pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-2115 |
Genomic Coordinates | chr3: 48316360 - 48316459 |
Description | Homo sapiens miR-2115 stem-loop |
Comment | None |
RNA Secondary Structure | ![]() |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-2115-3p | |||||||||
Sequence | 58| CAUCAGAAUUCAUGGAGGCUAG |79 | |||||||||
Evidence | Experimental | |||||||||
Experiments | 454 | DRVs in miRNA |
|
|||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | SHCBP1 | ||||||||||||||||||||
Synonyms | PAL | ||||||||||||||||||||
Description | SHC binding and spindle associated 1 | ||||||||||||||||||||
Transcript | NM_024745 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on SHCBP1 | |||||||||||||||||||||
3'UTR of SHCBP1 (miRNA target sites are highlighted) |
>SHCBP1|NM_024745|3'UTR 1 CTACAGTGATGTAAGTAGATAGCAAAATACTGGATTTTGCACATGCTGCCCTAAGAATCACTGCTGCCATTGTAGTTTGC 81 TGTATTGTCTGTATTTTATATTTGATTATTTGGGCTTGAGTGAAAGGTAGATTTATTTCCATTTGCAGGTGTTGCACATA 161 AAACACTCCCTCTTTATAAGAAAAATCATAAATGCATATAAAATAGAAAATATTTGGAGATTGCTTATCTGAAAGTCTTG 241 CTTTCTTATACACATGGTTCTCTCATATTAAGCCTGGTAGTAACTTTTTAGTGTAATTACCTTTAGCACTTCAAAGACGA 321 GGAAGTAAGGAAGGGAATGCAAGACTAGTGCATAAAAATGCAATAGGTGTCATATGTACAGCATTCTTCTTAGAGTTGCC 401 TTTTCATCCCAATTACAGTGAGTCTGATTTCCATCCTGTATTTGCATAATACTTGTCTTAAAATAAAAGCTTTTATGATT 481 GGGAATTTATCTGCCTAATCAGACTTATTATTGAGACGTCAATGGGACGCATTTTTCTGTTGAGCTATGCAGTCGTCAAA 561 ACAGCGATAGACAGCATAGGAGGTTTGAAGCAGAAATGAAATGTGTTATTCAGAGCCAATGTTGTACATAGAGCATTTTC 641 ACTATTGCTGAATGGGAATGATTAAAAACAAGGTATTTTTCGGGCCAGGCGGTGGCTCACGCTTGTAATCGCAGCACTTT 721 GGGAGGCTGAGGCAGGAGGATCACTTGAGCCCAGGAGTTCAAGACTAGCCTAGGCAACATAGTGAGACCCTGTCTCTACT 801 AAAAATAAATTTAAAAAAAATTAGCTGAGTGTGGTGGTGCATGCATGTAGTTCCAGCTACTCAGGAGGCTGAGGCTAGAG 881 GATCCTTGAGCCCAGGAGGTTGAGGCTGCAGTGAGGTGTGATTGCGCCACTGCATTCCAGCTTGGGCGACAGAGCGAGAC 961 CCAGTCTCAAAAAAAAAAAAAAGTATTTTTCTCTTACCGTTACAGTATTCTGATTATATTACTGACACAGTCAAAATGAT 1041 TAACTGTACAACCTGTATCTGCTGGGTGTTCTTGTTATCATATTGTAAAACAGCTTTAAAAATATTTATATTTTAAAAAC 1121 TGTATGTGACATTAATATGCCTAATGATTAAAATTATAGTGATGAAATAACAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 79801.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HCT116 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1
PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2
PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8
PAR-CLIP data was present in ERX177608. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_10
PAR-CLIP data was present in ERX177609. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_11
PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1
PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2
PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4
PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7
PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8
PAR-CLIP data was present in ERX177620. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_10
PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2
PAR-CLIP data was present in ERX177626. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_4
PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8
PAR-CLIP data was present in ERX177632. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_10
PAR-CLIP data was present in ERX177633. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_11
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000303383.3 | 3UTR | UAUUUUUCUCUUACCGUUACAGUAUUCUGA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
80 hsa-miR-2115-3p Target Genes:
Functional analysis:
ID![]() |
Target | Description | Validation methods |
![]() |
![]() |
|||||||
Strong evidence | Less strong evidence | |||||||||||
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
|||||
MIRT057089 | DDIT4 | DNA damage inducible transcript 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT071216 | FCF1 | FCF1, rRNA-processing protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT226901 | RAD23B | RAD23 homolog B, nucleotide excision repair protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT235961 | BACH1 | BTB domain and CNC homolog 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT294569 | ZNF460 | zinc finger protein 460 | ![]() |
![]() |
2 | 4 | ||||||
MIRT321046 | RAC1 | Rac family small GTPase 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT359666 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | ![]() |
![]() |
2 | 8 | ||||||
MIRT366451 | KLHL15 | kelch like family member 15 | ![]() |
![]() |
2 | 2 | ||||||
MIRT405375 | ZBTB18 | zinc finger and BTB domain containing 18 | ![]() |
![]() |
2 | 2 | ||||||
MIRT441794 | TCEAL5 | transcription elongation factor A like 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT443295 | TCEAL3 | transcription elongation factor A like 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT455275 | DDX39B | DExD-box helicase 39B | ![]() |
![]() |
2 | 2 | ||||||
MIRT458523 | C5orf22 | chromosome 5 open reading frame 22 | ![]() |
![]() |
2 | 2 | ||||||
MIRT464960 | TWIST1 | twist family bHLH transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT466848 | STX6 | syntaxin 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT469252 | RHOB | ras homolog family member B | ![]() |
![]() |
2 | 2 | ||||||
MIRT469825 | RAB14 | RAB14, member RAS oncogene family | ![]() |
![]() |
2 | 4 | ||||||
MIRT470047 | PTGFRN | prostaglandin F2 receptor inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT471420 | PDP2 | pyruvate dehyrogenase phosphatase catalytic subunit 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT472024 | NPM1 | nucleophosmin 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT484156 | CENPN | centromere protein N | ![]() |
![]() |
2 | 2 | ||||||
MIRT485490 | HMGN2 | high mobility group nucleosomal binding domain 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT490462 | PROSER2 | proline and serine rich 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493069 | MTCH1 | mitochondrial carrier 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT493573 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | ![]() |
![]() |
2 | 8 | ||||||
MIRT494919 | NDUFC2-KCTD14 | NDUFC2-KCTD14 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT500439 | ZMAT3 | zinc finger matrin-type 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT500931 | SRPR | SRP receptor alpha subunit | ![]() |
![]() |
2 | 4 | ||||||
MIRT501551 | POC1B-GALNT4 | POC1B-GALNT4 readthrough | ![]() |
![]() |
2 | 2 | ||||||
MIRT501809 | NEURL1B | neuralized E3 ubiquitin protein ligase 1B | ![]() |
![]() |
2 | 2 | ||||||
MIRT502415 | GALNT4 | polypeptide N-acetylgalactosaminyltransferase 4 | ![]() |
![]() |
2 | 2 | ||||||
MIRT506504 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | ![]() |
![]() |
2 | 2 | ||||||
MIRT507861 | CCNE2 | cyclin E2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT510511 | YOD1 | YOD1 deubiquitinase | ![]() |
![]() |
2 | 6 | ||||||
MIRT516073 | RAB42 | RAB42, member RAS oncogene family | ![]() |
![]() |
2 | 2 | ||||||
MIRT519030 | KYNU | kynureninase | ![]() |
![]() |
2 | 6 | ||||||
MIRT521762 | PPIL1 | peptidylprolyl isomerase like 1 | ![]() |
![]() |
2 | 4 | ||||||
MIRT522898 | KCNJ3 | potassium voltage-gated channel subfamily J member 3 | ![]() |
![]() |
2 | 4 | ||||||
MIRT527370 | MGARP | mitochondria localized glutamic acid rich protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT530691 | C8orf46 | chromosome 8 open reading frame 46 | ![]() |
![]() |
2 | 2 | ||||||
MIRT530867 | TRUB1 | TruB pseudouridine synthase family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT531832 | MTPAP | mitochondrial poly(A) polymerase | ![]() |
![]() |
2 | 4 | ||||||
MIRT533035 | ZBTB5 | zinc finger and BTB domain containing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533165 | WIPF2 | WAS/WASL interacting protein family member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT533464 | TRIM71 | tripartite motif containing 71 | ![]() |
![]() |
2 | 2 | ||||||
MIRT534331 | SHCBP1 | SHC binding and spindle associated 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT539372 | ADSS | adenylosuccinate synthase | ![]() |
![]() |
2 | 6 | ||||||
MIRT545951 | ZBTB10 | zinc finger and BTB domain containing 10 | ![]() |
![]() |
2 | 2 | ||||||
MIRT553283 | TSR1 | TSR1, ribosome maturation factor | ![]() |
![]() |
2 | 2 | ||||||
MIRT553532 | TMEM185B | transmembrane protein 185B | ![]() |
![]() |
2 | 4 | ||||||
MIRT556480 | LIPA | lipase A, lysosomal acid type | ![]() |
![]() |
2 | 2 | ||||||
MIRT556975 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | ![]() |
![]() |
2 | 2 | ||||||
MIRT557697 | GATA6 | GATA binding protein 6 | ![]() |
![]() |
2 | 2 | ||||||
MIRT558901 | CCDC58 | coiled-coil domain containing 58 | ![]() |
![]() |
2 | 2 | ||||||
MIRT559224 | BLMH | bleomycin hydrolase | ![]() |
![]() |
2 | 2 | ||||||
MIRT559827 | SLPI | secretory leukocyte peptidase inhibitor | ![]() |
![]() |
2 | 2 | ||||||
MIRT563435 | SLC3A2 | solute carrier family 3 member 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT569270 | PCDH11X | protocadherin 11 X-linked | ![]() |
![]() |
2 | 2 | ||||||
MIRT571386 | JKAMP | JNK1/MAPK8-associated membrane protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT572567 | AFF1 | AF4/FMR2 family member 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT610400 | AR | androgen receptor | ![]() |
![]() |
2 | 2 | ||||||
MIRT611058 | ZNF621 | zinc finger protein 621 | ![]() |
![]() |
2 | 2 | ||||||
MIRT635118 | TMEM233 | transmembrane protein 233 | ![]() |
![]() |
2 | 2 | ||||||
MIRT641617 | DEFB118 | defensin beta 118 | ![]() |
![]() |
2 | 2 | ||||||
MIRT642146 | CHORDC1 | cysteine and histidine rich domain containing 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT647295 | C8orf33 | chromosome 8 open reading frame 33 | ![]() |
![]() |
2 | 2 | ||||||
MIRT648155 | MPLKIP | M-phase specific PLK1 interacting protein | ![]() |
![]() |
2 | 2 | ||||||
MIRT652780 | TENM3 | teneurin transmembrane protein 3 | ![]() |
![]() |
2 | 2 | ||||||
MIRT657356 | HNRNPA2B1 | heterogeneous nuclear ribonucleoprotein A2/B1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT658718 | ELN | elastin | ![]() |
![]() |
2 | 2 | ||||||
MIRT662441 | RALGAPA1 | Ral GTPase activating protein catalytic alpha subunit 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT665302 | ZBTB38 | zinc finger and BTB domain containing 38 | ![]() |
![]() |
2 | 2 | ||||||
MIRT699898 | RUNX1 | runt related transcription factor 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT700921 | PDS5A | PDS5 cohesin associated factor A | ![]() |
![]() |
2 | 2 | ||||||
MIRT700992 | PDE3A | phosphodiesterase 3A | ![]() |
![]() |
2 | 2 | ||||||
MIRT707397 | DCAF4L1 | DDB1 and CUL4 associated factor 4 like 1 | ![]() |
![]() |
2 | 2 | ||||||
MIRT711895 | INSIG2 | insulin induced gene 2 | ![]() |
![]() |
2 | 2 | ||||||
MIRT712072 | XRCC5 | X-ray repair cross complementing 5 | ![]() |
![]() |
2 | 2 | ||||||
MIRT716121 | PTPLAD2 | 3-hydroxyacyl-CoA dehydratase 4 | ![]() |
1 | 1 | |||||||
MIRT724470 | SMAD2 | SMAD family member 2 | ![]() |
![]() |
2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|