miRTarBase - #MIRT531990


—
pre-miRNA Information
pre-miRNA hsa-mir-4457   
Genomic Coordinates chr5: 1309310 - 1309377
Description Homo sapiens miR-4457 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4457
Sequence 43| UCACAAGGUAUUGACUGGCGUA |64
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1031676297 8 dbSNP
rs1249861366 14 dbSNP
rs115769169 17 dbSNP
rs968846507 19 dbSNP
rs540870271 20 dbSNP
rs993130937 22 dbSNP
Putative Targets

Gene Information
Gene Symbol SLCO1B3   
Synonyms HBLRR, LST-2, LST-3TM13, LST3, OATP-8, OATP1B3, OATP8, SLC21A8
Description solute carrier organic anion transporter family member 1B3
Transcript NM_019844   
Expression
Putative miRNA Targets on SLCO1B3
3'UTR of SLCO1B3
(miRNA target sites are highlighted)		 
>SLCO1B3|NM_019844|3'UTR
   1 CATTGCATTGATTCATTAAGATGTTATTTTTGAGGTGTTCCTGGTCTTTCACTGACAATTCCAACATTCTTTACTTACAG
  81 TGGACCAATGGATAAGTCTATGCATCTATAATAAACTATAAAAAATGGGAGTACCCATGGTTAGGATATAGCTATGCCTT
 161 TATGGTTAAGATTAGAATATATGATCCATAAAAATTTAAAGTGAGAGGCATGGTTAGTGTGTGATACAATAAAAAGTAAT
 241 TGTTTGGTAGTTGTAACTGCTAATAAAACCAGTGACTAGAATATAAGGGAGGTAAAAAGGACAAGATAGATTAATAGCCT
 321 AAATAAAGAGAAAAGCCTGATGCCTTTAAAAAAAATGAAACACTTTGGATGTATTACTTAGGCCAAAATCTGGCCTGGAT
 401 TTATGCTATAATATATATTTTCATGTTAAGTTGTATATTTTTCAGAAATTATAAATATTATTAATTTAAAATTTGAATTT
 481 GTGTTTGACTAACAACCTCGATGGATCTTCTTCCAACCTCCCATTAAGATCCTGCAGAAGAAATAGAAATATTCAAATAT
 561 TGCAAGGTGTAATTGTGAGACAACTTATTATAATACGTGTTAAGTTTCTACTGGACCCATGGAAGTGGATTAAGAAAAAC
 641 CGACTTTAGCTTGAGAAAGCAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' augcgGUCAGUUAU-GGAACACu 5'
               :|| | ||: |:|| || 
Target 5' ggataTAG-CTATGCCTTTATGg 3'
 144 - 165 100.00 -7.80
2 
miRNA  3' augcggucaguuauggAACACu 5'
                          ||||| 
Target 5' atattgcaaggtgtaaTTGTGa 3'
 557 - 578 100.00 -9.30
3 
miRNA  3' augCGGUCAGUUAUGGAAcacu 5'
             |||   ::||:||||    
Target 5' aaaGCC---TGATGCCTTtaaa 3'
 332 - 350 96.00 -8.26
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
307916 9 ClinVar
307917 137 ClinVar
307918 220 ClinVar
307919 308 ClinVar
307920 340 ClinVar
307921 348 ClinVar
883836 363 ClinVar
307922 400 ClinVar
883837 438 ClinVar
883838 510 ClinVar
307923 541 ClinVar
307924 549 ClinVar
307925 561 ClinVar
307926 563 ClinVar
307927 611 ClinVar
307928 623 ClinVar
307929 628 ClinVar
880547 642 ClinVar
881963 643 ClinVar
COSN30528818 13 COSMIC
COSN30486915 15 COSMIC
COSN24849544 24 COSMIC
COSN30514138 24 COSMIC
COSN30112774 25 COSMIC
COSN30448027 41 COSMIC
COSN30522219 44 COSMIC
COSN30179778 45 COSMIC
COSN31493333 55 COSMIC
COSN31512424 55 COSMIC
COSN30475224 63 COSMIC
COSN30158560 66 COSMIC
COSN13384995 70 COSMIC
COSN30486237 73 COSMIC
COSN30477715 78 COSMIC
COSN31498490 88 COSMIC
COSN30156117 97 COSMIC
COSN30138911 126 COSMIC
COSN31554021 152 COSMIC
COSN27528056 228 COSMIC
COSN20109324 356 COSMIC
COSN29901179 472 COSMIC
COSN30438123 480 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs756051143 3 dbSNP
rs1184613416 8 dbSNP
rs1464263850 8 dbSNP
rs372418887 9 dbSNP
rs1248273345 11 dbSNP
rs1257072785 11 dbSNP
rs1484547300 11 dbSNP
rs1207616464 12 dbSNP
rs753744600 16 dbSNP
rs1326456687 19 dbSNP
rs754816901 21 dbSNP
rs1269631461 22 dbSNP
rs1422404707 25 dbSNP
rs1458417238 27 dbSNP
rs779239464 30 dbSNP
rs1227100178 31 dbSNP
rs748299846 33 dbSNP
rs376969190 35 dbSNP
rs777677238 36 dbSNP
rs747516576 37 dbSNP
rs953846251 38 dbSNP
rs777104935 41 dbSNP
rs1320911276 48 dbSNP
rs369766680 51 dbSNP
rs1397530319 59 dbSNP
rs1004052897 62 dbSNP
rs538738277 70 dbSNP
rs1015884449 74 dbSNP
rs1005768206 79 dbSNP
rs1344570714 84 dbSNP
rs1197891206 94 dbSNP
rs1161669905 100 dbSNP
rs970580375 101 dbSNP
rs926522870 104 dbSNP
rs959049095 105 dbSNP
rs989077078 106 dbSNP
rs1463169094 107 dbSNP
rs760564389 114 dbSNP
rs961549564 116 dbSNP
rs112861267 119 dbSNP
rs1186088841 122 dbSNP
rs915002605 123 dbSNP
rs1246793463 124 dbSNP
rs1322103335 125 dbSNP
rs945078156 126 dbSNP
rs766036895 137 dbSNP
rs1363147351 139 dbSNP
rs188100388 144 dbSNP
rs112931172 146 dbSNP
rs1382822978 150 dbSNP
rs1390357867 151 dbSNP
rs1475592747 151 dbSNP
rs552798414 158 dbSNP
rs927285525 163 dbSNP
rs1386189379 169 dbSNP
rs936035903 175 dbSNP
rs1448159474 176 dbSNP
rs924806652 187 dbSNP
rs1450524649 189 dbSNP
rs944170770 201 dbSNP
rs989408924 209 dbSNP
rs915164223 214 dbSNP
rs1460441852 219 dbSNP
rs886049139 220 dbSNP
rs1041339508 221 dbSNP
rs1298221119 225 dbSNP
rs759763921 229 dbSNP
rs900059177 233 dbSNP
rs932649930 236 dbSNP
rs1413728005 238 dbSNP
rs1291064000 241 dbSNP
rs1366614224 243 dbSNP
rs1356772627 246 dbSNP
rs1428197159 252 dbSNP
rs1048834923 263 dbSNP
rs1373009360 266 dbSNP
rs1168993826 270 dbSNP
rs568909978 273 dbSNP
rs537823550 277 dbSNP
rs1200580238 285 dbSNP
rs1480538377 293 dbSNP
rs569431797 296 dbSNP
rs1306263652 303 dbSNP
rs886049140 308 dbSNP
rs1483909136 311 dbSNP
rs1015667225 316 dbSNP
rs1344425941 318 dbSNP
rs145346893 319 dbSNP
rs575053126 337 dbSNP
rs191491660 340 dbSNP
rs1485549811 345 dbSNP
rs1208945074 348 dbSNP
rs397689574 348 dbSNP
rs1408456380 349 dbSNP
rs889456846 350 dbSNP
rs1352643509 353 dbSNP
rs1259906598 355 dbSNP
rs1330167979 356 dbSNP
rs1005654068 363 dbSNP
rs906399142 365 dbSNP
rs1003306947 372 dbSNP
rs1033570097 375 dbSNP
rs1473458095 380 dbSNP
rs1233193723 389 dbSNP
rs1186787705 390 dbSNP
rs1417547603 394 dbSNP
rs1017173712 397 dbSNP
rs886049141 400 dbSNP
rs1258157737 407 dbSNP
rs1205715159 425 dbSNP
rs897372503 425 dbSNP
rs1324369609 426 dbSNP
rs1267749077 445 dbSNP
rs959246020 452 dbSNP
rs1331690384 461 dbSNP
rs1280465826 462 dbSNP
rs865780175 472 dbSNP
rs994441433 484 dbSNP
rs1447725343 496 dbSNP
rs1024441558 497 dbSNP
rs1172463365 498 dbSNP
rs369234665 500 dbSNP
rs971566402 505 dbSNP
rs980177801 506 dbSNP
rs1458451534 507 dbSNP
rs554075376 510 dbSNP
rs957374384 518 dbSNP
rs1162483324 527 dbSNP
rs990582646 529 dbSNP
rs966393398 533 dbSNP
rs758379038 541 dbSNP
rs1184054941 545 dbSNP
rs117703648 549 dbSNP
rs886049142 561 dbSNP
rs545934577 563 dbSNP
rs1216763611 567 dbSNP
rs1207098304 570 dbSNP
rs147670653 573 dbSNP
rs921518334 576 dbSNP
rs1279044836 582 dbSNP
rs1347544594 589 dbSNP
rs933860126 591 dbSNP
rs764711410 597 dbSNP
rs932928383 598 dbSNP
rs889562500 600 dbSNP
rs751963988 611 dbSNP
rs1363869592 617 dbSNP
rs1215412607 619 dbSNP
rs1038422304 620 dbSNP
rs555196020 623 dbSNP
rs79132805 628 dbSNP
rs1024598614 642 dbSNP
rs77957556 643 dbSNP
rs1415622443 650 dbSNP
rs1164162582 652 dbSNP
rs377573287 660 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 28234.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' augcggucAGUUAUGGAACACu 5'
                  ||||  ||||||| 
Target 5' -------cUCAACCCCUUGUGg 3'
 		1 - 15
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000261196.2 | 3UTR | CUCAACCCCUUGUGGGAGGGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
83 hsa-miR-4457 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT098032 SOBP sine oculis binding protein homolog 2 2
MIRT202580 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 6
MIRT247137 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT349266 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT363756 EIF4EBP1 eukaryotic translation initiation factor 4E binding protein 1 2 2
MIRT443586 FAM84B family with sequence similarity 84 member B 2 2
MIRT452333 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453864 ZBTB40 zinc finger and BTB domain containing 40 2 4
MIRT471486 PDE4D phosphodiesterase 4D 2 4
MIRT476290 GMFB glia maturation factor beta 2 8
MIRT479897 CCDC117 coiled-coil domain containing 117 2 4
MIRT484251 ANK1 ankyrin 1 2 2
MIRT491473 TMEM214 transmembrane protein 214 2 2
MIRT493804 GAN gigaxonin 2 6
MIRT499252 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502271 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504651 RPL9 ribosomal protein L9 2 6
MIRT505211 UBN2 ubinuclein 2 2 8
MIRT508952 SNRPB small nuclear ribonucleoprotein polypeptides B and B1 2 4
MIRT512691 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT513320 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT513870 HOXA5 homeobox A5 2 2
MIRT517342 ZNF529 zinc finger protein 529 2 4
MIRT518947 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520867 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT528325 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT531990 SLCO1B3 solute carrier organic anion transporter family member 1B3 2 2
MIRT533298 USP46 ubiquitin specific peptidase 46 2 2
MIRT545257 TRIM36 tripartite motif containing 36 2 4
MIRT547038 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556103 MOAP1 modulator of apoptosis 1 2 2
MIRT558321 DR1 down-regulator of transcription 1 2 2
MIRT558521 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT560906 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT568448 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570586 OTUD7B OTU deubiquitinase 7B 2 2
MIRT572799 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573863 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT575058 P2ry1 purinergic receptor P2Y, G-protein coupled 1 2 5
MIRT609931 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610836 ZNF585A zinc finger protein 585A 2 4
MIRT611474 P2RY1 purinergic receptor P2Y1 2 7
MIRT613569 YY2 YY2 transcription factor 2 2
MIRT618626 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620606 SAP30 Sin3A associated protein 30 2 2
MIRT621017 CLSTN3 calsyntenin 3 2 4
MIRT635314 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635919 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT640598 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT641784 YWHAB tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein beta 2 4
MIRT644067 IQCE IQ motif containing E 2 2
MIRT648288 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT658085 FOXR2 forkhead box R2 2 2
MIRT659077 DEPTOR DEP domain containing MTOR interacting protein 2 2
MIRT665307 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665975 SYTL4 synaptotagmin like 4 2 2
MIRT666302 SLC25A25 solute carrier family 25 member 25 2 2
MIRT674906 RASSF9 Ras association domain family member 9 2 2
MIRT680086 THAP1 THAP domain containing 1 2 2
MIRT681488 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691244 DFNB59 pejvakin 2 2
MIRT692362 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693035 MB21D1 Mab-21 domain containing 1 2 2
MIRT693837 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT694479 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696070 ZNF264 zinc finger protein 264 2 2
MIRT696578 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696760 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697307 ZNF652 zinc finger protein 652 2 2
MIRT700152 RNF115 ring finger protein 115 2 2
MIRT701056 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701198 OTUD3 OTU deubiquitinase 3 2 2
MIRT701335 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT702656 ITGA3 integrin subunit alpha 3 2 2
MIRT703618 FBXO45 F-box protein 45 2 2
MIRT704673 CHTOP chromatin target of PRMT1 2 2
MIRT708894 ZNF780A zinc finger protein 780A 2 2
MIRT711620 DGKH diacylglycerol kinase eta 2 2
MIRT713745 TMEM81 transmembrane protein 81 2 2
MIRT719712 CD101 CD101 molecule 2 2
MIRT720294 DLGAP3 DLG associated protein 3 2 2
MIRT722606 CCDC152 coiled-coil domain containing 152 2 2
MIRT724566 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4457 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4457 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-4457 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission