miRTarBase - #MIRT532694


—
pre-miRNA Information
pre-miRNA hsa-mir-5590   
Genomic Coordinates chr2: 134857820 - 134857873
Description Homo sapiens miR-5590 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5590-5p
Sequence 1| UUGCCAUACAUAGACUUUAUU |21
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs553031425 1 dbSNP
rs1255264134 4 dbSNP
rs1205476379 9 dbSNP
rs1387316331 10 dbSNP
rs1031241138 11 dbSNP
rs1465409255 12 dbSNP
rs1227248415 18 dbSNP
rs1334861447 19 dbSNP
Putative Targets

Gene Information
Gene Symbol TCN2   
Synonyms D22S676, D22S750, II, TC, TC II, TC-2, TC2, TCII
Description transcobalamin 2
Transcript NM_000355   
Other Transcripts NM_001184726   
Expression
Putative miRNA Targets on TCN2
3'UTR of TCN2
(miRNA target sites are highlighted)		 
>TCN2|NM_000355|3'UTR
   1 CCCCTGAGCTCCCTCATCCCAGCAGCCTCGCACACTCCCTAGGCTTCTACCCTCCCTCCTGATGTCCCTGGAACAGGAAC
  81 TCGCCTGACCCTGCTGCCACCTCCTGTGCACTTTGAGCAATGCCCCCTGGGATCACCCCAGCCACAAGCCCTTCGAGGGC
 161 CCTATACCATGGCCCACCTTGGAGCAGAGAGCCAAGCATCTTCCCTGGGAAGTCTTTCTGGCCAAGTCTGGCCAGCCTGG
 241 CCCTGCAGGTCTCCCATGAAGGCCACCCCATGGTCTGATGGGCATGAAGCATCTCAGACTCCTTGGCAAAAAACGGAGTC
 321 CGCAGGCCGCAGGTGTTGTGAAGACCACTCGTTCTGTGGTTGGGGTCCTGCAAGAAGGCCTCCTCAGCCCGGGGGCTATG
 401 GCCCTGACCCCAGCTCTCCACTCTGCTGTTAGAGTGGCAGCTCCGAGCTGGTTGTGGCACAGTAGCTGGGGAGACCTCAG
 481 CAGGGCTGCTCAGTGCCTGCCTCTGACAAAATTAAAGCATTGATGGCCTGTGGACCTGCAAAAAAAAAAAAAAAAAAAAA
 561 AAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuauUUCAGAUACAUACCGUu 5'
              :|| ||:  |:||||| 
Target 5' ctccGAG-CTGGTTGTGGCAc 3'
 441 - 460 132.00 -9.20
2 
miRNA  3' uuauuucagauacAUACCGuu 5'
                       ||||||  
Target 5' tcagcccgggggcTATGGCcc 3'
 384 - 404 120.00 -8.80
3 
miRNA  3' uuAUUUCAGAUACAUACCGuu 5'
            ||||| | ||  |||||  
Target 5' atTAAAG-C-ATTGATGGCct 3'
 511 - 529 109.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
903099 19 ClinVar
341216 30 ClinVar
899473 38 ClinVar
341217 83 ClinVar
341218 94 ClinVar
341219 128 ClinVar
899474 174 ClinVar
341220 210 ClinVar
341221 226 ClinVar
900608 284 ClinVar
341222 301 ClinVar
341223 308 ClinVar
900609 330 ClinVar
341224 382 ClinVar
341225 383 ClinVar
900610 384 ClinVar
900611 406 ClinVar
900612 416 ClinVar
341226 445 ClinVar
902291 521 ClinVar
COSN26435513 3 COSMIC
COSN26998152 14 COSMIC
COSN30486846 19 COSMIC
COSN30534240 22 COSMIC
COSN30499853 30 COSMIC
COSN30180692 31 COSMIC
COSN31501985 59 COSMIC
COSN18843751 131 COSMIC
COSN20093991 155 COSMIC
COSN20117365 314 COSMIC
COSN25590007 323 COSMIC
COSN10029469 498 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1261702072 1 dbSNP
rs765234343 4 dbSNP
rs1441612133 5 dbSNP
rs762921572 5 dbSNP
rs9609023 9 dbSNP
rs752904961 12 dbSNP
rs542831784 14 dbSNP
rs758569183 15 dbSNP
rs371703966 19 dbSNP
rs1174709032 20 dbSNP
rs767300914 21 dbSNP
rs1244210879 22 dbSNP
rs757089476 23 dbSNP
rs1355090129 25 dbSNP
rs375001872 28 dbSNP
rs190828416 30 dbSNP
rs779447189 31 dbSNP
rs1445925540 33 dbSNP
rs1185637749 34 dbSNP
rs531866634 38 dbSNP
rs953846920 39 dbSNP
rs377671686 40 dbSNP
rs774093080 41 dbSNP
rs1279990075 49 dbSNP
rs1384336358 51 dbSNP
rs1024118413 52 dbSNP
rs1318919849 55 dbSNP
rs968065882 57 dbSNP
rs1294885757 59 dbSNP
rs370900093 60 dbSNP
rs759986135 67 dbSNP
rs551706126 70 dbSNP
rs1314644791 75 dbSNP
rs564065214 80 dbSNP
rs12169610 83 dbSNP
rs1374776371 83 dbSNP
rs931021693 84 dbSNP
rs1385676834 85 dbSNP
rs1157963410 88 dbSNP
rs1303320035 90 dbSNP
rs1419460451 92 dbSNP
rs1188064834 93 dbSNP
rs886057398 94 dbSNP
rs1256113125 96 dbSNP
rs956608022 99 dbSNP
rs975957937 101 dbSNP
rs1310409387 103 dbSNP
rs753307631 105 dbSNP
rs1327149627 107 dbSNP
rs1049294912 110 dbSNP
rs1234009662 112 dbSNP
rs1316656714 112 dbSNP
rs1310546841 115 dbSNP
rs1213942733 119 dbSNP
rs1385482627 121 dbSNP
rs905474582 122 dbSNP
rs1455267214 123 dbSNP
rs1396230769 126 dbSNP
rs1488849183 127 dbSNP
rs12160073 128 dbSNP
rs1251124385 131 dbSNP
rs1368378623 132 dbSNP
rs1186099815 133 dbSNP
rs1430660282 136 dbSNP
rs963030185 136 dbSNP
rs1441440590 145 dbSNP
rs1188330545 151 dbSNP
rs931780420 152 dbSNP
rs1179069763 153 dbSNP
rs867646396 156 dbSNP
rs1214374970 160 dbSNP
rs764279003 163 dbSNP
rs1263602128 168 dbSNP
rs1229593998 169 dbSNP
rs1326965680 172 dbSNP
rs896653059 174 dbSNP
rs184018052 178 dbSNP
rs908936936 188 dbSNP
rs1009615156 193 dbSNP
rs1372665512 200 dbSNP
rs1326233591 205 dbSNP
rs536284359 206 dbSNP
rs1021088704 207 dbSNP
rs146450057 210 dbSNP
rs549184880 213 dbSNP
rs1463930163 214 dbSNP
rs1374174669 215 dbSNP
rs1448097177 217 dbSNP
rs897448445 223 dbSNP
rs930229273 224 dbSNP
rs2072195 226 dbSNP
rs1451092758 227 dbSNP
rs1265282893 229 dbSNP
rs896672068 234 dbSNP
rs1339953045 235 dbSNP
rs1273861340 238 dbSNP
rs1225879933 245 dbSNP
rs987135596 247 dbSNP
rs1303686729 249 dbSNP
rs1323293811 251 dbSNP
rs1012812216 256 dbSNP
rs1329011667 258 dbSNP
rs781394351 268 dbSNP
rs1392967797 269 dbSNP
rs1449688780 270 dbSNP
rs1332574047 283 dbSNP
rs538133033 284 dbSNP
rs1000908376 285 dbSNP
rs1031011000 290 dbSNP
rs558084644 291 dbSNP
rs1315182251 300 dbSNP
rs187942607 301 dbSNP
rs1032 303 dbSNP
rs533953034 304 dbSNP
rs1438517281 305 dbSNP
rs1271320118 308 dbSNP
rs397940476 314 dbSNP
rs1486522830 315 dbSNP
rs139540214 316 dbSNP
rs1218435559 317 dbSNP
rs1342374446 320 dbSNP
rs926973068 320 dbSNP
rs372961947 322 dbSNP
rs1030639072 323 dbSNP
rs1408471708 326 dbSNP
rs1377802242 328 dbSNP
rs953260904 329 dbSNP
rs779850312 330 dbSNP
rs986355779 333 dbSNP
rs1042482497 337 dbSNP
rs1470551118 343 dbSNP
rs1411403426 345 dbSNP
rs574027391 351 dbSNP
rs1476110097 352 dbSNP
rs941779132 355 dbSNP
rs1209134640 360 dbSNP
rs971746826 361 dbSNP
rs918929775 365 dbSNP
rs1440522853 369 dbSNP
rs1285903781 379 dbSNP
rs1183375680 381 dbSNP
rs149713328 382 dbSNP
rs56076607 383 dbSNP
rs896720175 384 dbSNP
rs535143735 388 dbSNP
rs948282571 391 dbSNP
rs545256921 392 dbSNP
rs1320523250 396 dbSNP
rs565454899 399 dbSNP
rs1008109185 402 dbSNP
rs532913665 405 dbSNP
rs539828054 406 dbSNP
rs1354456071 408 dbSNP
rs1181273328 410 dbSNP
rs1440533830 410 dbSNP
rs961230505 413 dbSNP
rs1000958871 414 dbSNP
rs560130628 416 dbSNP
rs1214994776 417 dbSNP
rs528989934 419 dbSNP
rs1334964054 424 dbSNP
rs1291214036 427 dbSNP
rs1380215084 428 dbSNP
rs1228315231 430 dbSNP
rs1354881149 431 dbSNP
rs1272227229 432 dbSNP
rs1436321331 433 dbSNP
rs1364699961 439 dbSNP
rs10418 445 dbSNP
rs952435317 446 dbSNP
rs1403470463 450 dbSNP
rs1421604246 452 dbSNP
rs1291617971 455 dbSNP
rs892489910 461 dbSNP
rs1320116161 467 dbSNP
rs979826716 469 dbSNP
rs749682701 489 dbSNP
rs1468528255 497 dbSNP
rs771785781 498 dbSNP
rs926920412 501 dbSNP
rs1320406799 502 dbSNP
rs773013305 504 dbSNP
rs1030276303 518 dbSNP
rs1229554818 520 dbSNP
rs953408654 521 dbSNP
rs1295654402 528 dbSNP
rs1236695505 530 dbSNP
rs1368578511 531 dbSNP
rs569024523 536 dbSNP
rs1434428309 537 dbSNP
rs918191273 541 dbSNP
rs148893618 542 dbSNP
rs1308602575 543 dbSNP
rs1237870366 544 dbSNP
rs963145950 550 dbSNP
rs1175301577 554 dbSNP
rs1485193654 555 dbSNP
rs1433346703 570 dbSNP
rs1185363123 572 dbSNP
rs1424072436 572 dbSNP
rs1328375596 581 dbSNP
rs1481350178 581 dbSNP
rs1264798982 586 dbSNP
rs551615871 588 dbSNP
rs1483020821 591 dbSNP
rs1272848144 594 dbSNP
rs1213506971 598 dbSNP
rs1312941643 599 dbSNP
rs904036813 600 dbSNP
rs1217519269 603 dbSNP
rs1375707180 604 dbSNP
rs571472809 605 dbSNP
rs918990333 606 dbSNP
rs1368639545 608 dbSNP
rs534122554 613 dbSNP
rs1466382643 614 dbSNP
rs959764375 626 dbSNP
rs1173597932 631 dbSNP
rs1419483309 635 dbSNP
rs759969826 636 dbSNP
rs374988949 637 dbSNP
rs548508538 638 dbSNP
rs771331627 641 dbSNP
rs948308164 650 dbSNP
rs1311300415 654 dbSNP
rs1342609290 656 dbSNP
rs1255626116 662 dbSNP
rs994057590 665 dbSNP
rs1045287491 667 dbSNP
rs952548628 670 dbSNP
rs1295110661 673 dbSNP
rs1269652036 679 dbSNP
rs879410258 683 dbSNP
rs1544468 684 dbSNP
rs1300875091 685 dbSNP
rs1454958990 686 dbSNP
rs1388959500 687 dbSNP
rs555328218 691 dbSNP
rs1157710008 692 dbSNP
rs1359832551 696 dbSNP
rs1410356616 698 dbSNP
rs1034547507 701 dbSNP
rs1424748531 704 dbSNP
rs764537177 707 dbSNP
rs751568649 709 dbSNP
rs1346889052 710 dbSNP
rs912915633 712 dbSNP
rs992926185 712 dbSNP
rs1287783865 721 dbSNP
rs757340384 723 dbSNP
rs1208165178 726 dbSNP
rs536301535 729 dbSNP
rs556250301 730 dbSNP
rs978347626 732 dbSNP
rs892540555 733 dbSNP
rs1245349190 734 dbSNP
rs1321049383 735 dbSNP
rs997560139 737 dbSNP
rs1052196024 740 dbSNP
rs889081044 741 dbSNP
rs147015527 744 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6948.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 6948.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000215838.3 | 3UTR | CAAAACUCCAUCUCUACUAAAAAUACAAAAAUUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000215838.3 | 3UTR | CAAAACUCCAUCUCUACUAAAAAUACAAAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-5590-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056313 WAC WW domain containing adaptor with coiled-coil 2 6
MIRT066181 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT095612 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT099166 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT107578 VLDLR very low density lipoprotein receptor 2 2
MIRT179602 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 8
MIRT241303 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT244620 MCM4 minichromosome maintenance complex component 4 2 2
MIRT270705 SBNO1 strawberry notch homolog 1 2 4
MIRT453616 SNRPE small nuclear ribonucleoprotein polypeptide E 2 4
MIRT453653 RAB6C RAB6C, member RAS oncogene family 2 2
MIRT464159 VMP1 vacuole membrane protein 1 2 15
MIRT477720 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 2 2
MIRT484301 ENDOD1 endonuclease domain containing 1 2 4
MIRT496069 GLCCI1 glucocorticoid induced 1 2 2
MIRT496338 TMEM81 transmembrane protein 81 2 2
MIRT496653 PITPNM3 PITPNM family member 3 2 2
MIRT499098 DENND4C DENN domain containing 4C 2 8
MIRT499862 SVOP SV2 related protein 2 12
MIRT504913 CD38 CD38 molecule 2 4
MIRT515401 WDR72 WD repeat domain 72 2 4
MIRT518156 TMEM133 transmembrane protein 133 2 2
MIRT518558 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT518636 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT518724 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT524301 CTC1 CST telomere replication complex component 1 2 4
MIRT524472 CHRM3 cholinergic receptor muscarinic 3 2 4
MIRT527562 ADCY7 adenylate cyclase 7 2 2
MIRT532694 TCN2 transcobalamin 2 2 4
MIRT534640 RNF6 ring finger protein 6 2 2
MIRT537163 GGCX gamma-glutamyl carboxylase 2 2
MIRT539360 AFF4 AF4/FMR2 family member 4 2 2
MIRT547023 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT548155 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT550127 ZNF138 zinc finger protein 138 2 2
MIRT558473 DBN1 drebrin 1 2 2
MIRT566862 LRRC58 leucine rich repeat containing 58 2 2
MIRT567246 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT572848 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT574914 Vmp1 vacuole membrane protein 1 2 9
MIRT606849 RAB7A RAB7A, member RAS oncogene family 2 2
MIRT611274 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT612328 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT612415 SP1 Sp1 transcription factor 2 2
MIRT614791 RRAGC Ras related GTP binding C 2 2
MIRT618449 SERPINA3 serpin family A member 3 2 2
MIRT621154 MICALCL MICAL C-terminal like 2 2
MIRT622141 SOX4 SRY-box 4 2 2
MIRT623504 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT623598 IPO9 importin 9 2 2
MIRT624075 EBF1 early B-cell factor 1 2 2
MIRT639792 MVK mevalonate kinase 2 2
MIRT641109 ZNF274 zinc finger protein 274 2 2
MIRT641579 RFX1 regulatory factor X1 2 2
MIRT643095 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT645141 CUBN cubilin 2 2
MIRT646461 PRDM10 PR/SET domain 10 2 2
MIRT650815 HMOX1 heme oxygenase 1 2 2
MIRT653073 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2 2
MIRT657675 GPR26 G protein-coupled receptor 26 2 2
MIRT665824 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT695592 TMEM199 transmembrane protein 199 2 2
MIRT698039 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT701015 PCGF5 polycomb group ring finger 5 2 2
MIRT701357 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT707114 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT718661 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT719901 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT720564 C1RL complement C1r subcomponent like 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5590-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission