 | 4 | ||||||||
MIRT493285 | LNPEP | leucyl and cystinyl aminopeptidase | 2 | 2 | ||||||||
MIRT499336 | RAB25 | RAB25, member RAS oncogene family | 2 | 2 | ||||||||
MIRT501721 | OVOL1 | ovo like transcriptional repressor 1 | 2 | 2 | ||||||||
MIRT507975 | BCL2L13 | BCL2 like 13 | 2 | 4 | ||||||||
MIRT511809 | HDGF | heparin binding growth factor | 2 | 6 | ||||||||
MIRT516709 | PIK3CG | phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma | 2 | 4 | ||||||||
MIRT527851 | SMOC1 | SPARC related modular calcium binding 1 | 2 | 2 | ||||||||
MIRT531284 | SLC7A7 | solute carrier family 7 member 7 | 2 | 2 | ||||||||
MIRT531892 | INVS | inversin | 2 | 8 | ||||||||
MIRT536805 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | 2 | 2 | ||||||||
MIRT537805 | EFNB2 | ephrin B2 | 2 | 4 | ||||||||
MIRT544333 | LPGAT1 | lysophosphatidylglycerol acyltransferase 1 | 2 | 2 | ||||||||
MIRT547140 | PGM3 | phosphoglucomutase 3 | 2 | 2 | ||||||||
MIRT547427 | MED4 | mediator complex subunit 4 | 2 | 2 | ||||||||
MIRT563352 | ZNF181 | zinc finger protein 181 | 2 | 2 | ||||||||
MIRT564847 | ZBED3 | zinc finger BED-type containing 3 | 2 | 2 | ||||||||
MIRT566424 | PIGA | phosphatidylinositol glycan anchor biosynthesis class A | 2 | 2 | ||||||||
MIRT572510 | KIAA0232 | KIAA0232 | 2 | 2 | ||||||||
MIRT574680 | HNRNPA3 | heterogeneous nuclear ribonucleoprotein A3 | 2 | 2 | ||||||||
MIRT608818 | ONECUT3 | one cut homeobox 3 | 2 | 6 | ||||||||
MIRT608884 | CLIC6 | chloride intracellular channel 6 | 2 | 2 | ||||||||
MIRT608957 | GIMAP1 | GTPase, IMAP family member 1 | 2 | 4 | ||||||||
MIRT609010 | HPS3 | HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 | 2 | 2 | ||||||||
MIRT641429 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | 2 | 2 | ||||||||
MIRT661839 | ZNF587B | zinc finger protein 587B | 2 | 2 | ||||||||
MIRT690649 | RPF2 | ribosome production factor 2 homolog | 2 | 2 | ||||||||
MIRT704617 | CLIP1 | CAP-Gly domain containing linker protein 1 | 2 | 2 | ||||||||
MIRT708712 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | 1 | 1 | ||||||||
MIRT710661 | CSTF2T | cleavage stimulation factor subunit 2 tau variant | 2 | 2 | ||||||||
MIRT711258 | TPCN2 | two pore segment channel 2 | 2 | 2 | ||||||||
MIRT714647 | FSTL1 | follistatin like 1 | 2 | 2 | ||||||||
MIRT718516 | COL19A1 | collagen type XIX alpha 1 chain | 2 | 2 |