pre-miRNA Information
pre-miRNA hsa-mir-124-1   
Genomic Coordinates chr8: 9903388 - 9903472
Description Homo sapiens miR-124-1 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-2   
Genomic Coordinates chr8: 64379149 - 64379257
Description Homo sapiens miR-124-2 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-124-3   
Genomic Coordinates chr20: 63178500 - 63178586
Description Homo sapiens miR-124-3 stem-loop
Comment miR-124 was first identified by cloning studies in mouse . The 5' end of the miRNA may be offset with respect to previous annotations.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-124-5p
Sequence 14| CGUGUUCACAGCGGACCUUGAU |35
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 8 + 64379180 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1280076135 1 dbSNP
rs775858016 4 dbSNP
rs760972715 7 dbSNP
rs1334649236 11 dbSNP
rs1160219511 12 dbSNP
rs764591061 12 dbSNP
rs1261326747 13 dbSNP
rs1344491363 20 dbSNP
rs1340798465 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Increase Plasma Polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Neuron Reverse transcription-polymerase chain reaction
B28CWB miR-124 Safety Biomarker (SAF); Monitoring Biomarker (MOI) Clinical/Experimental Data Expression Decrease Peripheral blood mononuclear cell Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol PSAT1   
Synonyms EPIP, NLS2, PSA, PSAT, PSATD
Description phosphoserine aminotransferase 1
Transcript NM_021154   
Other Transcripts NM_058179   
Expression
Putative miRNA Targets on PSAT1
3'UTR of PSAT1
(miRNA target sites are highlighted)
>PSAT1|NM_021154|3'UTR
   1 ACACATCCTAACCAGGATATACTCTGTTCTTGAACAACATACAAAGTTTAAAGTAACTTGGGGATGGCTACAAAAAGTTA
  81 ACACAGTATTTTTCTCAAATGAACATGTTTATTGCAGATTCTTCTTTTTTGAAAGAACAACAGCAAAACATCCACAACTC
 161 TGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAA
 241 CAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGT
 321 TGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATC
 401 TGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCG
 481 AAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGT
 561 CTGTTTTTAATACCATATACTTTATATTTCTATACATTTATATTTCTAATAATACAGTTATCACTGATATATGTAGACAC
 641 TTTTAGAATTTATTAAATCCTTGACCTTGTGCATTATAGCATTCCATTAGCAAGAGTTGTACCCCCTCCCCAGTCTTCGC
 721 CTTCCTCTTTTTAAGCTGTTTTATGAAAAAGACCTAGAAGTTCTTGATTCATTTTTACCATTCTTTCCATAGGTAGAAGA
 801 GAAAGTTGATTGGTTGGTTGTTTTTCAATTATGCCATTAAACTAAACATTTCTGTTAAATTACCCTATCCTTTGTTCTCT
 881 ACTGTTTTCTTTGTAATGTATGACTACGAGAGTGATACTTTGCTGAAAAGTCTTTCCCCTATTGTTTATCTATTGTCAGT
 961 ATTTTATGTTGAATATGTAAAGAACATTAAAGTCCTAAAACATCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' uaGUUCCAGGCGACACUUGUGc 5'
            |||||||:|:| | ||:|| 
Target 5' agCAAGGTCTGTTTTTAATACc 3'
553 - 574 136.00 -17.90
2
miRNA  3' uaguuccAGGCGA-CACUUGUgc 5'
                 ||:|:|  ||||||  
Target 5' gatatacTCTGTTCTTGAACAac 3'
16 - 38 131.00 -9.90
3
miRNA  3' uaguuccaggcgacACUUGUGc 5'
                        ||||||: 
Target 5' gtatttttctcaaaTGAACATg 3'
86 - 107 124.00 -9.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
912650 220 ClinVar
367462 242 ClinVar
912651 252 ClinVar
367463 253 ClinVar
912652 253 ClinVar
912653 294 ClinVar
912654 379 ClinVar
367464 423 ClinVar
913754 497 ClinVar
913755 499 ClinVar
913756 555 ClinVar
367465 593 ClinVar
367466 665 ClinVar
367467 671 ClinVar
914154 720 ClinVar
367468 790 ClinVar
367469 837 ClinVar
367470 866 ClinVar
914155 940 ClinVar
COSN30469335 9 COSMIC
COSN30116467 11 COSMIC
COSN31533554 58 COSMIC
COSN2328516 64 COSMIC
COSN30494688 70 COSMIC
COSN9523582 88 COSMIC
COSN31600842 131 COSMIC
COSN31573909 144 COSMIC
COSN22259776 480 COSMIC
COSN31963052 555 COSMIC
COSN29120568 756 COSMIC
COSN15827104 781 COSMIC
COSN16477356 829 COSMIC
COSN24938179 894 COSMIC
COSN26324655 908 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1376181327 3 dbSNP
rs777691208 4 dbSNP
rs1305709679 5 dbSNP
rs1345650393 7 dbSNP
rs373654141 8 dbSNP
rs1260941235 11 dbSNP
rs771164639 14 dbSNP
rs779224452 15 dbSNP
rs377546355 20 dbSNP
rs1415326767 21 dbSNP
rs1383091743 22 dbSNP
rs768266832 26 dbSNP
rs776559550 28 dbSNP
rs1195204907 30 dbSNP
rs375713892 40 dbSNP
rs772682516 43 dbSNP
rs762410248 44 dbSNP
rs765897031 46 dbSNP
rs912112640 48 dbSNP
rs751156869 50 dbSNP
rs1356601342 52 dbSNP
rs55735002 54 dbSNP
rs1357763425 55 dbSNP
rs1291443041 65 dbSNP
rs944711574 89 dbSNP
rs1041760380 97 dbSNP
rs373306764 102 dbSNP
rs1380015320 121 dbSNP
rs532073374 122 dbSNP
rs1339518091 132 dbSNP
rs767572870 136 dbSNP
rs1406331941 138 dbSNP
rs1363509822 139 dbSNP
rs1336863412 141 dbSNP
rs924600684 144 dbSNP
rs773305506 150 dbSNP
rs936131415 156 dbSNP
rs1363797738 161 dbSNP
rs550727446 169 dbSNP
rs764963253 170 dbSNP
rs894334384 171 dbSNP
rs1012724932 179 dbSNP
rs1268679273 189 dbSNP
rs1196726330 191 dbSNP
rs1481941403 202 dbSNP
rs368179744 210 dbSNP
rs1297266168 211 dbSNP
rs1250125164 215 dbSNP
rs1045685672 221 dbSNP
rs1316766861 225 dbSNP
rs907078101 227 dbSNP
rs1004532311 233 dbSNP
rs1343218095 235 dbSNP
rs1057515673 242 dbSNP
rs962678923 250 dbSNP
rs187331280 251 dbSNP
rs76966550 252 dbSNP
rs17064358 253 dbSNP
rs1484933240 261 dbSNP
rs986225228 262 dbSNP
rs1377272781 267 dbSNP
rs912059641 271 dbSNP
rs566608311 272 dbSNP
rs966301702 276 dbSNP
rs1195754938 290 dbSNP
rs1462124280 291 dbSNP
rs1263262669 294 dbSNP
rs978065995 300 dbSNP
rs1273873087 308 dbSNP
rs1321040687 308 dbSNP
rs1239229691 317 dbSNP
rs1337321849 322 dbSNP
rs924660684 324 dbSNP
rs534118383 325 dbSNP
rs1338851919 332 dbSNP
rs753980162 333 dbSNP
rs1468297276 346 dbSNP
rs935978492 350 dbSNP
rs990261195 352 dbSNP
rs1471253466 355 dbSNP
rs1362454793 359 dbSNP
rs755260572 361 dbSNP
rs1174679828 369 dbSNP
rs371726153 373 dbSNP
rs1431864718 375 dbSNP
rs915962826 377 dbSNP
rs1184969647 402 dbSNP
rs1179083794 403 dbSNP
rs1205392793 406 dbSNP
rs1352360659 408 dbSNP
rs1258796924 410 dbSNP
rs948535954 421 dbSNP
rs10867185 423 dbSNP
rs1465614317 424 dbSNP
rs1317084248 426 dbSNP
rs1450286422 428 dbSNP
rs1339968741 444 dbSNP
rs907027317 453 dbSNP
rs1402701290 463 dbSNP
rs1383042643 465 dbSNP
rs1344157884 468 dbSNP
rs1425680906 478 dbSNP
rs570860296 480 dbSNP
rs1290278116 481 dbSNP
rs1037337607 484 dbSNP
rs898178242 487 dbSNP
rs553854445 497 dbSNP
rs573775683 499 dbSNP
rs1028033654 500 dbSNP
rs1359907248 501 dbSNP
rs1281201926 504 dbSNP
rs1293612163 506 dbSNP
rs1347149403 510 dbSNP
rs1226568732 511 dbSNP
rs1355517463 516 dbSNP
rs889572522 518 dbSNP
rs1432959017 523 dbSNP
rs1007924919 532 dbSNP
rs1224121340 534 dbSNP
rs1405712716 537 dbSNP
rs1291455735 541 dbSNP
rs1019102180 544 dbSNP
rs376749590 555 dbSNP
rs1217982074 561 dbSNP
rs1032312948 568 dbSNP
rs1420836078 569 dbSNP
rs568308325 576 dbSNP
rs1168062593 577 dbSNP
rs1488301628 581 dbSNP
rs1476112152 582 dbSNP
rs1420765077 591 dbSNP
rs115361057 593 dbSNP
rs553947293 596 dbSNP
rs572620565 605 dbSNP
rs778172800 607 dbSNP
rs1219082974 609 dbSNP
rs915910394 618 dbSNP
rs948814663 636 dbSNP
rs981510527 657 dbSNP
rs41277903 665 dbSNP
rs1277586377 666 dbSNP
rs143748888 671 dbSNP
rs1347601579 680 dbSNP
rs1301750390 686 dbSNP
rs1036963176 704 dbSNP
rs1345251010 706 dbSNP
rs1355414871 711 dbSNP
rs1331476854 716 dbSNP
rs1423674638 719 dbSNP
rs898367741 720 dbSNP
rs1480586822 722 dbSNP
rs1049419781 723 dbSNP
rs1367217417 752 dbSNP
rs1189319180 771 dbSNP
rs1477576296 781 dbSNP
rs889437649 784 dbSNP
rs1007957619 787 dbSNP
rs1057515674 790 dbSNP
rs1278912566 798 dbSNP
rs576799548 803 dbSNP
rs1326004618 805 dbSNP
rs1299475549 812 dbSNP
rs544321070 826 dbSNP
rs562487070 829 dbSNP
rs957896304 835 dbSNP
rs41277905 837 dbSNP
rs1400180451 854 dbSNP
rs1022999589 859 dbSNP
rs529821810 866 dbSNP
rs981541758 868 dbSNP
rs928681662 872 dbSNP
rs1413502646 882 dbSNP
rs961239861 884 dbSNP
rs748940129 894 dbSNP
rs1490618598 901 dbSNP
rs973017363 908 dbSNP
rs1231699471 909 dbSNP
rs542019513 914 dbSNP
rs1471472276 917 dbSNP
rs1178271572 922 dbSNP
rs1408169193 931 dbSNP
rs545654977 933 dbSNP
rs1161300205 940 dbSNP
rs931260171 948 dbSNP
rs1285036496 953 dbSNP
rs1049615930 955 dbSNP
rs1386656453 958 dbSNP
rs1376897466 970 dbSNP
rs910907044 973 dbSNP
rs183713691 979 dbSNP
rs1454994463 980 dbSNP
rs943681493 986 dbSNP
rs768478418 991 dbSNP
rs527575923 1005 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uaguuccaggcgacaCUUGUGc 5'
                         |||||| 
Target 5' uuucuggagucauggGAACACa 3'
9 - 30
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 29968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' uaguuccaggcgacaCUUGUGc 5'
                         |||||| 
Target 5' uuucuggagucauggGAACAC- 3'
9 - 29
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000376588.3 | 3UTR | AUUAAUUAUUUCUGGAGUCAUGGGAACACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000376588.3 | 3UTR | AUUAAUUAUUUCUGGAGUCAUGGGAACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE32688 Pancreatic cancer 0.426 7.5e-3 0.347 2.6e-2 32 Click to see details
GSE28260 Renal cortex and medulla -0.6 1.5e-2 -0.599 1.5e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells 0.311 7.4e-2 0.208 1.7e-1 23 Click to see details
GSE28544 Breast cancer -0.249 1.2e-1 -0.153 2.4e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.14 1.3e-1 0.041 3.7e-1 64 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.206 1.9e-1 0.056 4.1e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.125 2.8e-1 -0.062 3.8e-1 25 Click to see details
GSE38226 Liver fibrosis -0.067 3.9e-1 -0.370 4.9e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.03 4.4e-1 0.096 3.3e-1 24 Click to see details
GSE19350 CNS germ cell tumors 0.017 4.8e-1 0.224 2.4e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.017 4.8e-1 0.224 2.4e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
0.017 4.8e-1 0.224 2.4e-1 12 Click to see details
0.017 4.8e-1 0.224 2.4e-1 12 Click to see details
0.017 4.8e-1 0.224 2.4e-1 12 Click to see details
65 hsa-miR-124-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT064177 KIAA1804 mitogen-activated protein kinase kinase kinase 21 2 2
MIRT069736 FOXG1 forkhead box G1 2 4
MIRT086429 NABP1 nucleic acid binding protein 1 2 6
MIRT105334 SLC7A2 solute carrier family 7 member 2 2 4
MIRT110455 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT172998 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT196428 TAOK1 TAO kinase 1 2 14
MIRT325704 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT365670 TSC22D3 TSC22 domain family member 3 2 4
MIRT365873 XIAP X-linked inhibitor of apoptosis 2 2
MIRT404126 ASB1 ankyrin repeat and SOCS box containing 1 2 2
MIRT404626 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT405284 ARF1 ADP ribosylation factor 1 2 2
MIRT406099 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT446627 SDC3 syndecan 3 2 2
MIRT446906 RGS5 regulator of G protein signaling 5 2 2
MIRT461790 FXR2 FMR1 autosomal homolog 2 2 2
MIRT463982 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT464204 VGLL4 vestigial like family member 4 2 2
MIRT472790 MTMR4 myotubularin related protein 4 2 4
MIRT473485 MCFD2 multiple coagulation factor deficiency 2 2 2
MIRT481124 AZIN1 antizyme inhibitor 1 2 4
MIRT485060 SUCO SUN domain containing ossification factor 2 2
MIRT487343 HLA-DRA major histocompatibility complex, class II, DR alpha 2 2
MIRT491948 VPS52 VPS52, GARP complex subunit 2 2
MIRT497208 CDH7 cadherin 7 2 2
MIRT497476 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT528203 NELFE negative elongation factor complex member E 2 2
MIRT529255 TRIM4 tripartite motif containing 4 2 4
MIRT530096 PSAPL1 prosaposin like 1 (gene/pseudogene) 2 2
MIRT530597 C7orf33 chromosome 7 open reading frame 33 2 4
MIRT534980 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT538326 CSGALNACT1 chondroitin sulfate N-acetylgalactosaminyltransferase 1 2 2
MIRT561237 ZNF652 zinc finger protein 652 2 2
MIRT562035 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT563120 THAP5 THAP domain containing 5 2 2
MIRT563538 RBM41 RNA binding motif protein 41 2 2
MIRT566037 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT566505 PAWR pro-apoptotic WT1 regulator 2 2
MIRT566745 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT566850 LRRC58 leucine rich repeat containing 58 2 2
MIRT568077 CELF2 CUGBP Elav-like family member 2 2 2
MIRT576826 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT608870 NR2E1 nuclear receptor subfamily 2 group E member 1 2 4
MIRT611997 VAC14 Vac14, PIKFYVE complex component 2 2
MIRT614054 FAM89A family with sequence similarity 89 member A 2 2
MIRT618800 SPATA21 spermatogenesis associated 21 2 2
MIRT619389 RSPH3 radial spoke head 3 homolog 2 2
MIRT622282 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624026 EN2 engrailed homeobox 2 2 2
MIRT626000 MPEG1 macrophage expressed 1 2 2
MIRT641792 USP32 ubiquitin specific peptidase 32 2 2
MIRT651599 WDFY2 WD repeat and FYVE domain containing 2 2 2
MIRT659662 CDC73 cell division cycle 73 2 2
MIRT663010 KIAA1586 KIAA1586 2 2
MIRT663561 ASTN2 astrotactin 2 2 2
MIRT669312 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT685216 POTED POTE ankyrin domain family member D 2 2
MIRT695757 ZNF117 zinc finger protein 117 2 2
MIRT697909 TXNRD1 thioredoxin reductase 1 2 2
MIRT707181 RPH3A rabphilin 3A 2 2
MIRT707214 TRIM13 tripartite motif containing 13 2 2
MIRT707478 SLCO4C1 solute carrier organic anion transporter family member 4C1 2 2
MIRT719507 LMAN2L lectin, mannose binding 2 like 2 2
MIRT755814 PARP1 poly(ADP-ribose) polymerase 1 2 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-124 5-aminoimidazole-4-carboxamide-1-β-d-ribofuranoside (AICAR) NULL 16078949 Microarray hepatocytes 23107762 2013 up-regulated
miR-124 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-124 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-124 Cocaine NULL 446220 Quantitative real-time PCR HEK293 cells or rat brain parts 19703567 2009 down-regulated
miR-124 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-124 Chaihu Shugan San NULL NULL Microarray hippocampus 23947143 2013 up-regualted
miR-124 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-124 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) NULL 15625 Microarray embryos 22921993 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-124-5p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-124-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-124-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-124-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-124-5p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission