pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-569 |
Genomic Coordinates | chr3: 171106664 - 171106759 |
Synonyms | MIRN569, hsa-mir-569, MIR569 |
Description | Homo sapiens miR-569 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Associated Diseases | ![]() |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-569 | |||||||||||||||
Sequence | 61| AGUUAAUGAAUCCUGGAAAGU |81 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | SAGE | DRVs in miRNA |
|
|||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | TXNL1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | HEL-S-114, TRP32, TXL-1, TXNL, Txl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | thioredoxin like 1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_004786 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on TXNL1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of TXNL1 (miRNA target sites are highlighted) |
>TXNL1|NM_004786|3'UTR 1 GGTACAAAAGACACTGGACAACCATATTGCAATCAGATCTACAGCTCCTGGATAATTGCTTGATTCTCGCCAGAGACTGT 81 CAATGTTTCATTCATTGCCATTACCAATAAATCATTGCTTTTGTTCAGATGGTATCACTAGTGTTTCCATTGTAATCTTG 161 ACACATGCAATTGTAAATAAAAGTCACCACTTTTGCCAAGCTTAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 9352.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000217515.6 | 3UTR | CAUUAACUGGUCUGUGAUGAUCUUA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
58 hsa-miR-569 Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT004827 | SPI1 | Spi-1 proto-oncogene | ![]() |
![]() |
2 | 1 | ||||||
MIRT086537 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT086545 | MOB4 | MOB family member 4, phocein | ![]() |
![]() |
2 | 2 | ||||||
MIRT154349 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 4 | ||||||
MIRT182174 | POU2F1 | POU class 2 homeobox 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT190452 | EIF5 | eukaryotic translation initiation factor 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT191410 | NAA30 | N(alpha)-acetyltransferase 30, NatC catalytic subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT199846 | CSNK1G2 | casein kinase 1 gamma 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT208376 | SLC25A36 | solute carrier family 25 member 36 | ![]() |
![]() |
2 | 2 | ||||||
MIRT275677 | CARKD | NAD(P)HX dehydratase | ![]() |
![]() |
2 | 2 | ||||||
MIRT275764 | TFDP1 | transcription factor Dp-1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT280470 | UBR7 | ubiquitin protein ligase E3 component n-recognin 7 (putative) | ![]() |
![]() |
2 | 2 | ||||||
MIRT296592 | FAM217B | family with sequence similarity 217 member B | ![]() |
![]() |
2 | 4 | ||||||
MIRT306847 | FYTTD1 | forty-two-three domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443764 | HLF | HLF, PAR bZIP transcription factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT448026 | GSR | glutathione-disulfide reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT448659 | NCALD | neurocalcin delta | ![]() |
![]() |
2 | 2 | ||||||
MIRT449142 | UQCRB | ubiquinol-cytochrome c reductase binding protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT449225 | RAD51B | RAD51 paralog B | ![]() |
![]() |
2 | 2 | ||||||
MIRT462421 | TWISTNB | TWIST neighbor | ![]() |
![]() |
2 | 2 | ||||||
MIRT468478 | SESN3 | sestrin 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT478170 | DENND5B | DENN domain containing 5B | ![]() |
![]() |
2 | 2 | ||||||
MIRT478577 | VSIG2 | V-set and immunoglobulin domain containing 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT481300 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | ![]() |
![]() |
2 | 16 | ||||||
MIRT485894 | ZFP36 | ZFP36 ring finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT497242 | FITM2 | fat storage inducing transmembrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500282 | ZNF703 | zinc finger protein 703 | ![]() |
![]() |
2 | 8 | ||||||
MIRT509536 | RSBN1L | round spermatid basic protein 1 like | ![]() |
![]() |
2 | 4 | ||||||
MIRT511835 | GPATCH8 | G-patch domain containing 8 | ![]() |
![]() |
2 | 4 | ||||||
MIRT522437 | MON1B | MON1 homolog B, secretory trafficking associated | ![]() |
![]() |
2 | 2 | ||||||
MIRT523538 | GLO1 | glyoxalase I | ![]() |
![]() |
2 | 4 | ||||||
MIRT527631 | MYBPC1 | myosin binding protein C, slow type | ![]() |
![]() |
2 | 4 | ||||||
MIRT528059 | OLAH | oleoyl-ACP hydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT532549 | TXNL1 | thioredoxin like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT545503 | NAP1L1 | nucleosome assembly protein 1 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546724 | RNF6 | ring finger protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT546737 | RNF141 | ring finger protein 141 | ![]() |
![]() |
2 | 2 | ||||||
MIRT550889 | ACTA1 | actin, alpha 1, skeletal muscle | ![]() |
![]() |
2 | 2 | ||||||
MIRT554180 | SLC35E2B | solute carrier family 35 member E2B | ![]() |
![]() |
2 | 2 | ||||||
MIRT555878 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558458 | DCUN1D1 | defective in cullin neddylation 1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT560375 | TIMM8A | translocase of inner mitochondrial membrane 8A | ![]() |
![]() |
2 | 2 | ||||||
MIRT562672 | AKT3 | AKT serine/threonine kinase 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT563810 | TUBA1B | tubulin alpha 1b | ![]() |
![]() |
2 | 2 | ||||||
MIRT564607 | ZNF711 | zinc finger protein 711 | ![]() |
![]() |
2 | 2 | ||||||
MIRT564881 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | ![]() |
![]() |
2 | 2 | ||||||
MIRT566724 | MSL2 | MSL complex subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566900 | CSRP3 | cysteine and glycine rich protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570002 | COL1A2 | collagen type I alpha 2 chain | ![]() |
![]() |
2 | 2 | ||||||
MIRT612300 | ZFP14 | ZFP14 zinc finger protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT618334 | ZNF813 | zinc finger protein 813 | ![]() |
![]() |
2 | 2 | ||||||
MIRT627658 | RSBN1 | round spermatid basic protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT630660 | PLAG1 | PLAG1 zinc finger | ![]() |
![]() |
2 | 2 | ||||||
MIRT640802 | MYCL1 | MYCL proto-oncogene, bHLH transcription factor | ![]() |
1 | 1 | |||||||
MIRT651370 | ZBTB21 | zinc finger and BTB domain containing 21 | ![]() |
![]() |
2 | 2 | ||||||
MIRT709227 | GPSM2 | G protein signaling modulator 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712058 | ZBTB34 | zinc finger and BTB domain containing 34 | ![]() |
![]() |
2 | 2 | ||||||
MIRT725006 | ZPBP | zona pellucida binding protein | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|