miRTarBase - #MIRT533143


—
pre-miRNA Information
pre-miRNA hsa-mir-378g   
Genomic Coordinates chr1: 94745860 - 94745900
Description Homo sapiens miR-378g stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-378g
Sequence 2| ACUGGGCUUGGAGUCAGAAG |21
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WNT10A   
Synonyms OODD, SSPS, STHAG4
Description Wnt family member 10A
Transcript NM_025216   
Expression
Putative miRNA Targets on WNT10A
3'UTR of WNT10A
(miRNA target sites are highlighted)		 
>WNT10A|NM_025216|3'UTR
   1 GCGGCCCGGGGTCCCCTGGGCCCTGATCGAGGTCCCCTCCTGGAGCCTGGCCCTCTGAGGCTTACGGTCTTGGCAAGGCA
  81 GCATCGCCTTGGCTCTTGGGAAGAGGAGATTGGACCACATGATCTTATAGGAACCCCTCAGCTCTGAGGTCTGTGATCGC
 161 CGGACAGTCCAGGCCTGTCTGAACCCCACCACTCACTTCTGTGGGCTCTAGGACTGACTGGGTTCTTCCTCCCTCCCCGA
 241 AGCCCAGACAGTTCAGTTGGGCTGGGGGTTGCTCCACACCCTAAAACAAGCCTCAGCCAGGCAACCCGTCAGTCTGTCTC
 321 CATCCTTTCACCCCTTCCCTGGAGATGGGAGGTGGGGAATGAATGGAAGCTGACGGGCAGAGAGAGGAGGATTAAAAAAA
 401 AGAAATAGACATAACTGAGCTGAAGTAATTCCATAAAGGGCCCAGACAGCCTCCTCCACCATTCCCTTCATCATTCATTT
 481 AACAAATATTTATTTTGCACTCTCTTTGCGGCACTCTGGGGGCGGTGGGGTGCGTGGGGGTGGCAATGCAAGGCACTGAG
 561 GCCACAGATGTGAGTAAGCGAGACACAACACTTGTCCTCTTGGAGGTTACATTCTTGCTGGGGGGAGGCATGGGCAATAA
 641 ACAAGTAAATATACAAAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gaaGACUGAGG---UUCGGGUCa 5'
             ||  ||||   |||||||| 
Target 5' ttcCTCCCTCCCCGAAGCCCAGa 3'
 226 - 248 157.00 -17.70
2 
miRNA  3' gaagACUGAGGU-----UCGGGUCa 5'
              | |:||||     :|||||| 
Target 5' gaagTAATTCCATAAAGGGCCCAGa 3'
 422 - 446 136.00 -15.50
3 
miRNA  3' gaAGACU-GAGGU---UCGGGUCa 5'
            | ||| | ||:   ||:|||| 
Target 5' tcTGTGATCGCCGGACAGTCCAGg 3'
 150 - 173 134.00 -15.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
334416 16 ClinVar
334417 109 ClinVar
334418 116 ClinVar
334419 129 ClinVar
896531 140 ClinVar
334420 217 ClinVar
898152 239 ClinVar
334421 276 ClinVar
898153 340 ClinVar
334422 432 ClinVar
334423 442 ClinVar
COSN25444837 490 COSMIC
COSN9874294 496 COSMIC
COSN29872443 554 COSMIC
COSN15351925 635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455199549 3 dbSNP
rs758910410 4 dbSNP
rs1385259515 5 dbSNP
rs1413647127 8 dbSNP
rs538939718 9 dbSNP
rs1360751323 11 dbSNP
rs886055645 16 dbSNP
rs1287664794 17 dbSNP
rs1349880411 20 dbSNP
rs951810914 21 dbSNP
rs942569840 22 dbSNP
rs1226689369 23 dbSNP
rs974286327 26 dbSNP
rs1351648447 27 dbSNP
rs747500221 36 dbSNP
rs929873887 37 dbSNP
rs1373843245 40 dbSNP
rs1276937573 41 dbSNP
rs1486889307 43 dbSNP
rs1328987129 46 dbSNP
rs1212147084 52 dbSNP
rs372266337 66 dbSNP
rs1199948897 67 dbSNP
rs548597599 85 dbSNP
rs1269146419 87 dbSNP
rs1431129556 98 dbSNP
rs1172842734 103 dbSNP
rs1046796175 107 dbSNP
rs190527122 109 dbSNP
rs1396821223 110 dbSNP
rs927137827 115 dbSNP
rs886055646 116 dbSNP
rs1231302296 117 dbSNP
rs1206679424 119 dbSNP
rs1483544743 120 dbSNP
rs937148442 124 dbSNP
rs1054630 129 dbSNP
rs1359228445 137 dbSNP
rs1302612850 138 dbSNP
rs1419603125 142 dbSNP
rs1223763469 145 dbSNP
rs894186878 158 dbSNP
rs1371765948 189 dbSNP
rs755171539 205 dbSNP
rs1443720567 206 dbSNP
rs1370101622 207 dbSNP
rs1370797489 208 dbSNP
rs552325173 217 dbSNP
rs1041725289 230 dbSNP
rs781764094 232 dbSNP
rs774329279 233 dbSNP
rs999724590 236 dbSNP
rs1176499706 239 dbSNP
rs570627699 253 dbSNP
rs1031181831 258 dbSNP
rs944308245 268 dbSNP
rs1039935318 269 dbSNP
rs182186187 276 dbSNP
rs748708833 285 dbSNP
rs987184507 291 dbSNP
rs900002308 292 dbSNP
rs1486763683 298 dbSNP
rs1018374829 300 dbSNP
rs553337539 312 dbSNP
rs1256991758 313 dbSNP
rs536406767 315 dbSNP
rs1215509695 317 dbSNP
rs973971582 325 dbSNP
rs574740587 332 dbSNP
rs1229705044 333 dbSNP
rs1223085900 339 dbSNP
rs535783596 343 dbSNP
rs887557747 347 dbSNP
rs1303281402 348 dbSNP
rs1452774065 352 dbSNP
rs557279615 371 dbSNP
rs575536603 376 dbSNP
rs1457854772 392 dbSNP
rs546040301 402 dbSNP
rs11549437 403 dbSNP
rs1190392948 407 dbSNP
rs759463877 407 dbSNP
rs929759211 411 dbSNP
rs1257103148 412 dbSNP
rs1186307773 413 dbSNP
rs1485057426 429 dbSNP
rs77272502 432 dbSNP
rs1209855873 433 dbSNP
rs1334746575 441 dbSNP
rs886055647 442 dbSNP
rs928512302 444 dbSNP
rs1272038259 450 dbSNP
rs572980386 457 dbSNP
rs971028885 473 dbSNP
rs1323202264 474 dbSNP
rs1312917896 477 dbSNP
rs539901092 485 dbSNP
rs879165853 496 dbSNP
rs981356465 498 dbSNP
rs1034234679 501 dbSNP
rs958862779 503 dbSNP
rs938373524 510 dbSNP
rs1055854056 511 dbSNP
rs1162945023 512 dbSNP
rs1463024293 524 dbSNP
rs879514562 535 dbSNP
rs947122730 540 dbSNP
rs1169965861 543 dbSNP
rs977449203 556 dbSNP
rs1422160300 559 dbSNP
rs1189581857 570 dbSNP
rs1043906403 580 dbSNP
rs944002667 581 dbSNP
rs904038138 586 dbSNP
rs1352110649 598 dbSNP
rs999611724 612 dbSNP
rs1052656499 615 dbSNP
rs1489138067 615 dbSNP
rs1040368521 620 dbSNP
rs1293272089 622 dbSNP
rs891344962 627 dbSNP
rs900117052 629 dbSNP
rs931556303 631 dbSNP
rs1008258409 634 dbSNP
rs1401368714 638 dbSNP
rs1323731221 643 dbSNP
rs1388623850 646 dbSNP
rs1048584376 647 dbSNP
rs887243112 653 dbSNP
rs1018687507 655 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 80326.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gaagacugagguuCGGGUCa 5'
                       |||||| 
Target 5' -------------GCCCAGa 3'
 		1 - 7
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000258411.3 | 3UTR | GCCCAGACAGUUCAGUUGGGCUGGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
68 hsa-miR-378g Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT444739 SMYD1 SET and MYND domain containing 1 2 2
MIRT456104 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT458683 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT465802 TMEM91 transmembrane protein 91 2 2
MIRT470843 PLXND1 plexin D1 2 2
MIRT497263 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497674 SYNGR1 synaptogyrin 1 2 2
MIRT498218 TLN2 talin 2 2 2
MIRT498309 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504046 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT518196 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT533143 WNT10A Wnt family member 10A 2 2
MIRT533540 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533679 TMEM86A transmembrane protein 86A 2 2
MIRT540892 SRSF9 serine and arginine rich splicing factor 9 2 2
MIRT541329 G3BP1 G3BP stress granule assembly factor 1 2 2
MIRT541850 PLIN5 perilipin 5 2 2
MIRT551431 F2 coagulation factor II, thrombin 2 2
MIRT552105 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564912 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568605 ACVR2A activin A receptor type 2A 2 2
MIRT572604 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574234 DMRT2 doublesex and mab-3 related transcription factor 2 2 2
MIRT575688 Map1b microtubule-associated protein 1B 2 2
MIRT576643 Mill2 MHC I like leukocyte 2 1 1
MIRT609877 RAD54L2 RAD54 like 2 2 4
MIRT610057 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610791 KLK2 kallikrein related peptidase 2 2 2
MIRT617175 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT617707 RUSC2 RUN and SH3 domain containing 2 2 2
MIRT620577 WBSCR27 methyltransferase like 27 2 4
MIRT622657 POU2F3 POU class 2 homeobox 3 2 4
MIRT624561 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT634255 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT634677 GDE1 glycerophosphodiester phosphodiesterase 1 2 2
MIRT635254 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637081 SELPLG selectin P ligand 2 2
MIRT639021 AAK1 AP2 associated kinase 1 2 2
MIRT640396 ZNF785 zinc finger protein 785 2 2
MIRT642441 CLUAP1 clusterin associated protein 1 2 2
MIRT645666 ADK adenosine kinase 2 2
MIRT646083 MGST3 microsomal glutathione S-transferase 3 2 2
MIRT650513 UFM1 ubiquitin fold modifier 1 2 2
MIRT652474 TMEM181 transmembrane protein 181 2 2
MIRT652584 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654763 PRKAR2A protein kinase cAMP-dependent type II regulatory subunit alpha 2 2
MIRT655200 PHAX phosphorylated adaptor for RNA export 2 2
MIRT658353 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661820 PRPSAP1 phosphoribosyl pyrophosphate synthetase associated protein 1 2 2
MIRT662190 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT664375 CYB5A cytochrome b5 type A 2 2
MIRT665025 ELK1 ELK1, ETS transcription factor 2 2
MIRT666492 SBNO1 strawberry notch homolog 1 2 2
MIRT668480 EXOSC2 exosome component 2 2 2
MIRT682768 TMEM120B transmembrane protein 120B 2 2
MIRT689628 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT691846 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT696490 COX6B1 cytochrome c oxidase subunit 6B1 2 2
MIRT712480 FSTL3 follistatin like 3 2 2
MIRT712780 ZNF154 zinc finger protein 154 2 2
MIRT716607 MPPED1 metallophosphoesterase domain containing 1 2 2
MIRT719357 ITPKB inositol-trisphosphate 3-kinase B 2 2
MIRT719739 SLC39A11 solute carrier family 39 member 11 2 2
MIRT722569 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722838 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT733138 LINC00963 long intergenic non-protein coding RNA 963 3 0
MIRT733139 CHI3L1 chitinase 3 like 1 3 0
MIRT736944 TARBP2 TARBP2, RISC loading complex RNA binding subunit 2 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-378g Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (500nM)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (2uM)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-378g Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib + Trametinib sensitive High Melanoma cell line
hsa-miR-378g Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line
hsa-mir-378g Decitabine 451668 approved sensitive tissue (esopheageal cancer)
hsa-miR-378g Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-378g Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-378g Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-378g Tripterygium wilfordii Hook F resistant tissue
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM36)
hsa-miR-378g Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-378g Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-378g Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-378g Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR3)
hsa-miR-378g Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission