miRTarBase - #MIRT533147


—
pre-miRNA Information
pre-miRNA hsa-mir-5189   
Genomic Coordinates chr16: 88468918 - 88469031
Description Homo sapiens miR-5189 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5189-5p
Sequence 26| UCUGGGCACAGGCGGAUGGACAGG |49
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1253186568 1 dbSNP
rs1157467955 6 dbSNP
rs1375543253 7 dbSNP
rs188172752 9 dbSNP
rs1214792828 10 dbSNP
rs990027849 13 dbSNP
rs913161946 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WNT10A   
Synonyms OODD, SSPS, STHAG4
Description Wnt family member 10A
Transcript NM_025216   
Expression
Putative miRNA Targets on WNT10A
3'UTR of WNT10A
(miRNA target sites are highlighted)		 
>WNT10A|NM_025216|3'UTR
   1 GCGGCCCGGGGTCCCCTGGGCCCTGATCGAGGTCCCCTCCTGGAGCCTGGCCCTCTGAGGCTTACGGTCTTGGCAAGGCA
  81 GCATCGCCTTGGCTCTTGGGAAGAGGAGATTGGACCACATGATCTTATAGGAACCCCTCAGCTCTGAGGTCTGTGATCGC
 161 CGGACAGTCCAGGCCTGTCTGAACCCCACCACTCACTTCTGTGGGCTCTAGGACTGACTGGGTTCTTCCTCCCTCCCCGA
 241 AGCCCAGACAGTTCAGTTGGGCTGGGGGTTGCTCCACACCCTAAAACAAGCCTCAGCCAGGCAACCCGTCAGTCTGTCTC
 321 CATCCTTTCACCCCTTCCCTGGAGATGGGAGGTGGGGAATGAATGGAAGCTGACGGGCAGAGAGAGGAGGATTAAAAAAA
 401 AGAAATAGACATAACTGAGCTGAAGTAATTCCATAAAGGGCCCAGACAGCCTCCTCCACCATTCCCTTCATCATTCATTT
 481 AACAAATATTTATTTTGCACTCTCTTTGCGGCACTCTGGGGGCGGTGGGGTGCGTGGGGGTGGCAATGCAAGGCACTGAG
 561 GCCACAGATGTGAGTAAGCGAGACACAACACTTGTCCTCTTGGAGGTTACATTCTTGCTGGGGGGAGGCATGGGCAATAA
 641 ACAAGTAAATATACAAAC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggacAGGUAGGCGGACACGGGUCu 5'
              ||| ||| ||   |||||| 
Target 5' ttccTCCCTCC-CCGAAGCCCAGa 3'
 226 - 248 131.00 -23.60
2 
miRNA  3' ggacagguaggcggacaCGGGUCu 5'
                           |||||| 
Target 5' aagtaattccataaaggGCCCAGa 3'
 423 - 446 120.00 -16.80
3 
miRNA  3' ggaCAGGUA--GGCGGAC--ACGGGUCu 5'
             |||::|  :|||| |   |:|||| 
Target 5' gagGTCTGTGATCGCCGGACAGTCCAGg 3'
 146 - 173 117.00 -21.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
334416 16 ClinVar
334417 109 ClinVar
334418 116 ClinVar
334419 129 ClinVar
896531 140 ClinVar
334420 217 ClinVar
898152 239 ClinVar
334421 276 ClinVar
898153 340 ClinVar
334422 432 ClinVar
334423 442 ClinVar
COSN25444837 490 COSMIC
COSN9874294 496 COSMIC
COSN29872443 554 COSMIC
COSN15351925 635 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1455199549 3 dbSNP
rs758910410 4 dbSNP
rs1385259515 5 dbSNP
rs1413647127 8 dbSNP
rs538939718 9 dbSNP
rs1360751323 11 dbSNP
rs886055645 16 dbSNP
rs1287664794 17 dbSNP
rs1349880411 20 dbSNP
rs951810914 21 dbSNP
rs942569840 22 dbSNP
rs1226689369 23 dbSNP
rs974286327 26 dbSNP
rs1351648447 27 dbSNP
rs747500221 36 dbSNP
rs929873887 37 dbSNP
rs1373843245 40 dbSNP
rs1276937573 41 dbSNP
rs1486889307 43 dbSNP
rs1328987129 46 dbSNP
rs1212147084 52 dbSNP
rs372266337 66 dbSNP
rs1199948897 67 dbSNP
rs548597599 85 dbSNP
rs1269146419 87 dbSNP
rs1431129556 98 dbSNP
rs1172842734 103 dbSNP
rs1046796175 107 dbSNP
rs190527122 109 dbSNP
rs1396821223 110 dbSNP
rs927137827 115 dbSNP
rs886055646 116 dbSNP
rs1231302296 117 dbSNP
rs1206679424 119 dbSNP
rs1483544743 120 dbSNP
rs937148442 124 dbSNP
rs1054630 129 dbSNP
rs1359228445 137 dbSNP
rs1302612850 138 dbSNP
rs1419603125 142 dbSNP
rs1223763469 145 dbSNP
rs894186878 158 dbSNP
rs1371765948 189 dbSNP
rs755171539 205 dbSNP
rs1443720567 206 dbSNP
rs1370101622 207 dbSNP
rs1370797489 208 dbSNP
rs552325173 217 dbSNP
rs1041725289 230 dbSNP
rs781764094 232 dbSNP
rs774329279 233 dbSNP
rs999724590 236 dbSNP
rs1176499706 239 dbSNP
rs570627699 253 dbSNP
rs1031181831 258 dbSNP
rs944308245 268 dbSNP
rs1039935318 269 dbSNP
rs182186187 276 dbSNP
rs748708833 285 dbSNP
rs987184507 291 dbSNP
rs900002308 292 dbSNP
rs1486763683 298 dbSNP
rs1018374829 300 dbSNP
rs553337539 312 dbSNP
rs1256991758 313 dbSNP
rs536406767 315 dbSNP
rs1215509695 317 dbSNP
rs973971582 325 dbSNP
rs574740587 332 dbSNP
rs1229705044 333 dbSNP
rs1223085900 339 dbSNP
rs535783596 343 dbSNP
rs887557747 347 dbSNP
rs1303281402 348 dbSNP
rs1452774065 352 dbSNP
rs557279615 371 dbSNP
rs575536603 376 dbSNP
rs1457854772 392 dbSNP
rs546040301 402 dbSNP
rs11549437 403 dbSNP
rs1190392948 407 dbSNP
rs759463877 407 dbSNP
rs929759211 411 dbSNP
rs1257103148 412 dbSNP
rs1186307773 413 dbSNP
rs1485057426 429 dbSNP
rs77272502 432 dbSNP
rs1209855873 433 dbSNP
rs1334746575 441 dbSNP
rs886055647 442 dbSNP
rs928512302 444 dbSNP
rs1272038259 450 dbSNP
rs572980386 457 dbSNP
rs971028885 473 dbSNP
rs1323202264 474 dbSNP
rs1312917896 477 dbSNP
rs539901092 485 dbSNP
rs879165853 496 dbSNP
rs981356465 498 dbSNP
rs1034234679 501 dbSNP
rs958862779 503 dbSNP
rs938373524 510 dbSNP
rs1055854056 511 dbSNP
rs1162945023 512 dbSNP
rs1463024293 524 dbSNP
rs879514562 535 dbSNP
rs947122730 540 dbSNP
rs1169965861 543 dbSNP
rs977449203 556 dbSNP
rs1422160300 559 dbSNP
rs1189581857 570 dbSNP
rs1043906403 580 dbSNP
rs944002667 581 dbSNP
rs904038138 586 dbSNP
rs1352110649 598 dbSNP
rs999611724 612 dbSNP
rs1052656499 615 dbSNP
rs1489138067 615 dbSNP
rs1040368521 620 dbSNP
rs1293272089 622 dbSNP
rs891344962 627 dbSNP
rs900117052 629 dbSNP
rs931556303 631 dbSNP
rs1008258409 634 dbSNP
rs1401368714 638 dbSNP
rs1323731221 643 dbSNP
rs1388623850 646 dbSNP
rs1048584376 647 dbSNP
rs887243112 653 dbSNP
rs1018687507 655 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 80326.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ggacagguaggcggacaCGGGUCu 5'
                           |||||| 
Target 5' -----------------GCCCAGa 3'
 		1 - 7
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000258411.3 | 3UTR | GCCCAGACAGUUCAGUUGGGCUGGGG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
177 hsa-miR-5189-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT142280 DCTN5 dynactin subunit 5 2 4
MIRT455613 SRSF3 serine and arginine rich splicing factor 3 2 2
MIRT458687 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT470847 PLXND1 plexin D1 2 2
MIRT471838 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT475228 IKZF3 IKAROS family zinc finger 3 2 4
MIRT480294 C7orf73 short transmembrane mitochondrial protein 1 2 4
MIRT483509 C10orf76 chromosome 10 open reading frame 76 2 2
MIRT484952 ZBTB34 zinc finger and BTB domain containing 34 2 6
MIRT489295 B4GALNT4 beta-1,4-N-acetyl-galactosaminyltransferase 4 2 4
MIRT490801 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT493375 KIAA1614 KIAA1614 2 2
MIRT496408 PARVB parvin beta 2 2
MIRT497267 GRK6 G protein-coupled receptor kinase 6 2 2
MIRT497679 SYNGR1 synaptogyrin 1 2 2
MIRT498222 TLN2 talin 2 2 2
MIRT498313 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT504049 TOMM5 translocase of outer mitochondrial membrane 5 2 2
MIRT516313 F8A2 coagulation factor VIII associated 2 2 2
MIRT516339 F8A3 coagulation factor VIII associated 3 2 2
MIRT517813 UGDH UDP-glucose 6-dehydrogenase 2 6
MIRT518743 C1orf35 chromosome 1 open reading frame 35 2 2
MIRT519295 MLH1 mutL homolog 1 2 2
MIRT520387 UBB ubiquitin B 2 4
MIRT525228 DPY19L3 dpy-19 like C-mannosyltransferase 3 2 2
MIRT533147 WNT10A Wnt family member 10A 2 2
MIRT533544 TPR translocated promoter region, nuclear basket protein 2 2
MIRT533684 TMEM86A transmembrane protein 86A 2 2
MIRT534544 RUNX1 runt related transcription factor 1 2 2
MIRT539592 SSH2 slingshot protein phosphatase 2 2 2
MIRT539676 ZBTB44 zinc finger and BTB domain containing 44 2 2
MIRT539710 EIF3H eukaryotic translation initiation factor 3 subunit H 2 2
MIRT539730 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT539755 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT539787 EMC1 ER membrane protein complex subunit 1 2 4
MIRT539812 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT539995 SLC24A4 solute carrier family 24 member 4 2 2
MIRT540073 SSH3 slingshot protein phosphatase 3 2 2
MIRT540092 NPY4R neuropeptide Y receptor Y4 2 2
MIRT540428 FAM83F family with sequence similarity 83 member F 2 2
MIRT540512 CXCL10 C-X-C motif chemokine ligand 10 2 2
MIRT540531 ZNF417 zinc finger protein 417 2 2
MIRT540622 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT540909 PON1 paraoxonase 1 2 2
MIRT540990 ZNF460 zinc finger protein 460 2 4
MIRT541513 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT541633 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT541665 ATP8B3 ATPase phospholipid transporting 8B3 2 2
MIRT541738 ZC3HAV1 zinc finger CCCH-type containing, antiviral 1 2 2
MIRT541813 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT541904 VWA7 von Willebrand factor A domain containing 7 2 2
MIRT542004 XRCC2 X-ray repair cross complementing 2 2 2
MIRT542020 PEX2 peroxisomal biogenesis factor 2 2 2
MIRT542187 FUT1 fucosyltransferase 1 (H blood group) 2 6
MIRT542204 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542337 LIMD1 LIM domains containing 1 2 2
MIRT542426 ZNF331 zinc finger protein 331 2 2
MIRT542459 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT542494 WDR13 WD repeat domain 13 2 2
MIRT542552 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT542699 RPS15A ribosomal protein S15a 2 2
MIRT542819 PDE12 phosphodiesterase 12 2 2
MIRT552108 PPP1R1A protein phosphatase 1 regulatory inhibitor subunit 1A 2 2
MIRT555606 PIK3R1 phosphoinositide-3-kinase regulatory subunit 1 2 2
MIRT564916 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT568609 ACVR2A activin A receptor type 2A 2 2
MIRT608702 GMPR guanosine monophosphate reductase 2 2
MIRT610061 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610794 KLK2 kallikrein related peptidase 2 2 2
MIRT617179 GOSR2 golgi SNAP receptor complex member 2 2 2
MIRT620581 WBSCR27 methyltransferase like 27 2 4
MIRT623348 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT623873 FUS FUS RNA binding protein 2 2
MIRT625418 IMP4 IMP4, U3 small nucleolar ribonucleoprotein 2 2
MIRT630227 SORD sorbitol dehydrogenase 2 2
MIRT631870 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT631905 VEGFC vascular endothelial growth factor C 2 2
MIRT632005 POPDC2 popeye domain containing 2 2 2
MIRT632876 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT633313 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT633989 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635248 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT635258 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT635280 GK5 glycerol kinase 5 (putative) 2 2
MIRT635862 SLC11A2 solute carrier family 11 member 2 2 2
MIRT636624 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT637085 SELPLG selectin P ligand 2 2
MIRT639025 AAK1 AP2 associated kinase 1 2 2
MIRT640876 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT641928 SLC25A16 solute carrier family 25 member 16 2 2
MIRT642173 HEBP2 heme binding protein 2 2 2
MIRT642251 PAK4 p21 (RAC1) activated kinase 4 2 2
MIRT642854 RNF135 ring finger protein 135 2 2
MIRT643240 PRSS21 protease, serine 21 2 2
MIRT643375 TRIM16L tripartite motif containing 16 like 2 2
MIRT646931 MCCC2 methylcrotonoyl-CoA carboxylase 2 2 2
MIRT647803 FRMD8 FERM domain containing 8 2 2
MIRT650517 UFM1 ubiquitin fold modifier 1 2 2
MIRT651618 WASF3 WAS protein family member 3 2 2
MIRT655588 OTUD7B OTU deubiquitinase 7B 2 2
MIRT657652 GPR75 G protein-coupled receptor 75 2 2
MIRT657835 GJD3 gap junction protein delta 3 2 2
MIRT658357 FAM65B RHO family interacting cell polarization regulator 2 2 2
MIRT661173 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT661332 TBC1D15 TBC1 domain family member 15 2 2
MIRT662003 ZNF445 zinc finger protein 445 2 2
MIRT662194 MEI1 meiotic double-stranded break formation protein 1 2 2
MIRT663473 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT663958 ZNF554 zinc finger protein 554 2 2
MIRT665907 TBCCD1 TBCC domain containing 1 2 2
MIRT666029 STRN3 striatin 3 2 2
MIRT666496 SBNO1 strawberry notch homolog 1 2 2
MIRT667290 MYPN myopalladin 2 4
MIRT668020 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT670087 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT670598 LLGL1 LLGL1, scribble cell polarity complex component 2 4
MIRT670689 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT670848 SFT2D2 SFT2 domain containing 2 2 2
MIRT670981 MED17 mediator complex subunit 17 2 2
MIRT672621 IGF2R insulin like growth factor 2 receptor 2 2
MIRT673223 KLHDC8A kelch domain containing 8A 2 2
MIRT674265 ZNF284 zinc finger protein 284 2 2
MIRT675631 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT675806 MED28 mediator complex subunit 28 2 2
MIRT676337 PCCB propionyl-CoA carboxylase beta subunit 2 2
MIRT681724 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT682844 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT682913 FAM73A mitoguardin 1 2 2
MIRT682932 ZNF292 zinc finger protein 292 2 2
MIRT682950 RPL12 ribosomal protein L12 2 2
MIRT683030 SUSD5 sushi domain containing 5 2 2
MIRT684387 MCTS1 MCTS1, re-initiation and release factor 2 2
MIRT684687 OR7D2 olfactory receptor family 7 subfamily D member 2 2 2
MIRT687202 PLXNA3 plexin A3 2 2
MIRT689145 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 2 2
MIRT689632 NAA30 N(alpha)-acetyltransferase 30, NatC catalytic subunit 2 2
MIRT690598 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690802 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT690943 GLG1 golgi glycoprotein 1 2 2
MIRT691850 OSCAR osteoclast associated, immunoglobulin-like receptor 2 2
MIRT693615 CENPL centromere protein L 2 2
MIRT693757 ZNF383 zinc finger protein 383 2 2
MIRT694014 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694594 AAR2 AAR2 splicing factor homolog 2 2
MIRT694983 PLAC8 placenta specific 8 2 2
MIRT695016 MRPS21 mitochondrial ribosomal protein S21 2 2
MIRT696414 DOCK7 dedicator of cytokinesis 7 2 2
MIRT697803 UBXN2A UBX domain protein 2A 2 2
MIRT697941 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT698775 STK4 serine/threonine kinase 4 2 2
MIRT699532 SIX4 SIX homeobox 4 2 2
MIRT701073 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT702610 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT702688 IRGQ immunity related GTPase Q 2 2
MIRT702931 HMX3 H6 family homeobox 3 2 2
MIRT703721 FAM127A retrotransposon Gag like 8C 2 2
MIRT704296 DDX19B DEAD-box helicase 19B 2 2
MIRT704332 DCTN6 dynactin subunit 6 2 2
MIRT706758 KIAA0907 KIAA0907 2 2
MIRT708483 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT710773 PHF7 PHD finger protein 7 2 2
MIRT712484 FSTL3 follistatin like 3 2 2
MIRT712784 ZNF154 zinc finger protein 154 2 2
MIRT714507 SHE Src homology 2 domain containing E 2 2
MIRT714771 TERF1 telomeric repeat binding factor 1 2 2
MIRT715263 RNF125 ring finger protein 125 2 2
MIRT716447 TMPRSS11BNL TMPRSS11B N-terminal like, pseudogene 2 2
MIRT718198 PSMF1 proteasome inhibitor subunit 1 2 2
MIRT720001 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT720394 ZNF549 zinc finger protein 549 2 2
MIRT720597 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT721231 CRCP CGRP receptor component 2 2
MIRT721261 SH3D19 SH3 domain containing 19 2 2
MIRT721802 GRM1 glutamate metabotropic receptor 1 2 2
MIRT722573 C1orf95 stum, mechanosensory transduction mediator homolog 2 2
MIRT722842 C17orf102 chromosome 17 open reading frame 102 2 2
MIRT722909 COA4 cytochrome c oxidase assembly factor 4 homolog 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5189-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-5189-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-5189-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-5189-5p Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-5189-5p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-5189-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-5189-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-5189-5p Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-5189-5p Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-5189-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-5189-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-5189-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission