miRTarBase - #MIRT533144


—
pre-miRNA Information
pre-miRNA hsa-mir-4486   
Genomic Coordinates chr11: 19575310 - 19575372
Description Homo sapiens miR-4486 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4486
Sequence 5| GCUGGGCGAGGCUGGCA |21
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs774299284 8 dbSNP
rs902172817 14 dbSNP
rs1222795726 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WNT10A   
Synonyms OODD, SSPS, STHAG4
Description Wnt family member 10A
Transcript NM_025216   
Expression
Putative miRNA Targets on WNT10A
3'UTR of WNT10A
(miRNA target sites are highlighted)		 
>WNT10A|NM_025216|3'UTR
   1 GCGGCCCGGGGTCCCCTGGGCCCTGATCGAGGTCCCCTCCTGGAGCCTGGCCCTCTGAGGCTTACGGTCTTGGCAAGGCA
  81 GCATCGCCTTGGCTCTTGGGAAGAGGAGATTGGACCACATGATCTTATAGGAACCCCTCAGCTCTGAGGTCTGTGATCGC
 161 CGGACAGTCCAGGCCTGTCTGAACCCCACCACTCACTTCTGTGGGCTCTAGGACTGACTGGGTTCTTCCTCCCTCCCCGA
 241 AGCCCAGACAGTTCAGTTGGGCTGGGGGTTGCTCCACACCCTAAAACAAGCCTCAGCCAGGCAACCCGTCAGTCTGTCTC
 321 CATCCTTTCACCCCTTCCCTGGAGATGGGAGGTGGGGAATGAATGGAAGCTGACGGGCAGAGAGAGGAGGATTAAAAAAA
 401 AGAAATAGACATAACTGAGCTGAAGTAATTCCATAAAGGGCCCAGACAGCCTCCTCCACCATTCCCTTCATCATTCATTT
 481 AACAAATATTTATTTTGCACTCTCTTTGCGGCACTCTGGGGGCGGTGGGGTGCGTGGGGGTGGCAATGCAAGGCACTGAG
 561 GCCACAGATGTGAGTAAGCGAGACACAACACTTGTCCTCTTGGAGGTTACATTCTTGCTGGGGGGAGGCATGGGCAATAA
 641 ACAAGTAAATATACAAAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' acggucggagCGGGUCg 5'
                    |||||| 
Target 5' cctccccgaaGCCCAGa 3'
 232 - 248 120.00 -14.60
2 
miRNA  3' acggucggagCGGGUCg 5'
                    |||||| 
Target 5' tccataaaggGCCCAGa 3'
 430 - 446 120.00 -12.60
3 
miRNA  3' acgGUCGGAGCGGGUCg 5'
             |||| |||||: | 
Target 5' aggCAGCATCGCCTTGg 3'
 76 - 92 114.00 -15.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
334416 16 ClinVar
334417 109 ClinVar
334418 116 ClinVar
334419 129 ClinVar
896531 140 ClinVar
334420 217 ClinVar
898152 239 ClinVar
334421 276 ClinVar
898153 340 ClinVar
334422 432 ClinVar
334423 442 ClinVar
COSN25444837 490 COSMIC
COSN9874294 496 COSMIC
COSN29872443 554 COSMIC
COSN15351925 635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455199549 3 dbSNP
rs758910410 4 dbSNP
rs1385259515 5 dbSNP
rs1413647127 8 dbSNP
rs538939718 9 dbSNP
rs1360751323 11 dbSNP
rs886055645 16 dbSNP
rs1287664794 17 dbSNP
rs1349880411 20 dbSNP
rs951810914 21 dbSNP
rs942569840 22 dbSNP
rs1226689369 23 dbSNP
rs974286327 26 dbSNP
rs1351648447 27 dbSNP
rs747500221 36 dbSNP
rs929873887 37 dbSNP
rs1373843245 40 dbSNP
rs1276937573 41 dbSNP
rs1486889307 43 dbSNP
rs1328987129 46 dbSNP
rs1212147084 52 dbSNP
rs372266337 66 dbSNP
rs1199948897 67 dbSNP
rs548597599 85 dbSNP
rs1269146419 87 dbSNP
rs1431129556 98 dbSNP
rs1172842734 103 dbSNP
rs1046796175 107 dbSNP
rs190527122 109 dbSNP
rs1396821223 110 dbSNP
rs927137827 115 dbSNP
rs886055646 116 dbSNP
rs1231302296 117 dbSNP
rs1206679424 119 dbSNP
rs1483544743 120 dbSNP
rs937148442 124 dbSNP
rs1054630 129 dbSNP
rs1359228445 137 dbSNP
rs1302612850 138 dbSNP
rs1419603125 142 dbSNP
rs1223763469 145 dbSNP
rs894186878 158 dbSNP
rs1371765948 189 dbSNP
rs755171539 205 dbSNP
rs1443720567 206 dbSNP
rs1370101622 207 dbSNP
rs1370797489 208 dbSNP
rs552325173 217 dbSNP
rs1041725289 230 dbSNP
rs781764094 232 dbSNP
rs774329279 233 dbSNP
rs999724590 236 dbSNP
rs1176499706 239 dbSNP
rs570627699 253 dbSNP
rs1031181831 258 dbSNP
rs944308245 268 dbSNP
rs1039935318 269 dbSNP
rs182186187 276 dbSNP
rs748708833 285 dbSNP
rs987184507 291 dbSNP
rs900002308 292 dbSNP
rs1486763683 298 dbSNP
rs1018374829 300 dbSNP
rs553337539 312 dbSNP
rs1256991758 313 dbSNP
rs536406767 315 dbSNP
rs1215509695 317 dbSNP
rs973971582 325 dbSNP
rs574740587 332 dbSNP
rs1229705044 333 dbSNP
rs1223085900 339 dbSNP
rs535783596 343 dbSNP
rs887557747 347 dbSNP
rs1303281402 348 dbSNP
rs1452774065 352 dbSNP
rs557279615 371 dbSNP
rs575536603 376 dbSNP
rs1457854772 392 dbSNP
rs546040301 402 dbSNP
rs11549437 403 dbSNP
rs1190392948 407 dbSNP
rs759463877 407 dbSNP
rs929759211 411 dbSNP
rs1257103148 412 dbSNP
rs1186307773 413 dbSNP
rs1485057426 429 dbSNP
rs77272502 432 dbSNP
rs1209855873 433 dbSNP
rs1334746575 441 dbSNP
rs886055647 442 dbSNP
rs928512302 444 dbSNP
rs1272038259 450 dbSNP
rs572980386 457 dbSNP
rs971028885 473 dbSNP
rs1323202264 474 dbSNP
rs1312917896 477 dbSNP
rs539901092 485 dbSNP
rs879165853 496 dbSNP
rs981356465 498 dbSNP
rs1034234679 501 dbSNP
rs958862779 503 dbSNP
rs938373524 510 dbSNP
rs1055854056 511 dbSNP
rs1162945023 512 dbSNP
rs1463024293 524 dbSNP
rs879514562 535 dbSNP
rs947122730 540 dbSNP
rs1169965861 543 dbSNP
rs977449203 556 dbSNP
rs1422160300 559 dbSNP
rs1189581857 570 dbSNP
rs1043906403 580 dbSNP
rs944002667 581 dbSNP
rs904038138 586 dbSNP
rs1352110649 598 dbSNP
rs999611724 612 dbSNP
rs1052656499 615 dbSNP
rs1489138067 615 dbSNP
rs1040368521 620 dbSNP
rs1293272089 622 dbSNP
rs891344962 627 dbSNP
rs900117052 629 dbSNP
rs931556303 631 dbSNP
rs1008258409 634 dbSNP
rs1401368714 638 dbSNP
rs1323731221 643 dbSNP
rs1388623850 646 dbSNP
rs1048584376 647 dbSNP
rs887243112 653 dbSNP
rs1018687507 655 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 80326.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' acggucggagCGGGUCg 5'
                    |||||| 
Target 5' ----------GCCCAGa 3'
 		1 - 7
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000258411.3 | 3UTR | GCCCAGACAGUUCAGUUGGGCUGGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
108 hsa-miR-4486 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT254654 NF2 neurofibromin 2 2 2
MIRT458684 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470845 PLXND1 plexin D1 2 2
MIRT493011 NANOS1 nanos C2HC-type zinc finger 1 2 2
MIRT497264 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497675 SYNGR1 synaptogyrin 1 2 2
MIRT498219 TLN2 talin 2 2 2
MIRT498310 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504048 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT519959 ZCCHC8 zinc finger CCHC-type containing 8 2 2
MIRT531521 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT533144 WNT10A Wnt family member 10A 2 2
MIRT533541 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533681 TMEM86A transmembrane protein 86A 2 2
MIRT540321 PIGR polymeric immunoglobulin receptor 2 2
MIRT540719 GUF1 GUF1 homolog, GTPase 2 2
MIRT541566 ZNF43 zinc finger protein 43 2 4
MIRT541787 TBCCD1 TBCC domain containing 1 2 2
MIRT541925 ORC1 origin recognition complex subunit 1 2 4
MIRT542232 FUT9 fucosyltransferase 9 2 2
MIRT542285 POLR3K RNA polymerase III subunit K 2 2
MIRT542299 QTRTD1 queuine tRNA-ribosyltransferase accessory subunit 2 2 4
MIRT542368 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542441 C3 complement C3 2 4
MIRT542475 APOC3 apolipoprotein C3 2 2
MIRT542535 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542640 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542788 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT552104 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT564913 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568606 ACVR2A activin A receptor type 2A 2 2
MIRT607389 LANCL3 LanC like 3 2 2
MIRT607451 ZNF543 zinc finger protein 543 2 2
MIRT610058 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610793 KLK2 kallikrein related peptidase 2 2 2
MIRT617176 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620579 WBSCR27 methyltransferase like 27 2 4
MIRT622085 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622542 PXMP4 peroxisomal membrane protein 4 2 2
MIRT630009 PDE6B phosphodiesterase 6B 2 2
MIRT631813 PTDSS2 phosphatidylserine synthase 2 2 2
MIRT632721 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT632757 MED28 mediator complex subunit 28 2 2
MIRT634821 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT635255 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT637082 SELPLG selectin P ligand 2 2
MIRT637357 ZNF460 zinc finger protein 460 2 2
MIRT637472 DEFB105B defensin beta 105B 2 4
MIRT637504 DEFB105A defensin beta 105A 2 4
MIRT639022 AAK1 AP2 associated kinase 1 2 2
MIRT641012 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT642170 HEBP2 heme binding protein 2 2 2
MIRT648977 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT650515 UFM1 ubiquitin fold modifier 1 2 2
MIRT650949 INMT indolethylamine N-methyltransferase 2 2
MIRT658354 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT660736 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT662191 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663045 SLC16A4 solute carrier family 16 member 4 2 2
MIRT664811 IRAK3 interleukin 1 receptor associated kinase 3 2 2
MIRT665161 SF3A1 splicing factor 3a subunit 1 2 4
MIRT665346 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 2
MIRT666493 SBNO1 strawberry notch homolog 1 2 2
MIRT666545 RNF115 ring finger protein 115 2 2
MIRT669351 BMP3 bone morphogenetic protein 3 2 2
MIRT669904 KIAA0754 KIAA0754 2 4
MIRT670323 CEP57L1 centrosomal protein 57 like 1 2 2
MIRT670430 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT670672 KIAA1551 KIAA1551 2 2
MIRT670746 HOOK3 hook microtubule tethering protein 3 2 2
MIRT670998 PTGIS prostaglandin I2 synthase 2 2
MIRT671290 RPL37A ribosomal protein L37a 2 2
MIRT671469 AGPAT6 glycerol-3-phosphate acyltransferase 4 2 2
MIRT671833 STIL STIL, centriolar assembly protein 2 2
MIRT673006 TAF1 TATA-box binding protein associated factor 1 2 2
MIRT675881 CSTF1 cleavage stimulation factor subunit 1 2 2
MIRT678625 OLFML2A olfactomedin like 2A 2 2
MIRT678790 NUPL2 nucleoporin like 2 2 2
MIRT679560 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT681032 AAED1 AhpC/TSA antioxidant enzyme domain containing 1 2 2
MIRT682480 LIX1L limb and CNS expressed 1 like 2 2
MIRT682758 MDM2 MDM2 proto-oncogene 2 2
MIRT682810 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682867 C9orf156 tRNA methyltransferase O 2 2
MIRT689233 RPS19 ribosomal protein S19 2 2
MIRT689305 C5AR2 complement component 5a receptor 2 2 2
MIRT689363 ZNF101 zinc finger protein 101 2 2
MIRT689629 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT689654 RBM23 RNA binding motif protein 23 2 2
MIRT690148 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT691407 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT691847 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT692234 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT694320 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694365 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT696215 LYZ lysozyme 2 2
MIRT697230 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT700487 PTPRF protein tyrosine phosphatase, receptor type F 2 2
MIRT700612 PRKCA protein kinase C alpha 2 2
MIRT702456 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702990 HERPUD2 HERPUD family member 2 2 2
MIRT703998 EIF5A2 eukaryotic translation initiation factor 5A2 2 2
MIRT704701 CHRFAM7A CHRNA7 (exons 5-10) and FAM7A (exons A-E) fusion 2 2
MIRT712481 FSTL3 follistatin like 3 2 2
MIRT712781 ZNF154 zinc finger protein 154 2 2
MIRT714369 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT722570 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722839 C17orf102 chromosome 17 open reading frame 102 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4486 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Curcumin 969516 NSC32982 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4486 Fulvestrant 17756771 NSC719276 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved sensitive Low Gastric Cancer cell line (SGC-7901)
hsa-mir-4486 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4486 Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4486 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-4486 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-4486 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission