miRTarBase - #MIRT531341


—
pre-miRNA Information
pre-miRNA hsa-mir-216b   
Genomic Coordinates chr2: 56000714 - 56000795
Description Homo sapiens miR-216b stem-loop
Comment This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-216b-3p
Sequence 49| ACACACUUACCCGUAGAGAUUCUA |72
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 9 2 - 56000739 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1032185572 4 dbSNP
rs1291886633 6 dbSNP
rs1195180466 10 dbSNP
rs761473579 10 dbSNP
rs751204276 12 dbSNP
rs368125248 13 dbSNP
rs755646560 13 dbSNP
rs1307586870 14 dbSNP
rs907200088 16 dbSNP
rs763696104 22 dbSNP
rs762699560 24 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B5PHM2 miR-216b Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Plasma MiRNA qPCR analyses
Gene Information
Gene Symbol TGIF2LX   
Synonyms TGIFLX
Description TGFB induced factor homeobox 2 like, X-linked
Transcript NM_138960   
Expression
Putative miRNA Targets on TGIF2LX
3'UTR of TGIF2LX
(miRNA target sites are highlighted)		 
>TGIF2LX|NM_138960|3'UTR
   1 TTGATGATGTTCCAAAAACCCAAGTAGTCAGTCCCTTATGTACTGTGGTAAACCTGTTTATGTTCACCCCAAAAAAAAAA
  81 AAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aucUUAGAG-AUGCCCAUUCACACa 5'
             |:|| | ||:|    | |||| 
Target 5' gtcAGTCCCTTATGT---ACTGTGg 3'
 27 - 48 93.00 -7.03
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs373148347 8 dbSNP
rs1450513377 9 dbSNP
rs748535095 23 dbSNP
rs376626896 25 dbSNP
rs758935865 27 dbSNP
rs764851895 30 dbSNP
rs369936646 32 dbSNP
rs868774187 35 dbSNP
rs775392054 36 dbSNP
rs1053792 39 dbSNP
rs762945174 41 dbSNP
rs764024037 44 dbSNP
rs200060527 49 dbSNP
rs1266539403 58 dbSNP
rs1453010666 58 dbSNP
rs1305812351 69 dbSNP
rs1016665127 73 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 90316.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000283891.5 | 3UTR | GUGUGAAAUAGAUCAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
111 hsa-miR-216b-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT071722 CCNK cyclin K 2 2
MIRT074768 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT101407 SSR1 signal sequence receptor subunit 1 2 2
MIRT241289 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 4
MIRT268292 CCND1 cyclin D1 2 8
MIRT445347 IFNA6 interferon alpha 6 2 2
MIRT446663 MXI1 MAX interactor 1, dimerization protein 2 4
MIRT447595 MSH3 mutS homolog 3 2 2
MIRT448485 SEMA4F ssemaphorin 4F 2 2
MIRT450309 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT451850 TXNDC5 thioredoxin domain containing 5 2 2
MIRT483613 SMC5 structural maintenance of chromosomes 5 2 2
MIRT485633 EEPD1 endonuclease/exonuclease/phosphatase family domain containing 1 2 2
MIRT499766 CIRH1A UTP4, small subunit processome component 2 6
MIRT503337 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT513007 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT513529 RHOQ ras homolog family member Q 2 4
MIRT521499 RAB11B RAB11B, member RAS oncogene family 2 2
MIRT524335 CRK CRK proto-oncogene, adaptor protein 2 4
MIRT524731 BRI3BP BRI3 binding protein 2 8
MIRT525326 SNX29 sorting nexin 29 2 2
MIRT526264 CCDC169 coiled-coil domain containing 169 2 2
MIRT527428 NRL neural retina leucine zipper 2 2
MIRT527512 ZNF134 zinc finger protein 134 2 2
MIRT528881 ATF3 activating transcription factor 3 2 2
MIRT529578 IGBP1 immunoglobulin binding protein 1 2 4
MIRT531122 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT531341 TGIF2LX TGFB induced factor homeobox 2 like, X-linked 2 2
MIRT532433 DHX33 DEAH-box helicase 33 2 2
MIRT534032 STX7 syntaxin 7 2 2
MIRT534538 SACS sacsin molecular chaperone 2 4
MIRT538886 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT539628 CD19 CD19 molecule 2 8
MIRT540327 ATAT1 alpha tubulin acetyltransferase 1 2 8
MIRT540353 OCLN occludin 2 6
MIRT540699 ATG10 autophagy related 10 2 4
MIRT541033 STRBP spermatid perinuclear RNA binding protein 2 8
MIRT541945 NBPF10 NBPF member 10 2 4
MIRT543505 PLS1 plastin 1 2 2
MIRT551164 UBTF upstream binding transcription factor, RNA polymerase I 2 4
MIRT551790 ZNF117 zinc finger protein 117 2 4
MIRT553227 TWF1 twinfilin actin binding protein 1 2 2
MIRT559622 AKIRIN2 akirin 2 2 2
MIRT559719 ADORA2B adenosine A2b receptor 2 2
MIRT564600 ZNF781 zinc finger protein 781 2 2
MIRT567015 KLHL15 kelch like family member 15 2 2
MIRT569564 C7orf26 chromosome 7 open reading frame 26 2 2
MIRT572155 DDX3X DEAD-box helicase 3, X-linked 2 2
MIRT575399 Zdhhc22 zinc finger, DHHC-type containing 22 2 5
MIRT607322 PKNOX1 PBX/knotted 1 homeobox 1 2 4
MIRT607953 NFAM1 NFAT activating protein with ITAM motif 1 2 10
MIRT607979 ZDHHC22 zinc finger DHHC-type containing 22 2 7
MIRT609145 ZNF610 zinc finger protein 610 2 4
MIRT609206 GOSR2 golgi SNAP receptor complex member 2 2 4
MIRT609338 HRASLS5 HRAS like suppressor family member 5 2 2
MIRT609725 KIF5C kinesin family member 5C 2 4
MIRT610014 MED24 mediator complex subunit 24 2 4
MIRT610407 TMEM245 transmembrane protein 245 2 2
MIRT610559 NBPF14 NBPF member 14 2 2
MIRT611291 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT611399 ATP9A ATPase phospholipid transporting 9A (putative) 2 2
MIRT611432 C11orf45 chromosome 11 open reading frame 45 2 4
MIRT611710 SLFN13 schlafen family member 13 2 2
MIRT611721 ANK3 ankyrin 3 2 2
MIRT611830 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 4
MIRT611977 ZNF175 zinc finger protein 175 2 2
MIRT612073 CEP135 centrosomal protein 135 2 4
MIRT612195 CCDC77 coiled-coil domain containing 77 2 2
MIRT612320 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT612354 TNRC6C trinucleotide repeat containing 6C 2 4
MIRT612635 PTEN phosphatase and tensin homolog 2 2
MIRT612773 MLXIP MLX interacting protein 2 4
MIRT612788 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT612853 JAZF1 JAZF zinc finger 1 2 2
MIRT612965 GID4 GID complex subunit 4 homolog 2 6
MIRT613132 DUSP6 dual specificity phosphatase 6 2 2
MIRT613388 AAK1 AP2 associated kinase 1 2 2
MIRT615058 CRY2 cryptochrome circadian clock 2 2 4
MIRT616046 HSPA12B heat shock protein family A (Hsp70) member 12B 2 2
MIRT617962 SEPT9 septin 9 2 2
MIRT618413 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT622448 RNF213 ring finger protein 213 2 2
MIRT623611 IPCEF1 interaction protein for cytohesin exchange factors 1 2 2
MIRT625709 SHROOM1 shroom family member 1 2 2
MIRT630646 ELK1 ELK1, ETS transcription factor 2 2
MIRT630970 KIAA2022 neurite extension and migration factor 2 2
MIRT631003 SPAG7 sperm associated antigen 7 2 2
MIRT640385 EMC1 ER membrane protein complex subunit 1 2 4
MIRT641064 WBSCR17 polypeptide N-acetylgalactosaminyltransferase 17 2 2
MIRT641780 ZDHHC7 zinc finger DHHC-type containing 7 2 4
MIRT646310 MPHOSPH8 M-phase phosphoprotein 8 2 2
MIRT646624 CENPL centromere protein L 2 2
MIRT659653 CDH2 cadherin 2 2 2
MIRT666161 SP1 Sp1 transcription factor 2 2
MIRT667638 LHFPL2 LHFPL tetraspan subfamily member 2 2 2
MIRT668988 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT680949 PLCXD1 phosphatidylinositol specific phospholipase C X domain containing 1 2 2
MIRT695238 PBK PDZ binding kinase 2 2
MIRT700036 RPL22 ribosomal protein L22 2 2
MIRT707685 GPR50 G protein-coupled receptor 50 2 2
MIRT709324 HMBOX1 homeobox containing 1 2 2
MIRT710176 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT712007 F9 coagulation factor IX 2 2
MIRT714219 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT714496 HSPA4 heat shock protein family A (Hsp70) member 4 2 2
MIRT714575 GALNT10 polypeptide N-acetylgalactosaminyltransferase 10 2 2
MIRT715982 TFRC transferrin receptor 2 2
MIRT717870 TRAPPC3L trafficking protein particle complex 3 like 2 2
MIRT718289 MINA ribosomal oxygenase 2 2 2
MIRT725200 PTRF caveolae associated protein 1 2 2
MIRT737338 TPX2 TPX2, microtubule nucleation factor 3 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-216b Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-216b 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 up-regulated
miR-216b Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 up-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Microarray human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Hydroxycamptothecin (HCPT) NULL 97226 Quantitative real-time PCR human Tenon's fibroblasts (HTFs) 24681041 2014 down-regulated
miR-216b Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-216b Doxorubicin approved 31703 Quantitative real-time PCR heart 22859947 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-216b Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-216b Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-216b-3p Tripterygium wilfordii Hook F resistant tissue
hsa-miR-216b-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-216b-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)

Error report submission