miRTarBase - #MIRT533139


—
pre-miRNA Information
pre-miRNA hsa-mir-1231   
Genomic Coordinates chr1: 201808611 - 201808702
Synonyms MIRN1231, hsa-mir-1231, MIR1231
Description Homo sapiens miR-1231 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-1231
Sequence 5| GUGUCUGGGCGGACAGCUGC |24
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN25212119 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs768024461 3 dbSNP
rs116338160 9 dbSNP
rs112032363 10 dbSNP
rs544709517 11 dbSNP
Putative Targets

Gene Information
Gene Symbol WNT10A   
Synonyms OODD, SSPS, STHAG4
Description Wnt family member 10A
Transcript NM_025216   
Expression
Putative miRNA Targets on WNT10A
3'UTR of WNT10A
(miRNA target sites are highlighted)		 
>WNT10A|NM_025216|3'UTR
   1 GCGGCCCGGGGTCCCCTGGGCCCTGATCGAGGTCCCCTCCTGGAGCCTGGCCCTCTGAGGCTTACGGTCTTGGCAAGGCA
  81 GCATCGCCTTGGCTCTTGGGAAGAGGAGATTGGACCACATGATCTTATAGGAACCCCTCAGCTCTGAGGTCTGTGATCGC
 161 CGGACAGTCCAGGCCTGTCTGAACCCCACCACTCACTTCTGTGGGCTCTAGGACTGACTGGGTTCTTCCTCCCTCCCCGA
 241 AGCCCAGACAGTTCAGTTGGGCTGGGGGTTGCTCCACACCCTAAAACAAGCCTCAGCCAGGCAACCCGTCAGTCTGTCTC
 321 CATCCTTTCACCCCTTCCCTGGAGATGGGAGGTGGGGAATGAATGGAAGCTGACGGGCAGAGAGAGGAGGATTAAAAAAA
 401 AGAAATAGACATAACTGAGCTGAAGTAATTCCATAAAGGGCCCAGACAGCCTCCTCCACCATTCCCTTCATCATTCATTT
 481 AACAAATATTTATTTTGCACTCTCTTTGCGGCACTCTGGGGGCGGTGGGGTGCGTGGGGGTGGCAATGCAAGGCACTGAG
 561 GCCACAGATGTGAGTAAGCGAGACACAACACTTGTCCTCTTGGAGGTTACATTCTTGCTGGGGGGAGGCATGGGCAATAA
 641 ACAAGTAAATATACAAAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cgucGACAGG---CGGGUCUGUg 5'
              ||  ||   ||||||||| 
Target 5' ctccCTCCCCGAAGCCCAGACAg 3'
 229 - 251 152.00 -17.30
2 
miRNA  3' cgucgacaggCGGGUCUGUg 5'
                    ||||||||| 
Target 5' tccataaaggGCCCAGACAg 3'
 430 - 449 150.00 -15.80
3 
miRNA  3' cgucGACA--GGCGGGUCUGUg 5'
              ||||  :|| ||:|||| 
Target 5' aggtCTGTGATCG-CCGGACAg 3'
 147 - 167 137.00 -16.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
334416 16 ClinVar
334417 109 ClinVar
334418 116 ClinVar
334419 129 ClinVar
896531 140 ClinVar
334420 217 ClinVar
898152 239 ClinVar
334421 276 ClinVar
898153 340 ClinVar
334422 432 ClinVar
334423 442 ClinVar
COSN25444837 490 COSMIC
COSN9874294 496 COSMIC
COSN29872443 554 COSMIC
COSN15351925 635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455199549 3 dbSNP
rs758910410 4 dbSNP
rs1385259515 5 dbSNP
rs1413647127 8 dbSNP
rs538939718 9 dbSNP
rs1360751323 11 dbSNP
rs886055645 16 dbSNP
rs1287664794 17 dbSNP
rs1349880411 20 dbSNP
rs951810914 21 dbSNP
rs942569840 22 dbSNP
rs1226689369 23 dbSNP
rs974286327 26 dbSNP
rs1351648447 27 dbSNP
rs747500221 36 dbSNP
rs929873887 37 dbSNP
rs1373843245 40 dbSNP
rs1276937573 41 dbSNP
rs1486889307 43 dbSNP
rs1328987129 46 dbSNP
rs1212147084 52 dbSNP
rs372266337 66 dbSNP
rs1199948897 67 dbSNP
rs548597599 85 dbSNP
rs1269146419 87 dbSNP
rs1431129556 98 dbSNP
rs1172842734 103 dbSNP
rs1046796175 107 dbSNP
rs190527122 109 dbSNP
rs1396821223 110 dbSNP
rs927137827 115 dbSNP
rs886055646 116 dbSNP
rs1231302296 117 dbSNP
rs1206679424 119 dbSNP
rs1483544743 120 dbSNP
rs937148442 124 dbSNP
rs1054630 129 dbSNP
rs1359228445 137 dbSNP
rs1302612850 138 dbSNP
rs1419603125 142 dbSNP
rs1223763469 145 dbSNP
rs894186878 158 dbSNP
rs1371765948 189 dbSNP
rs755171539 205 dbSNP
rs1443720567 206 dbSNP
rs1370101622 207 dbSNP
rs1370797489 208 dbSNP
rs552325173 217 dbSNP
rs1041725289 230 dbSNP
rs781764094 232 dbSNP
rs774329279 233 dbSNP
rs999724590 236 dbSNP
rs1176499706 239 dbSNP
rs570627699 253 dbSNP
rs1031181831 258 dbSNP
rs944308245 268 dbSNP
rs1039935318 269 dbSNP
rs182186187 276 dbSNP
rs748708833 285 dbSNP
rs987184507 291 dbSNP
rs900002308 292 dbSNP
rs1486763683 298 dbSNP
rs1018374829 300 dbSNP
rs553337539 312 dbSNP
rs1256991758 313 dbSNP
rs536406767 315 dbSNP
rs1215509695 317 dbSNP
rs973971582 325 dbSNP
rs574740587 332 dbSNP
rs1229705044 333 dbSNP
rs1223085900 339 dbSNP
rs535783596 343 dbSNP
rs887557747 347 dbSNP
rs1303281402 348 dbSNP
rs1452774065 352 dbSNP
rs557279615 371 dbSNP
rs575536603 376 dbSNP
rs1457854772 392 dbSNP
rs546040301 402 dbSNP
rs11549437 403 dbSNP
rs1190392948 407 dbSNP
rs759463877 407 dbSNP
rs929759211 411 dbSNP
rs1257103148 412 dbSNP
rs1186307773 413 dbSNP
rs1485057426 429 dbSNP
rs77272502 432 dbSNP
rs1209855873 433 dbSNP
rs1334746575 441 dbSNP
rs886055647 442 dbSNP
rs928512302 444 dbSNP
rs1272038259 450 dbSNP
rs572980386 457 dbSNP
rs971028885 473 dbSNP
rs1323202264 474 dbSNP
rs1312917896 477 dbSNP
rs539901092 485 dbSNP
rs879165853 496 dbSNP
rs981356465 498 dbSNP
rs1034234679 501 dbSNP
rs958862779 503 dbSNP
rs938373524 510 dbSNP
rs1055854056 511 dbSNP
rs1162945023 512 dbSNP
rs1463024293 524 dbSNP
rs879514562 535 dbSNP
rs947122730 540 dbSNP
rs1169965861 543 dbSNP
rs977449203 556 dbSNP
rs1422160300 559 dbSNP
rs1189581857 570 dbSNP
rs1043906403 580 dbSNP
rs944002667 581 dbSNP
rs904038138 586 dbSNP
rs1352110649 598 dbSNP
rs999611724 612 dbSNP
rs1052656499 615 dbSNP
rs1489138067 615 dbSNP
rs1040368521 620 dbSNP
rs1293272089 622 dbSNP
rs891344962 627 dbSNP
rs900117052 629 dbSNP
rs931556303 631 dbSNP
rs1008258409 634 dbSNP
rs1401368714 638 dbSNP
rs1323731221 643 dbSNP
rs1388623850 646 dbSNP
rs1048584376 647 dbSNP
rs887243112 653 dbSNP
rs1018687507 655 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 80326.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgucgacaggCGGGUCUGUg 5'
                    ||||||||| 
Target 5' ----------GCCCAGACAg 3'
 		1 - 10
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000258411.3 | 3UTR | GCCCAGACAGUUCAGUUGGGCUGGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.655 2.6e-4 -0.631 4.7e-4 24 Click to see details
GSE28260 Renal cortex and medulla -0.804 4.6e-4 -0.764 1.2e-3 13 Click to see details
GSE19350 CNS germ cell tumors 0.667 8.9e-3 0.558 3.0e-2 12 Click to see details
GSE32688 Pancreatic cancer -0.326 3.4e-2 -0.013 4.7e-1 32 Click to see details
GSE42095 Differentiated embryonic stem cells -0.219 1.6e-1 -0.214 1.6e-1 23 Click to see details
GSE21687 Ependynoma primary tumors -0.126 1.6e-1 -0.230 3.4e-2 64 Click to see details
GSE38226 Liver fibrosis -0.184 2.1e-1 0.382 4.4e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells -0.111 3.0e-1 -0.065 3.8e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.029 4.5e-1 0.065 3.8e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.027 4.6e-1 0.350 6.5e-2 20 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.027 4.6e-1 0.350 6.5e-2 20 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
37 hsa-miR-1231 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT075228 PHF13 PHD finger protein 13 2 6
MIRT266936 HDGF heparin binding growth factor 2 6
MIRT441394 SOX5 SRY-box 5 2 2
MIRT446329 ATP5C1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 2 2
MIRT446438 THYN1 thymocyte nuclear protein 1 2 2
MIRT482781 STIM1 stromal interaction molecule 1 2 2
MIRT497714 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT500907 STARD13 StAR related lipid transfer domain containing 13 2 2
MIRT503251 KIF18B kinesin family member 18B 2 2
MIRT504750 TEP1 telomerase associated protein 1 2 4
MIRT512158 CD164 CD164 molecule 2 6
MIRT518043 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 4
MIRT526038 GMDS GDP-mannose 4,6-dehydratase 2 2
MIRT529828 ARGFX arginine-fifty homeobox 2 2
MIRT531808 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT533139 WNT10A Wnt family member 10A 2 2
MIRT538612 CCT5 chaperonin containing TCP1 subunit 5 2 4
MIRT555617 PHLPP2 PH domain and leucine rich repeat protein phosphatase 2 2 2
MIRT561705 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT562301 GINM1 glycoprotein integral membrane 1 2 2
MIRT566732 MSH6 mutS homolog 6 2 2
MIRT569369 IMPG1 interphotoreceptor matrix proteoglycan 1 2 2
MIRT572314 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT574602 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT612023 FOXF2 forkhead box F2 2 2
MIRT616950 MAPKAPK2 mitogen-activated protein kinase-activated protein kinase 2 2 2
MIRT624175 DERL2 derlin 2 2 2
MIRT647634 FAIM2 Fas apoptotic inhibitory molecule 2 2 2
MIRT659393 CORO2A coronin 2A 2 2
MIRT659955 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT684001 FOLR1 folate receptor 1 2 2
MIRT688143 GABPB1 GA binding protein transcription factor beta subunit 1 2 2
MIRT688609 CYBRD1 cytochrome b reductase 1 2 2
MIRT693583 SLC39A1 solute carrier family 39 member 1 2 2
MIRT699922 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT712961 PET117 PET117 homolog 2 2
MIRT723950 TMEM184A transmembrane protein 184A 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved sensitive High Lung Adenocarcinoma cell line (A549)
hsa-miR-1231 Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-1231 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1231 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved sensitive High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-miR-1231 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-1231 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-mir-1231 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-mir-1231 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (KYSE)
hsa-mir-1231 Fluorouracil 3385 NSC19893 approved sensitive cell line (KYSE)
hsa-mir-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-1231 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved resistant cell line (HS578T)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-1231 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-1231 Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-1231 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-1231 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-1231 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved sensitive cell line (H460)
hsa-miR-1231 Cisplatin 5460033 NSC119875 approved resistant cell line (OVCAR3)

Error report submission