miRTarBase - #MIRT532254


—
pre-miRNA Information
pre-miRNA hsa-mir-4680   
Genomic Coordinates chr10: 110898090 - 110898155
Description Homo sapiens miR-4680 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4680-5p
Sequence 5| AGAACUCUUGCAGUCUUAGAUGU |27
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1274530692 2 dbSNP
rs780271274 5 dbSNP
rs1461423681 7 dbSNP
rs749729920 8 dbSNP
rs1252920446 10 dbSNP
rs201739274 11 dbSNP
rs774971106 19 dbSNP
rs748132091 22 dbSNP
rs773643180 22 dbSNP
rs1235425484 23 dbSNP
Putative Targets

Gene Information
Gene Symbol TBPL2   
Synonyms TBP2, TRF3
Description TATA-box binding protein like 2
Transcript NM_199047   
Expression
Putative miRNA Targets on TBPL2
3'UTR of TBPL2
(miRNA target sites are highlighted)		 
>TBPL2|NM_199047|3'UTR
   1 GCATATCATTCAGCATCTCACATTATTCTGGTTTGAATATGTCCATAAGCCCAGCACAGAAACAGCTGGATTCTTCTACG
  81 TTTAATTGTAGATGTTACAAGTACGTTACTTATTAAAGGGCGACTCTGTGTAAGTAACCTAAGAAACGAAGAAAAATTCT
 161 TATTCAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uguAGAUUC----UGACGUUCU-CAAga 5'
             |||| |    |:||: ||| |||  
Target 5' tctTCTACGTTTAATTGT-AGATGTTac 3'
 72 - 98 105.00 -10.30
2 
miRNA  3' ugUAGAUUC--UGAC--GUUCUCAAGa 5'
            | |||||  || |   || | ||| 
Target 5' taACCTAAGAAAC-GAAGAAAAATTCt 3'
 135 - 160 92.00 -7.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30449675 7 COSMIC
COSN31554327 41 COSMIC
COSN30107053 52 COSMIC
COSN24995549 66 COSMIC
COSN31569524 73 COSMIC
COSN8588743 76 COSMIC
COSN31587242 80 COSMIC
COSN30142311 91 COSMIC
COSN30119324 104 COSMIC
COSN31562398 121 COSMIC
COSN30170176 126 COSMIC
COSN30625842 153 COSMIC
COSN20062369 159 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1463845554 2 dbSNP
rs781518621 4 dbSNP
rs1413002972 7 dbSNP
rs750034405 8 dbSNP
rs375095318 10 dbSNP
rs761276001 17 dbSNP
rs370912698 21 dbSNP
rs776189538 22 dbSNP
rs144681507 23 dbSNP
rs1315349652 26 dbSNP
rs760626068 28 dbSNP
rs1444843441 30 dbSNP
rs1386197692 32 dbSNP
rs887257120 37 dbSNP
rs775442523 39 dbSNP
rs771947543 40 dbSNP
rs1157227468 44 dbSNP
rs759869634 46 dbSNP
rs1389976468 48 dbSNP
rs375488795 49 dbSNP
rs774478131 50 dbSNP
rs373514285 51 dbSNP
rs757383289 57 dbSNP
rs1439139582 58 dbSNP
rs1025846898 66 dbSNP
rs892565228 67 dbSNP
rs1307001536 78 dbSNP
rs17128455 79 dbSNP
rs1385724441 80 dbSNP
rs79919449 86 dbSNP
rs570064213 98 dbSNP
rs548278685 100 dbSNP
rs1045030116 101 dbSNP
rs947948674 104 dbSNP
rs1330053637 105 dbSNP
rs774295086 105 dbSNP
rs1358936130 121 dbSNP
rs766118640 122 dbSNP
rs530441017 127 dbSNP
rs1339278986 132 dbSNP
rs1384138855 134 dbSNP
rs1227052311 138 dbSNP
rs878976857 139 dbSNP
rs1267869698 143 dbSNP
rs762740605 147 dbSNP
rs566215278 148 dbSNP
rs1440497119 149 dbSNP
rs934087557 156 dbSNP
rs1452193222 157 dbSNP
rs76994124 159 dbSNP
rs142452015 160 dbSNP
rs963990144 162 dbSNP
rs1371404612 163 dbSNP
rs976874018 164 dbSNP
rs1159873990 166 dbSNP
rs1421132383 167 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 387332.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uguagaUUCU-GACGUUCUCAAga 5'
                :|||  ||:  |||||  
Target 5' -----gGAGAGGUGUCUGAGUU-- 3'
 		1 - 17
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000247219.5 | 3UTR | GGAGAGGUGUCUGAGUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
133 hsa-miR-4680-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT378771 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT393867 ZDHHC21 zinc finger DHHC-type containing 21 2 4
MIRT446684 C2CD2 C2 calcium dependent domain containing 2 2 2
MIRT447600 MRPL3 mitochondrial ribosomal protein L3 2 2
MIRT450708 RNF152 ring finger protein 152 2 2
MIRT450784 PAPOLG poly(A) polymerase gamma 2 2
MIRT454623 COL23A1 collagen type XXIII alpha 1 chain 2 8
MIRT461620 PTCD3 pentatricopeptide repeat domain 3 2 2
MIRT462695 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT475530 HOXA3 homeobox A3 2 8
MIRT475739 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT489676 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT490610 SLC47A1 solute carrier family 47 member 1 2 2
MIRT493628 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT496152 RPS15A ribosomal protein S15a 2 2
MIRT499232 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT501496 PRICKLE2 prickle planar cell polarity protein 2 2 2
MIRT507163 GAS2L3 growth arrest specific 2 like 3 2 2
MIRT512389 MTRNR2L1 MT-RNR2-like 1 2 4
MIRT514626 MTRNR2L7 MT-RNR2-like 7 2 2
MIRT517474 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT525332 CNGB1 cyclic nucleotide gated channel beta 1 2 2
MIRT526685 BAK1 BCL2 antagonist/killer 1 2 2
MIRT527317 CCR2 C-C motif chemokine receptor 2 2 2
MIRT527608 EYS eyes shut homolog (Drosophila) 2 2
MIRT528794 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531048 TIPARP TCDD inducible poly(ADP-ribose) polymerase 2 2
MIRT532254 TBPL2 TATA-box binding protein like 2 2 2
MIRT533801 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT535887 MLEC malectin 2 2
MIRT540704 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT544645 PHF8 PHD finger protein 8 2 4
MIRT545760 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 2 2
MIRT555310 PPP2R5C protein phosphatase 2 regulatory subunit B'gamma 2 2
MIRT555877 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT559507 ARID5B AT-rich interaction domain 5B 2 2
MIRT560448 SLC30A7 solute carrier family 30 member 7 2 2
MIRT561262 ZIK1 zinc finger protein interacting with K protein 1 2 2
MIRT561795 PAWR pro-apoptotic WT1 regulator 2 2
MIRT567007 KLHL15 kelch like family member 15 2 2
MIRT569298 SURF6 surfeit 6 2 2
MIRT570606 MTRNR2L11 MT-RNR2-like 11 2 2
MIRT572888 ADCY2 adenylate cyclase 2 2 2
MIRT573119 ADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif 18 2 2
MIRT608332 ZNF670 zinc finger protein 670 2 6
MIRT614942 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT615324 ERN1 endoplasmic reticulum to nucleus signaling 1 2 2
MIRT618441 ZNF800 zinc finger protein 800 2 2
MIRT620110 HARBI1 harbinger transposase derived 1 2 2
MIRT626008 ZNF517 zinc finger protein 517 2 2
MIRT626626 SLC30A6 solute carrier family 30 member 6 2 2
MIRT627842 POU3F1 POU class 3 homeobox 1 2 2
MIRT628386 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT629305 PTPLAD2 3-hydroxyacyl-CoA dehydratase 4 1 1
MIRT629864 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT630444 IDE insulin degrading enzyme 2 2
MIRT631854 PIGG phosphatidylinositol glycan anchor biosynthesis class G 2 2
MIRT633173 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT633477 ZNF724P zinc finger protein 724 2 2
MIRT634395 PLSCR1 phospholipid scramblase 1 2 2
MIRT635538 TRIM72 tripartite motif containing 72 2 2
MIRT635821 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT636169 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636797 CYB5D1 cytochrome b5 domain containing 1 2 2
MIRT637952 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT645136 HES2 hes family bHLH transcription factor 2 2 2
MIRT645667 ADK adenosine kinase 2 2
MIRT646148 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT647004 NCR3LG1 natural killer cell cytotoxicity receptor 3 ligand 1 2 2
MIRT648187 C2orf68 chromosome 2 open reading frame 68 2 2
MIRT650090 TERF2 telomeric repeat binding factor 2 2 2
MIRT650329 RTN2 reticulon 2 2 2
MIRT654224 RNF165 ring finger protein 165 2 2
MIRT654545 RAB1A RAB1A, member RAS oncogene family 2 2
MIRT656457 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT656828 KLF8 Kruppel like factor 8 2 2
MIRT657112 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT657930 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT659375 CREG2 cellular repressor of E1A stimulated genes 2 2 2
MIRT659833 CARHSP1 calcium regulated heat stable protein 1 2 2
MIRT662108 LACTB lactamase beta 2 4
MIRT662789 TBC1D25 TBC1 domain family member 25 2 2
MIRT669501 ARL3 ADP ribosylation factor like GTPase 3 2 2
MIRT669759 ZNF101 zinc finger protein 101 2 4
MIRT669800 GAN gigaxonin 2 2
MIRT670050 RPP14 ribonuclease P/MRP subunit p14 2 2
MIRT670299 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670388 EMP2 epithelial membrane protein 2 2 2
MIRT672862 C22orf29 retrotransposon Gag like 10 2 2
MIRT672890 FXN frataxin 2 2
MIRT673210 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT674001 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT674163 BLOC1S3 biogenesis of lysosomal organelles complex 1 subunit 3 2 2
MIRT674502 TIRAP TIR domain containing adaptor protein 2 2
MIRT675470 NUBPL nucleotide binding protein like 2 2
MIRT675671 TMOD2 tropomodulin 2 2 2
MIRT676006 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT676074 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676386 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676764 SNX2 sorting nexin 2 2 2
MIRT676896 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT676978 ZNF708 zinc finger protein 708 2 2
MIRT677236 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677369 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT677464 PDLIM3 PDZ and LIM domain 3 2 2
MIRT678081 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678093 ATCAY ATCAY, caytaxin 2 2
MIRT678324 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678417 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678521 ZNF347 zinc finger protein 347 2 2
MIRT678700 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT678829 PDE6A phosphodiesterase 6A 2 2
MIRT679991 RUNDC1 RUN domain containing 1 2 2
MIRT680751 PSD4 pleckstrin and Sec7 domain containing 4 2 2
MIRT681249 ZNF383 zinc finger protein 383 2 2
MIRT681422 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT681948 SLC19A3 solute carrier family 19 member 3 2 2
MIRT689278 C5AR2 complement component 5a receptor 2 2 2
MIRT690389 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT691845 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT693863 IYD iodotyrosine deiodinase 2 2
MIRT696002 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT701930 MLLT1 MLLT1, super elongation complex subunit 2 2
MIRT702341 KLHL7 kelch like family member 7 2 2
MIRT703557 FKBP14 FK506 binding protein 14 2 2
MIRT705033 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT706341 STAC2 SH3 and cysteine rich domain 2 2 2
MIRT709671 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT711212 EFHB EF-hand domain family member B 2 2
MIRT718342 PURA purine rich element binding protein A 2 2
MIRT722755 SIRPB2 signal regulatory protein beta 2 2 2
MIRT723535 NFATC2IP nuclear factor of activated T-cells 2 interacting protein 2 2
MIRT724498 BFAR bifunctional apoptosis regulator 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4680-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission