miRTarBase - #MIRT533208


—
pre-miRNA Information
pre-miRNA hsa-mir-4446   
Genomic Coordinates chr3: 113594876 - 113594942
Description Homo sapiens miR-4446 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4446-5p
Sequence 8| AUUUCCCUGCCAUUCCCUUGGC |29
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1356015605 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol WAPAL
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 23063.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cgguUCCCUUACCGUCCCUUua 5'
              :| | :|  ::|||||  
Target 5' ---uGGUGUGUAUUGGGGAA-- 3'
 		1 - 17
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_015045 | 3UTR | UGAUAUUUAUUAAUCAUUGGAUUUAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_015045 | 3UTR | UCAUUGGAUUUAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_015045 | 3UTR | AAAUACAUUGAUAUUUAUUAAUCAUUGGAUUUAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_015045 | 3UTR | AUUUUAAAAUGCAAAAUACAUUGAUAUUUAUUAAUCAUUGGAUUUAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_015045 | 3UTR | AUACAUUGAUAUUUAUUAAUCAUUGGAUUUAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_015045 | 3UTR | UAGGGAAAGGGACAGAUUUUUGGUGAACCUGACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000298767.5 | 3UTR | UGGUGUGUAUUGGGGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
223 hsa-miR-4446-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT078060 PCTP phosphatidylcholine transfer protein 2 2
MIRT099072 FOXC1 forkhead box C1 2 2
MIRT130186 TXNIP thioredoxin interacting protein 2 2
MIRT148786 NARS asparaginyl-tRNA synthetase 2 2
MIRT261965 SEPHS1 selenophosphate synthetase 1 2 2
MIRT345867 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT409087 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT451883 SOD2 superoxide dismutase 2 2 4
MIRT469236 RHOB ras homolog family member B 2 2
MIRT469435 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT483055 FOXB1 forkhead box B1 2 8
MIRT484640 TBC1D5 TBC1 domain family member 5 2 6
MIRT493106 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 6
MIRT497307 TMEFF2 transmembrane protein with EGF like and two follistatin like domains 2 2 2
MIRT497798 GABRB1 gamma-aminobutyric acid type A receptor beta1 subunit 2 2
MIRT501273 SCARB2 scavenger receptor class B member 2 2 4
MIRT506756 KMT2D lysine methyltransferase 2D 2 2
MIRT511986 EEF2 eukaryotic translation elongation factor 2 2 4
MIRT513126 ZNF431 zinc finger protein 431 2 2
MIRT519733 ZNF394 zinc finger protein 394 2 4
MIRT520351 UBE2K ubiquitin conjugating enzyme E2 K 2 4
MIRT520542 TPPP tubulin polymerization promoting protein 2 8
MIRT530782 HDHD2 haloacid dehalogenase like hydrolase domain containing 2 2 2
MIRT531112 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT532144 GALNT8 polypeptide N-acetylgalactosaminyltransferase 8 2 2
MIRT533208 WAPAL WAPL cohesin release factor 2 2
MIRT533419 TWF1 twinfilin actin binding protein 1 2 2
MIRT534063 SRSF10 serine and arginine rich splicing factor 10 2 2
MIRT534288 SLAIN2 SLAIN motif family member 2 2 2
MIRT537796 EFNB2 ephrin B2 2 2
MIRT538017 DNAJC10 DnaJ heat shock protein family (Hsp40) member C10 2 2
MIRT538058 DMD dystrophin 2 2
MIRT538132 DDI2 DNA damage inducible 1 homolog 2 2 2
MIRT538680 CCDC80 coiled-coil domain containing 80 2 2
MIRT538788 C3orf52 chromosome 3 open reading frame 52 2 2
MIRT542762 PPAP2B phospholipid phosphatase 3 2 2
MIRT546861 RAB10 RAB10, member RAS oncogene family 2 4
MIRT547418 MED4 mediator complex subunit 4 2 4
MIRT551633 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT552329 ZNF704 zinc finger protein 704 2 2
MIRT556124 MFSD9 major facilitator superfamily domain containing 9 2 4
MIRT559290 ATXN1 ataxin 1 2 2
MIRT562125 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT563777 HUWE1 HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase 2 2
MIRT564430 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT566102 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT567126 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT571213 RRS1 ribosome biogenesis regulator homolog 2 2
MIRT571939 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT571967 KIF21A kinesin family member 21A 2 2
MIRT606792 IL1RAPL1 interleukin 1 receptor accessory protein like 1 2 8
MIRT607351 TNS1 tensin 1 2 4
MIRT609416 GJB7 gap junction protein beta 7 2 4
MIRT609522 AZI2 5-azacytidine induced 2 2 4
MIRT611218 FAM174B family with sequence similarity 174 member B 2 2
MIRT611385 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT612053 KLB klotho beta 2 4
MIRT612102 CHRM3 cholinergic receptor muscarinic 3 2 2
MIRT612146 SIX1 SIX homeobox 1 2 4
MIRT612488 SIX3 SIX homeobox 3 2 4
MIRT613685 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613763 TTC38 tetratricopeptide repeat domain 38 2 2
MIRT613876 FGD1 FYVE, RhoGEF and PH domain containing 1 2 2
MIRT613965 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 4
MIRT614894 PAPOLG poly(A) polymerase gamma 2 2
MIRT614912 NFIA nuclear factor I A 2 2
MIRT615013 ERGIC2 ERGIC and golgi 2 2 2
MIRT615106 BCL7A BCL tumor suppressor 7A 2 2
MIRT615242 FAM227A family with sequence similarity 227 member A 2 4
MIRT615695 NEGR1 neuronal growth regulator 1 2 2
MIRT615956 ERBB3 erb-b2 receptor tyrosine kinase 3 2 4
MIRT615979 FSTL4 follistatin like 4 2 2
MIRT616053 PTPRE protein tyrosine phosphatase, receptor type E 2 4
MIRT616073 TBX2 T-box 2 2 4
MIRT616234 NPAS3 neuronal PAS domain protein 3 2 2
MIRT616306 CELF2 CUGBP Elav-like family member 2 2 2
MIRT616474 MACC1 MACC1, MET transcriptional regulator 2 2
MIRT616662 ST3GAL1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 2 2
MIRT616887 ATP5E ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit 2 2
MIRT616902 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT617025 SYT6 synaptotagmin 6 2 2
MIRT617162 SLC16A5 solute carrier family 16 member 5 2 2
MIRT617318 DPF3 double PHD fingers 3 2 2
MIRT617792 CHRM2 cholinergic receptor muscarinic 2 2 2
MIRT618418 DNAJC30 DnaJ heat shock protein family (Hsp40) member C30 2 2
MIRT618663 RPP40 ribonuclease P/MRP subunit p40 2 2
MIRT620212 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620413 TFDP3 transcription factor Dp family member 3 2 2
MIRT620667 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620709 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT620956 SFT2D2 SFT2 domain containing 2 2 2
MIRT621225 LMAN1 lectin, mannose binding 1 2 2
MIRT621333 SLC11A1 solute carrier family 11 member 1 2 2
MIRT621696 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT623484 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623777 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT624215 DCAF5 DDB1 and CUL4 associated factor 5 2 2
MIRT624675 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT627369 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT628252 EFCAB14 EF-hand calcium binding domain 14 2 2
MIRT630790 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT635631 PRR15L proline rich 15 like 2 2
MIRT636425 MARCH1 membrane associated ring-CH-type finger 1 2 2
MIRT637295 ACTN2 actinin alpha 2 2 2
MIRT637345 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT637842 SLC2A9 solute carrier family 2 member 9 2 2
MIRT638327 RCAN1 regulator of calcineurin 1 2 2
MIRT638375 RABL3 RAB, member of RAS oncogene family like 3 2 2
MIRT638751 EPHA4 EPH receptor A4 2 2
MIRT638965 ARHGAP6 Rho GTPase activating protein 6 2 2
MIRT639094 GLIPR1L2 GLI pathogenesis related 1 like 2 2 2
MIRT639172 CEP70 centrosomal protein 70 2 2
MIRT639254 SLC38A1 solute carrier family 38 member 1 2 4
MIRT639368 ZCCHC24 zinc finger CCHC-type containing 24 2 4
MIRT639504 CACNA1G calcium voltage-gated channel subunit alpha1 G 2 2
MIRT639644 WHAMM WAS protein homolog associated with actin, golgi membranes and microtubules 2 2
MIRT640486 EXOC5 exocyst complex component 5 2 2
MIRT641424 SCUBE3 signal peptide, CUB domain and EGF like domain containing 3 2 2
MIRT641550 LIPG lipase G, endothelial type 2 2
MIRT642180 TOR1AIP1 torsin 1A interacting protein 1 2 2
MIRT642656 RGS6 regulator of G protein signaling 6 2 2
MIRT642873 SAMD1 sterile alpha motif domain containing 1 2 2
MIRT643355 TRIM10 tripartite motif containing 10 2 2
MIRT643531 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT643998 PPP1R3G protein phosphatase 1 regulatory subunit 3G 2 2
MIRT644105 PHLPP1 PH domain and leucine rich repeat protein phosphatase 1 2 2
MIRT644421 VDR vitamin D receptor 2 2
MIRT644481 SLFN12 schlafen family member 12 2 2
MIRT644573 SPOP speckle type BTB/POZ protein 2 2
MIRT645354 SPNS1 sphingolipid transporter 1 (putative) 2 2
MIRT645383 FBLIM1 filamin binding LIM protein 1 2 2
MIRT645758 SURF6 surfeit 6 2 2
MIRT646060 VANGL2 VANGL planar cell polarity protein 2 2 2
MIRT646194 DUSP10 dual specificity phosphatase 10 2 2
MIRT647915 RGS5 regulator of G protein signaling 5 2 2
MIRT649216 AMMECR1L AMMECR1 like 2 2
MIRT649265 C17orf64 chromosome 17 open reading frame 64 2 2
MIRT649522 GTF3C3 general transcription factor IIIC subunit 3 2 2
MIRT649605 ITPKC inositol-trisphosphate 3-kinase C 2 2
MIRT650392 ORMDL2 ORMDL sphingolipid biosynthesis regulator 2 2 2
MIRT650835 SEMA4G semaphorin 4G 2 2
MIRT651273 ZDHHC5 zinc finger DHHC-type containing 5 2 2
MIRT651674 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT651763 VASP vasodilator stimulated phosphoprotein 2 2
MIRT652250 TPD52L3 tumor protein D52 like 3 2 2
MIRT652277 TOM1L2 target of myb1 like 2 membrane trafficking protein 2 2
MIRT652316 TNFSF15 TNF superfamily member 15 2 2
MIRT652342 TMOD3 tropomodulin 3 2 2
MIRT652373 TMEM57 transmembrane protein 57 2 2
MIRT652438 TMEM236 transmembrane protein 236 2 2
MIRT652723 TGFB2 transforming growth factor beta 2 2 2
MIRT652752 TET3 tet methylcytosine dioxygenase 3 2 2
MIRT653310 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT653327 SMIM18 small integral membrane protein 18 2 2
MIRT653406 SLC7A2 solute carrier family 7 member 2 2 2
MIRT653512 SLC41A1 solute carrier family 41 member 1 2 2
MIRT653912 SERPINC1 serpin family C member 1 2 2
MIRT654111 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654153 RORB RAR related orphan receptor B 2 2
MIRT654548 RAB14 RAB14, member RAS oncogene family 2 2
MIRT654920 POLR3D RNA polymerase III subunit D 2 2
MIRT655169 PHF19 PHD finger protein 19 2 2
MIRT655412 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT655784 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT655836 NGDN neuroguidin 2 2
MIRT656079 MTA3 metastasis associated 1 family member 3 2 2
MIRT656404 MCTP1 multiple C2 and transmembrane domain containing 1 2 2
MIRT656720 LMLN leishmanolysin like peptidase 2 2
MIRT656774 LARP1 La ribonucleoprotein domain family member 1 2 2
MIRT656922 KIAA1462 junctional cadherin 5 associated 2 2
MIRT657004 KCNMB4 potassium calcium-activated channel subfamily M regulatory beta subunit 4 2 2
MIRT657477 HCAR2 hydroxycarboxylic acid receptor 2 2 2
MIRT657539 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657911 GCC1 GRIP and coiled-coil domain containing 1 2 2
MIRT658478 EXOC8 exocyst complex component 8 2 2
MIRT658612 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT658823 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT658965 DNAJB5 DnaJ heat shock protein family (Hsp40) member B5 2 4
MIRT659706 CCDC93 coiled-coil domain containing 93 2 2
MIRT660034 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT660108 BTBD3 BTB domain containing 3 2 2
MIRT660697 AMOTL2 angiomotin like 2 2 2
MIRT660763 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT660884 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT660956 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661217 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT661596 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT661624 UGT2B28 UDP glucuronosyltransferase family 2 member B28 2 2
MIRT662430 EID2 EP300 interacting inhibitor of differentiation 2 2 2
MIRT664816 NOX5 NADPH oxidase 5 2 2
MIRT665548 UCHL5 ubiquitin C-terminal hydrolase L5 2 2
MIRT665815 TMEM161B transmembrane protein 161B 2 2
MIRT666668 RBM23 RNA binding motif protein 23 2 2
MIRT667995 HCFC2 host cell factor C2 2 2
MIRT668064 GPR180 G protein-coupled receptor 180 2 2
MIRT669056 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 2
MIRT669637 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
MIRT699368 SLC30A6 solute carrier family 30 member 6 2 2
MIRT699882 RUNX1 runt related transcription factor 1 2 2
MIRT703834 ETV3 ETS variant 3 2 2
MIRT708528 ZNF177 zinc finger protein 177 2 2
MIRT709696 DMWD DM1 locus, WD repeat containing 2 2
MIRT710381 PARD6G par-6 family cell polarity regulator gamma 2 2
MIRT710639 GLUL glutamate-ammonia ligase 2 2
MIRT711584 SETD1A SET domain containing 1A 2 2
MIRT713208 FAM13A family with sequence similarity 13 member A 2 2
MIRT714129 IL20RB interleukin 20 receptor subunit beta 2 2
MIRT714204 MRE11A MRE11 homolog, double strand break repair nuclease 2 2
MIRT714733 CCNO cyclin O 2 2
MIRT714761 ZNF462 zinc finger protein 462 2 2
MIRT715624 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT715755 SKA2 spindle and kinetochore associated complex subunit 2 2 2
MIRT716075 RNF150 ring finger protein 150 2 2
MIRT716179 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT717450 RWDD2A RWD domain containing 2A 2 2
MIRT717866 CACNA2D1 calcium voltage-gated channel auxiliary subunit alpha2delta 1 2 2
MIRT720964 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT721564 SLC5A12 solute carrier family 5 member 12 2 2
MIRT722348 BAG2 BCL2 associated athanogene 2 2 2
MIRT723235 BTLA B and T lymphocyte associated 2 2
MIRT724018 LMBRD2 LMBR1 domain containing 2 2 2
MIRT724507 KLHL5 kelch like family member 5 2 2
MIRT725478 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4446 Aed Therapy sensitive High Epilepsy tissue
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4446 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-4446 Tamoxifen 2733525 NSC180973 approved resistant cell line (MCF7)
hsa-mir-4446 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4446 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-4446-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-4446-5p Paclitaxel 36314 NSC125973 approved resistant cell line (A2780)
hsa-miR-4446-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-4446-5p Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)

Error report submission