miRTarBase - #MIRT534640


—
pre-miRNA Information
pre-miRNA hsa-mir-5590   
Genomic Coordinates chr2: 134857820 - 134857873
Description Homo sapiens miR-5590 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-5590-5p
Sequence 1| UUGCCAUACAUAGACUUUAUU |21
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs553031425 1 dbSNP
rs1255264134 4 dbSNP
rs1205476379 9 dbSNP
rs1387316331 10 dbSNP
rs1031241138 11 dbSNP
rs1465409255 12 dbSNP
rs1227248415 18 dbSNP
rs1334861447 19 dbSNP
Putative Targets

Gene Information
Gene Symbol RNF6   
Synonyms -
Description ring finger protein 6
Transcript NM_183043   
Other Transcripts NM_005977 , NM_183044   
Expression
Putative miRNA Targets on RNF6
3'UTR of RNF6
(miRNA target sites are highlighted)		 
>RNF6|NM_183043|3'UTR
   1 GGTGATGGGATCTACTCAAATACTGTTTTTTAGTAGAACTGAATGTTCAAGCATTGTTTTGCTGAGTTATTTGTGATTAG
  81 CTAACCAGGATGAAAAATAACAGATTATATATAGTTTGAACTATTTTTCGTGTGCTTTTTTAAACTTGTTAAAAAGAAAT
 161 TTATATAAAATTTAAAATACAAATGTTAAATTATCCAGAAATACAGAATAGTTAATATTGCTAGAACCAAATAACCTCTA
 241 AAATGTTTTTATTTTGGTAATTTTGTCATGCTAAGCACTTTTGTATCTGCACAATTCAGTAGGTTAAGAATCAATCTTCT
 321 TTTTCTTAATAGTACAGCAGACTTTAGCTTCAAGTTTCATAGGCTTAGTACTTATATCTAGACATTTGTGTCTAAATAAG
 401 CTTTTCATTAACTTTTTATTTTAAGGACAGTATCTTTTCATGAAAGAGTATTTGGCTGAATGTTTGCTATATATATGTTA
 481 CTTGAAATGTTAAATTTAATATGCAGCATACCATAGGTGTATATATAGGTATATAATTTTAAGGTTAAAATATTCAGTCT
 561 ACAAGTTTGGTTCTTATTTAAGCTTTTGGGCTAATACTGCATATGGCACAATGTTTAATATTGGCAAGTTCATCTCAGAG
 641 AAAGGGGATTCAGATATAATTTTAAAGTAGAGATAATTTACTGAAGCGTCTCTGACAATCTAACTTATTAGACAGCAAGC
 721 AATATATAATACTGAAAAAGTATTCAGAAATGGAAAATTTACATCATATAGGTTATTTAACTTGTGTTCAGCCTTTTTGT
 801 AACTTTTTTGAAAGTGCAAACAATTCTTTGGATTATTAAATAAGGTATACAGTATGCATGGTTTCTCAAATTTAGTTTTA
 881 AAATCTAAAAGTCTATAAAGAATCAGATGCATAGGCAATATGTTAAGTTCACTTGGAGGCTAAAAATCTCCAGTGAAAAC
 961 AAAACGAAAACCTTTAAGAGAATGTAGAGTTTATATAAACACAAAGTATGCATTGAAGATCTGTTTCTACCAATAAACAT
1041 TAAAACAAAGACTGTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uuauUUCAGAUACAUACCGUu 5'
              ||  ||:  ||||||| 
Target 5' ggctAATACTGCATATGGCAc 3'
 589 - 609 149.00 -9.10
2 
miRNA  3' uuauUUCAGAUACAUA-CCGUu 5'
              |:|| ||| ||| ||:| 
Target 5' ccatAGGTGTATATATAGGTAt 3'
 511 - 532 117.00 -7.60
3 
miRNA  3' uuAUUUCAGAU-ACAUACCGUu 5'
            |||:|| ||  |||| ||| 
Target 5' aaTAAGGTATACAGTAT-GCAt 3'
 839 - 859 115.00 -8.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN28839471 5 COSMIC
COSN26992496 8 COSMIC
COSN30155891 12 COSMIC
COSN30497260 25 COSMIC
COSN30450218 36 COSMIC
COSN30157606 41 COSMIC
COSN30192840 76 COSMIC
COSN25921923 93 COSMIC
COSN30520592 129 COSMIC
COSN31527747 156 COSMIC
COSN31541278 186 COSMIC
COSN1157024 190 COSMIC
COSN31490232 282 COSMIC
COSN31590620 327 COSMIC
COSN28709719 351 COSMIC
COSN31517749 400 COSMIC
COSN6225124 430 COSMIC
COSN31563688 469 COSMIC
COSN29801544 573 COSMIC
COSN31569151 606 COSMIC
COSN31608165 640 COSMIC
COSN29303819 757 COSMIC
COSN31571393 826 COSMIC
COSN28202262 849 COSMIC
COSN28791184 850 COSMIC
COSN31585768 966 COSMIC
COSN32055796 997 COSMIC
COSN31485938 1036 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1394916990 1 dbSNP
rs753573634 2 dbSNP
rs779802161 7 dbSNP
rs1387316134 15 dbSNP
rs755801417 17 dbSNP
rs1410335680 20 dbSNP
rs1023159518 21 dbSNP
rs1470080680 23 dbSNP
rs1236831609 24 dbSNP
rs768476849 26 dbSNP
rs1196023137 31 dbSNP
rs1367191172 32 dbSNP
rs1469219973 33 dbSNP
rs767215878 34 dbSNP
rs1464011477 38 dbSNP
rs761872332 39 dbSNP
rs1319491889 44 dbSNP
rs751397041 48 dbSNP
rs539577278 52 dbSNP
rs1400472123 53 dbSNP
rs1410010291 68 dbSNP
rs1328789586 69 dbSNP
rs990383358 78 dbSNP
rs772288038 84 dbSNP
rs1228626855 86 dbSNP
rs1311782065 89 dbSNP
rs1319823946 102 dbSNP
rs1172301245 105 dbSNP
rs1220448982 111 dbSNP
rs957529973 114 dbSNP
rs1031833747 116 dbSNP
rs143463322 123 dbSNP
rs901594315 129 dbSNP
rs557296912 130 dbSNP
rs1181604846 132 dbSNP
rs537066819 139 dbSNP
rs1254568141 140 dbSNP
rs780374785 142 dbSNP
rs1234792019 144 dbSNP
rs1172104750 167 dbSNP
rs1182667639 167 dbSNP
rs1464600733 168 dbSNP
rs888819117 172 dbSNP
rs753373197 179 dbSNP
rs1448355411 190 dbSNP
rs1302022531 195 dbSNP
rs1441908302 198 dbSNP
rs549165464 203 dbSNP
rs548604120 220 dbSNP
rs930587083 221 dbSNP
rs1278697225 233 dbSNP
rs528684972 238 dbSNP
rs1036206304 240 dbSNP
rs1280872319 244 dbSNP
rs940095471 251 dbSNP
rs1209747409 265 dbSNP
rs529390690 269 dbSNP
rs1254628938 276 dbSNP
rs549133085 283 dbSNP
rs928724072 283 dbSNP
rs1263041891 285 dbSNP
rs1208562342 298 dbSNP
rs1184227351 301 dbSNP
rs981578106 314 dbSNP
rs1414669810 317 dbSNP
rs948708377 319 dbSNP
rs749246409 322 dbSNP
rs1280721885 323 dbSNP
rs990352333 329 dbSNP
rs1298612183 332 dbSNP
rs185318248 345 dbSNP
rs957624877 346 dbSNP
rs192302916 353 dbSNP
rs187933051 358 dbSNP
rs1368477422 359 dbSNP
rs543363701 375 dbSNP
rs529658384 378 dbSNP
rs965797117 383 dbSNP
rs1356154689 393 dbSNP
rs1019100019 403 dbSNP
rs1007333209 410 dbSNP
rs888782286 411 dbSNP
rs1027358204 418 dbSNP
rs1376466039 421 dbSNP
rs1478036054 424 dbSNP
rs182162193 439 dbSNP
rs1392834565 446 dbSNP
rs1399285079 449 dbSNP
rs1158999617 450 dbSNP
rs897762582 457 dbSNP
rs1417778438 458 dbSNP
rs1410518452 462 dbSNP
rs1350416607 469 dbSNP
rs1435791683 471 dbSNP
rs1159310097 497 dbSNP
rs1472513994 499 dbSNP
rs1255443748 503 dbSNP
rs17083434 509 dbSNP
rs1352050394 516 dbSNP
rs1003773861 521 dbSNP
rs1486640890 526 dbSNP
rs191406434 529 dbSNP
rs1250647733 530 dbSNP
rs116536064 543 dbSNP
rs1178935720 545 dbSNP
rs1379304514 549 dbSNP
rs948863890 555 dbSNP
rs1285930037 558 dbSNP
rs1223928461 560 dbSNP
rs1323949882 561 dbSNP
rs1402623435 568 dbSNP
rs1447790259 569 dbSNP
rs572430294 586 dbSNP
rs1330854995 601 dbSNP
rs1374981756 604 dbSNP
rs1247387198 609 dbSNP
rs1333559492 610 dbSNP
rs1356231871 611 dbSNP
rs1227161475 613 dbSNP
rs775178274 616 dbSNP
rs544824990 620 dbSNP
rs1198746295 625 dbSNP
rs1234567581 627 dbSNP
rs1356702168 636 dbSNP
rs1189326443 638 dbSNP
rs554226164 641 dbSNP
rs1472419907 642 dbSNP
rs1429128184 645 dbSNP
rs1347254128 646 dbSNP
rs188188192 647 dbSNP
rs924881097 650 dbSNP
rs1425696590 657 dbSNP
rs1466162693 674 dbSNP
rs1170099992 677 dbSNP
rs1394561602 678 dbSNP
rs1319269465 687 dbSNP
rs1335256175 699 dbSNP
rs879076698 701 dbSNP
rs182868386 702 dbSNP
rs1415931097 708 dbSNP
rs72166737 711 dbSNP
rs1475574900 713 dbSNP
rs191490411 719 dbSNP
rs1256917738 725 dbSNP
rs966595694 729 dbSNP
rs1201882387 762 dbSNP
rs912102506 769 dbSNP
rs986276802 776 dbSNP
rs1414521374 781 dbSNP
rs953116628 783 dbSNP
rs1265196306 790 dbSNP
rs866454495 793 dbSNP
rs1478129913 797 dbSNP
rs1193011884 802 dbSNP
rs537405505 807 dbSNP
rs1371464277 810 dbSNP
rs186584983 816 dbSNP
rs1474305778 823 dbSNP
rs994516703 826 dbSNP
rs746407951 829 dbSNP
rs1243590666 832 dbSNP
rs1216090527 833 dbSNP
rs961734559 853 dbSNP
rs1361701568 854 dbSNP
rs367558929 870 dbSNP
rs560052205 870 dbSNP
rs1294218943 874 dbSNP
rs1830 876 dbSNP
rs1215089919 888 dbSNP
rs1234789534 895 dbSNP
rs1334900078 897 dbSNP
rs906349236 907 dbSNP
rs535377034 908 dbSNP
rs867074043 910 dbSNP
rs1215885073 914 dbSNP
rs1488568173 914 dbSNP
rs1259577391 916 dbSNP
rs1013375855 917 dbSNP
rs1199699027 927 dbSNP
rs1271190862 929 dbSNP
rs755722685 947 dbSNP
rs1440593109 963 dbSNP
rs894583735 965 dbSNP
rs747682798 966 dbSNP
rs1160804791 970 dbSNP
rs1361642693 980 dbSNP
rs935992793 992 dbSNP
rs1287565546 1002 dbSNP
rs757645036 1005 dbSNP
rs753120786 1012 dbSNP
rs566258396 1019 dbSNP
rs1240869057 1023 dbSNP
rs1042359669 1050 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 6049.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000346166.3 | 3UTR | GGGCUAAUACUGCAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
69 hsa-miR-5590-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056313 WAC WW domain containing adaptor with coiled-coil 2 6
MIRT066181 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT095612 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT099166 MYLIP myosin regulatory light chain interacting protein 2 2
MIRT107578 VLDLR very low density lipoprotein receptor 2 2
MIRT179602 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 8
MIRT241303 ZC3H12C zinc finger CCCH-type containing 12C 2 8
MIRT244620 MCM4 minichromosome maintenance complex component 4 2 2
MIRT270705 SBNO1 strawberry notch homolog 1 2 4
MIRT453616 SNRPE small nuclear ribonucleoprotein polypeptide E 2 4
MIRT453653 RAB6C RAB6C, member RAS oncogene family 2 2
MIRT464159 VMP1 vacuole membrane protein 1 2 15
MIRT477720 EEF1A1 eukaryotic translation elongation factor 1 alpha 1 2 2
MIRT484301 ENDOD1 endonuclease domain containing 1 2 4
MIRT496069 GLCCI1 glucocorticoid induced 1 2 2
MIRT496338 TMEM81 transmembrane protein 81 2 2
MIRT496653 PITPNM3 PITPNM family member 3 2 2
MIRT499098 DENND4C DENN domain containing 4C 2 8
MIRT499862 SVOP SV2 related protein 2 12
MIRT504913 CD38 CD38 molecule 2 4
MIRT515401 WDR72 WD repeat domain 72 2 4
MIRT518156 TMEM133 transmembrane protein 133 2 2
MIRT518558 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT518636 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT518724 ABCG8 ATP binding cassette subfamily G member 8 2 2
MIRT524301 CTC1 CST telomere replication complex component 1 2 4
MIRT524472 CHRM3 cholinergic receptor muscarinic 3 2 4
MIRT527562 ADCY7 adenylate cyclase 7 2 2
MIRT532694 TCN2 transcobalamin 2 2 4
MIRT534640 RNF6 ring finger protein 6 2 2
MIRT537163 GGCX gamma-glutamyl carboxylase 2 2
MIRT539360 AFF4 AF4/FMR2 family member 4 2 2
MIRT547023 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT548155 FRAT2 FRAT2, WNT signaling pathway regulator 2 2
MIRT550127 ZNF138 zinc finger protein 138 2 2
MIRT558473 DBN1 drebrin 1 2 2
MIRT566862 LRRC58 leucine rich repeat containing 58 2 2
MIRT567246 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT572848 BRPF3 bromodomain and PHD finger containing 3 2 2
MIRT574914 Vmp1 vacuole membrane protein 1 2 9
MIRT606849 RAB7A RAB7A, member RAS oncogene family 2 2
MIRT611274 RBMXL1 RNA binding motif protein, X-linked like 1 2 2
MIRT612328 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT612415 SP1 Sp1 transcription factor 2 2
MIRT614791 RRAGC Ras related GTP binding C 2 2
MIRT618449 SERPINA3 serpin family A member 3 2 2
MIRT621154 MICALCL MICAL C-terminal like 2 2
MIRT622141 SOX4 SRY-box 4 2 2
MIRT623504 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT623598 IPO9 importin 9 2 2
MIRT624075 EBF1 early B-cell factor 1 2 2
MIRT639792 MVK mevalonate kinase 2 2
MIRT641109 ZNF274 zinc finger protein 274 2 2
MIRT641579 RFX1 regulatory factor X1 2 2
MIRT643095 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT645141 CUBN cubilin 2 2
MIRT646461 PRDM10 PR/SET domain 10 2 2
MIRT650815 HMOX1 heme oxygenase 1 2 2
MIRT653073 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 2 2
MIRT657675 GPR26 G protein-coupled receptor 26 2 2
MIRT665824 TIMM8B translocase of inner mitochondrial membrane 8 homolog B 2 2
MIRT695592 TMEM199 transmembrane protein 199 2 2
MIRT698039 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT701015 PCGF5 polycomb group ring finger 5 2 2
MIRT701357 NR4A3 nuclear receptor subfamily 4 group A member 3 2 2
MIRT707114 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT718661 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT719901 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT720564 C1RL complement C1r subcomponent like 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-5590-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission