miRTarBase - #MIRT531719


—
pre-miRNA Information
pre-miRNA hsa-mir-4653   
Genomic Coordinates chr7: 101159473 - 101159555
Description Homo sapiens miR-4653 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4653-5p
Sequence 10| UCUCUGAGCAAGGCUUAACACC |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs566953516 2 dbSNP
rs1307365749 4 dbSNP
rs1226652366 6 dbSNP
rs1216592229 12 dbSNP
rs1283699546 15 dbSNP
rs934609749 20 dbSNP
rs1377199291 21 dbSNP
rs1282994534 22 dbSNP
Putative Targets

Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B8DF7B miR-4653 Predictive Biomarker (PRD) Transcriptomic Data . . . .
Gene Information
Gene Symbol TARS   
Synonyms ThrRS
Description threonyl-tRNA synthetase
Transcript NM_152295   
Expression
Putative miRNA Targets on TARS
3'UTR of TARS
(miRNA target sites are highlighted)		 
>TARS|NM_152295|3'UTR
   1 TGAAAAAATTACCCAGATTGGCTCCATGGAAAAGGAGGAACAGCGTTTCCGTAAAATTGACTTTGTACTCTGAAAACGTC
  81 AATTTATATTGAACTTGGAGGAGTTTGGCAAAGTCTGAATAGGTCAACCTGCAGGCGTAACTATTTTTGACCTAGTCAGT
 161 TTTTAAACAATGTGCATTTGAAGGAGTTAATTAAAAGAGAGCCAATAAAATGATTTTACTCATTCAGTATCTGAGTACTG
 241 GAAGTGAAACATGAGGAATGCTTTAGTGTAATGTGGGAGAACTTTTTTGTAAATTTAATGCAATTGAAAAAGTTTTCAAA
 321 TTCAATTAAGATAACTAGAATTGGATTATGGTGTAAAAATAAAAAAAAAATTTATTCACATAAAAAAAAAAAAAAAAAAA
 401 AAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccaCAAUUCGG---AAC--GAGUCUCu 5'
             || || ::   |||  ||::||| 
Target 5' aacGTCAATTTATATTGAACTTGGAGg 3'
 75 - 101 117.00 -9.70
2 
miRNA  3' ccacAAUUCGGAAC--GAGUCUcu 5'
              ||:| |:|||  ||| ||  
Target 5' aaaaTTGA-CTTTGTACTCTGAaa 3'
 53 - 75 107.00 -6.00
3 
miRNA  3' ccacaAUUCGGAACGA-GUCUcu 5'
               ||:|:|   || |||:  
Target 5' ctgaaTAGGTCAACCTGCAGGcg 3'
 115 - 137 85.00 -7.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30168836 14 COSMIC
COSN31561341 30 COSMIC
COSN30193424 43 COSMIC
COSN31545541 59 COSMIC
COSN20049133 92 COSMIC
COSN18729996 117 COSMIC
COSN30599929 128 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs748046518 1 dbSNP
rs771610484 1 dbSNP
rs756132597 3 dbSNP
rs537943151 6 dbSNP
rs1240723043 9 dbSNP
rs1460828534 10 dbSNP
rs1353244069 11 dbSNP
rs774976354 14 dbSNP
rs367844736 18 dbSNP
rs762285810 22 dbSNP
rs1346534959 25 dbSNP
rs1464370209 30 dbSNP
rs765717810 33 dbSNP
rs1406538946 38 dbSNP
rs1454560339 40 dbSNP
rs1306927368 45 dbSNP
rs371022780 46 dbSNP
rs763338818 51 dbSNP
rs374414438 52 dbSNP
rs1478956850 61 dbSNP
rs1160427660 66 dbSNP
rs527754036 67 dbSNP
rs967992506 70 dbSNP
rs1417421632 77 dbSNP
rs16891192 78 dbSNP
rs1240826229 87 dbSNP
rs534477399 89 dbSNP
rs554479563 95 dbSNP
rs1210058630 111 dbSNP
rs1332133617 115 dbSNP
rs7261 117 dbSNP
rs536215882 120 dbSNP
rs1398842086 127 dbSNP
rs936440652 133 dbSNP
rs1233629486 136 dbSNP
rs184121387 137 dbSNP
rs776847736 138 dbSNP
rs1410631377 141 dbSNP
rs908317246 144 dbSNP
rs889454080 149 dbSNP
rs1007888893 159 dbSNP
rs1040709413 160 dbSNP
rs1334560183 161 dbSNP
rs1407280999 163 dbSNP
rs1438819870 165 dbSNP
rs897093508 171 dbSNP
rs754827792 173 dbSNP
rs1165966732 176 dbSNP
rs1463251212 177 dbSNP
rs1417787832 187 dbSNP
rs899374810 191 dbSNP
rs1027251109 194 dbSNP
rs1284402679 200 dbSNP
rs1045635421 206 dbSNP
rs952548375 208 dbSNP
rs905390634 215 dbSNP
rs1001626987 218 dbSNP
rs1251877297 227 dbSNP
rs1034393965 239 dbSNP
rs1213905297 245 dbSNP
rs1420157762 254 dbSNP
rs762450299 257 dbSNP
rs1453030812 259 dbSNP
rs1270616252 261 dbSNP
rs960106719 267 dbSNP
rs1003613899 269 dbSNP
rs377148597 271 dbSNP
rs187475798 278 dbSNP
rs558702444 286 dbSNP
rs1022332870 290 dbSNP
rs968055745 291 dbSNP
rs750551909 293 dbSNP
rs979009837 296 dbSNP
rs1194784287 299 dbSNP
rs926125570 304 dbSNP
rs1326724411 319 dbSNP
rs1438864706 326 dbSNP
rs1353048598 327 dbSNP
rs932114790 329 dbSNP
rs1328528141 330 dbSNP
rs574026857 332 dbSNP
rs1399206240 334 dbSNP
rs968360198 349 dbSNP
rs1490840077 356 dbSNP
rs113130518 361 dbSNP
rs955185396 361 dbSNP
rs975383745 361 dbSNP
rs571937064 362 dbSNP
rs908266750 364 dbSNP
rs540848257 372 dbSNP
rs1276560832 373 dbSNP
rs1208615019 376 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 6897.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccACAAUUCGGAACGAGUCUCu 5'
            || |  | ||| ||||||| 
Target 5' ggUGCU--GGCUU-CUCAGAGg 3'
 		6 - 24
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000265112.3 | 3UTR | AGCUGGGUGCUGGCUUCUCAGAGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
78 hsa-miR-4653-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT118186 ZNF544 zinc finger protein 544 2 2
MIRT332935 PRKAB2 protein kinase AMP-activated non-catalytic subunit beta 2 2 2
MIRT442166 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT442387 CLVS2 clavesin 2 2 2
MIRT442595 SIX1 SIX homeobox 1 2 2
MIRT448014 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT448061 MMP15 matrix metallopeptidase 15 2 2
MIRT489017 C1QTNF6 C1q and TNF related 6 2 2
MIRT494456 BTG2 BTG anti-proliferation factor 2 2 2
MIRT495650 SLC35B2 solute carrier family 35 member B2 2 2
MIRT504016 ACSL6 acyl-CoA synthetase long chain family member 6 2 2
MIRT506777 KLHL15 kelch like family member 15 2 4
MIRT507229 FOXN2 forkhead box N2 2 4
MIRT512550 MFN2 mitofusin 2 2 6
MIRT512842 A1CF APOBEC1 complementation factor 2 6
MIRT513944 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT516103 GADL1 glutamate decarboxylase like 1 2 4
MIRT519831 ZFP69B ZFP69 zinc finger protein B 2 4
MIRT523210 HIST1H3E histone cluster 1 H3 family member e 2 2
MIRT525008 ACTN4 actinin alpha 4 2 6
MIRT528858 PKP1 plakophilin 1 2 2
MIRT529062 ZNF675 zinc finger protein 675 2 2
MIRT531719 TARS threonyl-tRNA synthetase 2 2
MIRT534039 STK4 serine/threonine kinase 4 2 2
MIRT543848 APIP APAF1 interacting protein 2 2
MIRT545866 ZNF264 zinc finger protein 264 2 4
MIRT556037 MXD1 MAX dimerization protein 1 2 2
MIRT557081 HOXB3 homeobox B3 2 2
MIRT561345 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT562705 ZNF415 zinc finger protein 415 2 2
MIRT563223 ZNF286A zinc finger protein 286A 2 2
MIRT563860 ZNF616 zinc finger protein 616 2 4
MIRT563879 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT564652 ZNF487P zinc finger protein 487 1 1
MIRT566595 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT570878 ZFP1 ZFP1 zinc finger protein 2 2
MIRT573067 TRIB1 tribbles pseudokinase 1 2 2
MIRT573941 ZNF708 zinc finger protein 708 2 2
MIRT575966 Slfn5 schlafen 5 2 5
MIRT607293 CD300E CD300e molecule 2 4
MIRT608187 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609537 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT610152 PRMT8 protein arginine methyltransferase 8 2 4
MIRT611571 SLFN5 schlafen family member 5 2 7
MIRT613335 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT616560 ZNF512B zinc finger protein 512B 2 2
MIRT617240 SPATS2 spermatogenesis associated serine rich 2 2 2
MIRT618011 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT618478 IL17REL interleukin 17 receptor E like 2 2
MIRT619099 IFI44L interferon induced protein 44 like 2 2
MIRT622265 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT623080 NME6 NME/NM23 nucleoside diphosphate kinase 6 2 2
MIRT625621 LILRB2 leukocyte immunoglobulin like receptor B2 2 2
MIRT627844 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT630459 GMPS guanine monophosphate synthase 2 2
MIRT630524 BAZ2A bromodomain adjacent to zinc finger domain 2A 2 4
MIRT631502 TAF8 TATA-box binding protein associated factor 8 2 2
MIRT634537 MRPS17 mitochondrial ribosomal protein S17 2 2
MIRT638807 DCTN3 dynactin subunit 3 2 2
MIRT641303 SLAMF1 signaling lymphocytic activation molecule family member 1 2 2
MIRT648347 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT649705 ZNF175 zinc finger protein 175 2 2
MIRT652554 TLX1 T-cell leukemia homeobox 1 2 2
MIRT655564 P2RX7 purinergic receptor P2X 7 2 2
MIRT659065 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT660341 BCAT1 branched chain amino acid transaminase 1 2 2
MIRT664330 RAB8A RAB8A, member RAS oncogene family 2 2
MIRT688934 ATXN7L3B ataxin 7 like 3B 2 2
MIRT689971 ZNF185 zinc finger protein 185 with LIM domain 2 2
MIRT699514 SKIL SKI like proto-oncogene 2 2
MIRT699975 RREB1 ras responsive element binding protein 1 2 2
MIRT702676 IRS2 insulin receptor substrate 2 2 2
MIRT709357 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT709837 PAQR7 progestin and adipoQ receptor family member 7 2 2
MIRT718716 ANKRD18A ankyrin repeat domain 18A 2 2
MIRT718879 PDIA3 protein disulfide isomerase family A member 3 2 2
MIRT724105 TMEM199 transmembrane protein 199 2 2
MIRT724763 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Paclitaxel 36314 NSC125973 approved sensitive High Nasopharyngeal Cancer cell line (CNE-1)
hsa-mir-4653 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-4653-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)

Error report submission