pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-3160-1 |
Genomic Coordinates | chr11: 46451805 - 46451889 |
Description | Homo sapiens miR-3160-1 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
pre-miRNA | hsa-mir-3160-2 |
Genomic Coordinates | chr11: 46451807 - 46451887 |
Description | Homo sapiens miR-3160-2 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | |||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-3160-3p | ||||||||||||||||||||||||||||||
Sequence | 54| AGAGCUGAGACUAGAAAGCCCA |75 | ||||||||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||||||||
Experiments | Illumina | DRVs in miRNA |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MTHFD1 | |||||||||||||||
Synonyms | MTHFC, MTHFD | |||||||||||||||
Description | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | |||||||||||||||
Transcript | NM_005956 | |||||||||||||||
Expression | ||||||||||||||||
Putative miRNA Targets on MTHFD1 | ||||||||||||||||
3'UTR of MTHFD1 (miRNA target sites are highlighted) |
>MTHFD1|NM_005956|3'UTR 1 ACAGATCACCATCCATCTTCAAGAAGCTACTTTGAAAGTCTGGCCAGTGTCTATTCAGGCCCACTGGGAGTTAGGAAGTA 81 TAAGTAAGCCAAGAGAAGTCAGCCCCTGCCCAGAAGATCTGAAACTAATAGTAGGAGTTTCCCCAGAAGTCATTTTCAGC 161 CTTAATTCTCATCATGTATAAATTAACATAAATCATGCATGTCTGTTTACTTTAGTGACGTTCCACAGAATAAAAGGAAA 241 CAAGTTTGCCATCAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
|||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
|||||||||||||||
DRVs in gene 3'UTRs | ||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 4522.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000216605.8 | 3UTR | ACGUGAUCUCAGCUCA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
118 hsa-miR-3160-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT066658 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT075318 | SF3B3 | splicing factor 3b subunit 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT077083 | EIF1 | eukaryotic translation initiation factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT100381 | HSPA1B | heat shock protein family A (Hsp70) member 1B | ![]() |
![]() |
2 | 6 | ||||||
MIRT135259 | TMBIM6 | transmembrane BAX inhibitor motif containing 6 | ![]() |
![]() |
2 | 4 | ||||||
MIRT184913 | ZNF268 | zinc finger protein 268 | ![]() |
![]() |
2 | 2 | ||||||
MIRT218862 | CDKN1A | cyclin dependent kinase inhibitor 1A | ![]() |
![]() |
2 | 2 | ||||||
MIRT446580 | FPR2 | formyl peptide receptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT448834 | FGD4 | FYVE, RhoGEF and PH domain containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT449455 | RNF13 | ring finger protein 13 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452284 | CARD8 | caspase recruitment domain family member 8 | ![]() |
![]() |
2 | 2 | ||||||
MIRT452628 | FAM162A | family with sequence similarity 162 member A | ![]() |
![]() |
2 | 2 | ||||||
MIRT453454 | GLG1 | golgi glycoprotein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454188 | AP1S3 | adaptor related protein complex 1 sigma 3 subunit | ![]() |
![]() |
2 | 6 | ||||||
MIRT454434 | GTF2F1 | general transcription factor IIF subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT454575 | NT5DC3 | 5'-nucleotidase domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455555 | TRAF1 | TNF receptor associated factor 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT455841 | MPL | MPL proto-oncogene, thrombopoietin receptor | ![]() |
![]() |
2 | 6 | ||||||
MIRT455969 | BCAS4 | breast carcinoma amplified sequence 4 | ![]() |
![]() |
2 | 4 | ||||||
MIRT456805 | SIGLEC14 | sialic acid binding Ig like lectin 14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457320 | DUSP19 | dual specificity phosphatase 19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457366 | POFUT2 | protein O-fucosyltransferase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT457684 | ZNF587 | zinc finger protein 587 | ![]() |
![]() |
2 | 2 | ||||||
MIRT458158 | LYRM4 | LYR motif containing 4 | ![]() |
![]() |
2 | 6 | ||||||
MIRT458641 | SGPP2 | sphingosine-1-phosphate phosphatase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459134 | FADS6 | fatty acid desaturase 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT459153 | NARF | nuclear prelamin A recognition factor | ![]() |
![]() |
2 | 4 | ||||||
MIRT460460 | NOM1 | nucleolar protein with MIF4G domain 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT460974 | STK17B | serine/threonine kinase 17b | ![]() |
![]() |
2 | 2 | ||||||
MIRT461439 | ACSBG1 | acyl-CoA synthetase bubblegum family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT461507 | NEDD4L | neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase | ![]() |
![]() |
2 | 2 | ||||||
MIRT462490 | GSR | glutathione-disulfide reductase | ![]() |
![]() |
2 | 2 | ||||||
MIRT462638 | PHF5A | PHD finger protein 5A | ![]() |
![]() |
2 | 2 | ||||||
MIRT463279 | ZFX | zinc finger protein, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT463360 | ZFAND4 | zinc finger AN1-type containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT465777 | TMOD3 | tropomodulin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466143 | TMEM120B | transmembrane protein 120B | ![]() |
![]() |
2 | 2 | ||||||
MIRT468401 | SETD3 | SET domain containing 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT468998 | RNPS1 | RNA binding protein with serine rich domain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT471574 | PARD6B | par-6 family cell polarity regulator beta | ![]() |
![]() |
2 | 2 | ||||||
MIRT472108 | NME2 | NME/NM23 nucleoside diphosphate kinase 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472125 | NME1-NME2 | NME1-NME2 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT473020 | MRPS14 | mitochondrial ribosomal protein S14 | ![]() |
![]() |
2 | 2 | ||||||
MIRT473083 | MORN4 | MORN repeat containing 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT475598 | HMGB2 | high mobility group box 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT475937 | GXYLT2 | glucoside xylosyltransferase 2 | ![]() |
![]() |
2 | 8 | ||||||
MIRT476117 | GPR157 | G protein-coupled receptor 157 | ![]() |
![]() |
2 | 2 | ||||||
MIRT476406 | GDE1 | glycerophosphodiester phosphodiesterase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT478003 | DNAL1 | dynein axonemal light chain 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT487969 | IQSEC2 | IQ motif and Sec7 domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT489418 | TUBB2A | tubulin beta 2A class IIa | ![]() |
![]() |
2 | 2 | ||||||
MIRT491522 | IL10RA | interleukin 10 receptor subunit alpha | ![]() |
![]() |
2 | 2 | ||||||
MIRT492673 | PLEC | plectin | ![]() |
![]() |
2 | 2 | ||||||
MIRT493545 | ICOSLG | inducible T-cell costimulator ligand | ![]() |
![]() |
2 | 2 | ||||||
MIRT513085 | USP9X | ubiquitin specific peptidase 9, X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT514009 | CECR2 | CECR2, histone acetyl-lysine reader | ![]() |
![]() |
2 | 4 | ||||||
MIRT516683 | ZNF860 | zinc finger protein 860 | ![]() |
![]() |
2 | 2 | ||||||
MIRT518392 | ZNF250 | zinc finger protein 250 | ![]() |
![]() |
2 | 2 | ||||||
MIRT522683 | LUZP1 | leucine zipper protein 1 | ![]() |
![]() |
2 | 6 | ||||||
MIRT524488 | CEP97 | centrosomal protein 97 | ![]() |
![]() |
2 | 2 | ||||||
MIRT527457 | CLEC12B | C-type lectin domain family 12 member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT527705 | IL17REL | interleukin 17 receptor E like | ![]() |
![]() |
2 | 2 | ||||||
MIRT531647 | C19orf52 | translocase of inner mitochondrial membrane 29 | ![]() |
![]() |
2 | 2 | ||||||
MIRT532381 | UMPS | uridine monophosphate synthetase | ![]() |
![]() |
2 | 2 | ||||||
MIRT532588 | MTHFD1 | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533555 | TPM4 | tropomyosin 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT548371 | ENTPD5 | ectonucleoside triphosphate diphosphohydrolase 5 | ![]() |
![]() |
2 | 4 | ||||||
MIRT550250 | PVR | poliovirus receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT552555 | ZFP36L2 | ZFP36 ring finger protein like 2 | ![]() |
![]() |
2 | 4 | ||||||
MIRT554113 | SMARCE1 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT554131 | SMARCA5 | SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561344 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT561638 | RUNX3 | runt related transcription factor 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT566497 | PBX2P1 | PBX homeobox 2 pseudogene 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT570583 | OTUD7B | OTU deubiquitinase 7B | ![]() |
![]() |
2 | 2 | ||||||
MIRT572731 | MCTS1 | MCTS1, re-initiation and release factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT574041 | PEX26 | peroxisomal biogenesis factor 26 | ![]() |
![]() |
2 | 2 | ||||||
MIRT575231 | Fut1 | fucosyltransferase 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT606811 | BICD2 | BICD cargo adaptor 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT621016 | CLSTN3 | calsyntenin 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT637852 | PDCL3 | phosducin like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT640477 | ZNF557 | zinc finger protein 557 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642827 | LINC00346 | long intergenic non-protein coding RNA 346 | ![]() |
![]() |
2 | 2 | ||||||
MIRT643887 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | ![]() |
![]() |
2 | 2 | ||||||
MIRT664874 | PCNXL2 | pecanex homolog 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680528 | PRIM2 | DNA primase subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680648 | KIAA1456 | KIAA1456 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680807 | ZNF578 | zinc finger protein 578 | ![]() |
![]() |
2 | 2 | ||||||
MIRT680921 | STX2 | syntaxin 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681112 | CEP57L1 | centrosomal protein 57 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681147 | INTS7 | integrator complex subunit 7 | ![]() |
![]() |
2 | 2 | ||||||
MIRT681966 | TFCP2 | transcription factor CP2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684316 | GTF3C4 | general transcription factor IIIC subunit 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT684906 | GSG2 | histone H3 associated protein kinase | ![]() |
![]() |
2 | 2 | ||||||
MIRT685499 | MED16 | mediator complex subunit 16 | ![]() |
![]() |
2 | 2 | ||||||
MIRT685929 | MOCS3 | molybdenum cofactor synthesis 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT686875 | SLC25A32 | solute carrier family 25 member 32 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688204 | FNIP1 | folliculin interacting protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT688791 | CCNB1 | cyclin B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT689227 | RPS19 | ribosomal protein S19 | ![]() |
![]() |
2 | 2 | ||||||
MIRT690470 | ZNF33A | zinc finger protein 33A | ![]() |
![]() |
2 | 2 | ||||||
MIRT691982 | PLCXD1 | phosphatidylinositol specific phospholipase C X domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694006 | PPIL4 | peptidylprolyl isomerase like 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT694529 | TRIM72 | tripartite motif containing 72 | ![]() |
![]() |
2 | 2 | ||||||
MIRT695420 | ADH5 | alcohol dehydrogenase 5 (class III), chi polypeptide | ![]() |
![]() |
2 | 2 | ||||||
MIRT695784 | HSD17B12 | hydroxysteroid 17-beta dehydrogenase 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT697799 | UBXN2A | UBX domain protein 2A | ![]() |
![]() |
2 | 2 | ||||||
MIRT698275 | TMEM2 | transmembrane protein 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT698317 | TMEM136 | transmembrane protein 136 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699971 | RREB1 | ras responsive element binding protein 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700717 | PNO1 | partner of NOB1 homolog | ![]() |
![]() |
2 | 2 | ||||||
MIRT701721 | MTMR12 | myotubularin related protein 12 | ![]() |
![]() |
2 | 2 | ||||||
MIRT701879 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT702959 | HIF1A | hypoxia inducible factor 1 alpha subunit | ![]() |
![]() |
2 | 2 | ||||||
MIRT706178 | ZNF716 | zinc finger protein 716 | ![]() |
![]() |
2 | 2 | ||||||
MIRT706463 | SPRED1 | sprouty related EVH1 domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718154 | TTC33 | tetratricopeptide repeat domain 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT718711 | ANKRD18A | ankyrin repeat domain 18A | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|