miRTarBase - #MIRT535209


—
pre-miRNA Information
pre-miRNA hsa-mir-210   
Genomic Coordinates chr11: 568089 - 568198
Synonyms MIRN210, mir-210, MIR210
Description Homo sapiens miR-210 stem-loop
Comment This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-210-3p
Sequence 66| CUGUGCGUGUGACAGCGGCUGA |87
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 12 11 - 568122 25582055 MiREDiBase
A-to-I 14 11 - 568120 26028588 MiREDiBase
C-to-U 1 11 - 568133 26209130 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs753825152 1 dbSNP
rs759616365 3 dbSNP
rs1247955373 6 dbSNP
rs558661304 9 dbSNP
rs1490451308 13 dbSNP
rs1344162213 14 dbSNP
rs745930382 15 dbSNP
rs1220183952 16 dbSNP
rs1355496181 17 dbSNP
rs1280245998 19 dbSNP
rs781628850 20 dbSNP
rs1241231800 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Biomarker Information
Biomarker ID Name Type Discovered From Mode Level Source Testing Methods
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Increase Urine Quantitative real-time reverse transcription PCR
BX0CY6 miR-210 Predictive Biomarker (PRD); Safety Biomarker (SAF) Clinical/Experimental Data Expression Low Blood Reverse transcription-polymerase chain reaction
Gene Information
Gene Symbol PKIA   
Synonyms PRKACN1
Description cAMP-dependent protein kinase inhibitor alpha
Transcript NM_006823   
Other Transcripts NM_181839   
Expression
Putative miRNA Targets on PKIA
3'UTR of PKIA
(miRNA target sites are highlighted)		 
>PKIA|NM_006823|3'UTR
   1 CACCCCACTTTGACCCTCGACCACACCTGAAAATGTCTCAAATCTCCAGGAGTATCTGGAATGCATTTGTTTCCATGAGT
  81 GAAAAGAGGAAAAAGAAAATGGCTGTGCTGCATTGCAGGAACCTGCTCATTATCATGTTAAAAATGAGGGCAGAGGCTGT
 161 GGCTGCAGGCAGACTTTTCCCTACCTCTGTCATTAGCAATGGTTGAAATCATGTGGCTTGTGTTTGGGCGTCATTTTTGT
 241 ATGGATCCTTTCACTTGATCATATGACGAAATGCTTATAGAGAGTAGCTCCGACCTAGATGATGATTCTTCCTGTAGCAT
 321 CTGGCCCCTCACAATGTCAGAGGATTTAATTGTGTCTAATTGCGAAGGGTTGATTGAACCCCAGAGTTTAAATATCTCTG
 401 GCTCAAGTGTTCACCCAGTAAAAGAAAGATCCAGAAAGCACTGTTTTTAGCATTACGTATCTGTGTGTTACTGCTGTGTT
 481 ATTTACACTGTTTTGTATTGTACAATATATATGCTCAGCACTGCCCCCTTCTCTGATTGCTTATGAAAAACAAAATGATG
 561 TACATTACTGTGAATTTTTATACCACTCATTTTTAAAAGGGCTGTCTTTTCATTTTAGTTTTCCATACTGTGGTGGTGTA
 641 CACAGGATAGAACACCCTTTTTTAAAACACAGTCTTTCCCCTTGCTCATTGTATGTTGATGAGTTGATTAAGTCTAACAG
 721 ATTCATCAAGACTCCATTGCTTTATTATAGAGACATTTGAAAATATCCATTAATGTGAATATCACCTGAATTCAGTCTGT
 801 TTGGTGTCTGCACAGACTGGAATTCAATCTGTCAAATTTGTTTTATTCTCAAGTGGAGAACTTCTCCCACATAATATATA
 881 TATATATATATATTTTAATTTATGAGAATTTTGGACAATTGGAAAGGTAGAAAAGAAAAGCCAAGATCATACTAAGGACT
 961 GGAAATATTTTGTTCTATGGAATCAAATTTCTCACAATGCTGTATGATACTATTTAAATTTGGAGGACAACTTATCTTCA
1041 CTAAGCTGAATCAGGTGGAGAAAGTAATCTCCTTGCAATCATGTGGACACCAATCACAAAAGTAAAGCCCTGGTGTTGTG
1121 TTTTCATGTCTTTTTTCAGCCCTCTCAGATCCAAATGTTATTATGCACTTTTTAATGTTTGTAAACTTTTACTAATAATT
1201 AGTGTGAATTGCATTCTGATACAATAATGATTATCATTAGAAGCTAACAAAATTCTCATTAATACTGTGTTTGATGGCCT
1281 CTGCTGTGTTTTAACATCGTGCTTCTTATATGGAAAGTTTTTGTGAGCTGTGTAATCCCTCTGGTCAGTATTATGAAATC
1361 ATTTGTCAGTGGTAATAAATAAGGAACCAGTAATATGCCAATGGTTCATGAATTACTGGACAAATAGCAGACAATGGGAG
1441 TCCCTTTACAATAACGAGCCCACTTAGCTGTCCTTGAGGGCTTAGATACCTTGCCACGTGAAGTAGGTAGAGCAGCATTT
1521 CAATAGGTAATTTGTGTGGTTGTGCCAGAAACTCAGCCCTTCTATGTAATTACATACAGGATAAAAGGTAAGTCTGCTCA
1601 CTTCTCCTTCTACAGGGCATTTCAACTGACTGGAATAAGGGCATGGTTGCATTTAGTACTCAATCAGATATTACTAGAAA
1681 AAAAATTAATAATGTGAGCCTTTCCGAGAGCAGAACGAGGAAAGATTAAATTTTAGAATGCTTCCTTCTGTCTAATCCAT
1761 CAGGGGCCAAAATGCCCAGTAAAATTCAAACACATCACCTATTAATAGACTTACAAGTGAGAAAAGAGGTTCCTAGGGTT
1841 ATTTTAGGCAATCCCTGGTAAACTGTTTAAACCATCAAACCCCTACAGTCAGTTTTCAGTATCCTCATTTAATATTTTAA
1921 TAGGTTTCTTGTGAATTTAAACTTCTCTTCTTTCTTAAGGTTGTGAAATTCCAAACTGATTTTATGTGATTTTGAAAAGT
2001 TTAGAACCAGTGCTGAGTCTATGTGGAGGGTTTATATTCCTATGTGATATACTGTTATTAATGCATGTGGTGCCATGCTT
2081 GTCTTTAAATATATAAATAGTGCTAAATTGCAAAGTCATATGGAGCTTTGGATTTAGTTTGACTTCTTACTACTGCTTTG
2161 TCTGCTATATTCAAACCCAAAGGCATTCCCAAGCTAGGGAGATAAAAATTAATTTTCTAAAATGTCCACATCCTATACAT
2241 TTTGCTTATTCATGGCATCTTTCAAATTTTATTTTAGTTTCCTTTATTTGCCAAGAATACATATGGATTTGAATTTTTAA
2321 GGAGAGAAGGAAAGGGTAGGAAACCAGGGCCTTGGGTTTAGTAACAGGCATTGGATGTCTATTAACCAACTATTCTTACG
2401 CTAATGGCTTTGCAGCTCCTATTCTCCCATTTGATCCTCAAACAATTCTATTAGAGTGGTATTTTTATCCAATTTCACAG
2481 ATTAAAATATAAGCACTCAATAAAATATAACCTTTAGAAGCTTAAAAAGCTAGTAAGTGATGAACTGAGGATTTGAACCC
2561 ATGTTTGTCACCAAGGAGCTTTCCAGGGCACATGTCATAAAATTAGAGCCAACTGCAGAGCTGTAAGGGAACTTTTAGAG
2641 ATGAACTTCTTCAGCCTCCATATTTTACAGAAGGAAACTGAATCCCAGAAGGAGAAATTGCCGTTCTCAAGGCTCCCTGG
2721 ATGGGTAATAACACAGATATGAGTAGGTCACATAAAGTATATCTTTTTTAAAAAAAAGAAATTCAATTATGTCTTATTTG
2801 GGGGGTATATTTCCCAGAAGATATTTTTCTGGCATGTGGTCTGTAAACACAGCATGATTCATATTTTTTATGTTTCATGC
2881 TACTCATTTTGTTTAATTACCAACAAACATGGGGACTTTGGCTTTTTGACTTATTTGCAACAAGCATGAAATTGTTAAAT
2961 TTACCTTTTATCAATTGTAATCATCCTATGCCAACATATTATCATAAATTCATAGAAATATTTTTAAAAATAAATAACAG
3041 ACATTGAAATCCAATTCTTAGATAATACTCCCAGAACAGCCAATGGTAAATGCCCTATACTTGAGTCTTACTTAGATGCT
3121 GTGGTAATGCACCATTTTAGAAGATGAATGATACTGCTATTTCTCTTCAGGGAAACAATAATGGATAAAGAAATGTAACT
3201 GCCGGGCAGCAAAGCTTCTAAGTGAAACCTGTAGTAGCAGTAGTAGTAGGGAGAAAATGTGTAGTCATCAAGTGAAAATA
3281 GGAAAGGATCTATGATTTATGATGTCTTAATAGACCCTAAATTGTTCTTTAATTACAAGAGTGGCAGTCTCTGAAGTCAT
3361 TTGTGAGCTTGTATGACTTTTGTATTTAGCAATGTTGCATGCTCACATAATTGAAAATTAAAAGTAACACATTTTTCTGA
3441 AATGTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agUCGGCGACAGUG-UGCGUGuc 5'
            || :||||| :: |:||||  
Target 5' ttAGATGCTGTGGTAATGCACca 3'
 3112 - 3134 128.00 -16.70
2 
miRNA  3' agucggcgACAGU-GUGCGUGuc 5'
                  |||:| :|:||||  
Target 5' gatccaaaTGTTATTATGCACtt 3'
 1148 - 1170 118.00 -12.90
3 
miRNA  3' agUCG--GCGACAGUGUGCGUGUc 5'
            |||  :|:|| ||::| |||| 
Target 5' ttAGCAATGTTG-CATGCTCACAt 3'
 3386 - 3408 117.00 -14.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30161285 7 COSMIC
COSN26989232 23 COSMIC
COSN30507694 31 COSMIC
COSN31613561 45 COSMIC
COSN31545214 49 COSMIC
COSN20675889 56 COSMIC
COSN17230243 61 COSMIC
COSN30554506 70 COSMIC
COSN30155810 78 COSMIC
COSN30484800 84 COSMIC
COSN30532490 105 COSMIC
COSN30107483 110 COSMIC
COSN31560235 139 COSMIC
COSN30469328 158 COSMIC
COSN31597947 158 COSMIC
COSN30619720 204 COSMIC
COSN31590008 249 COSMIC
COSN31542371 263 COSMIC
COSN31480193 331 COSMIC
COSN31521040 364 COSMIC
COSN31485515 443 COSMIC
COSN31553750 457 COSMIC
COSN31514075 567 COSMIC
COSN15815557 584 COSMIC
COSN24302753 603 COSMIC
COSN28748352 680 COSMIC
COSN8519484 680 COSMIC
COSN31547527 705 COSMIC
COSN21196525 744 COSMIC
COSN9681543 869 COSMIC
COSN29804700 894 COSMIC
COSN28777483 966 COSMIC
COSN27780319 1027 COSMIC
COSN30539713 1049 COSMIC
COSN31548731 1072 COSMIC
COSN7677886 1088 COSMIC
COSN9681544 1092 COSMIC
COSN31607046 1217 COSMIC
COSN31521285 1230 COSMIC
COSN26649691 1331 COSMIC
COSN17799306 1409 COSMIC
COSN9681545 1460 COSMIC
COSN22022051 1522 COSMIC
COSN8519485 1546 COSMIC
COSN30354026 1641 COSMIC
COSN8326973 1644 COSMIC
COSN9681546 1940 COSMIC
COSN22041738 2060 COSMIC
COSN8103313 2253 COSMIC
COSN17308407 2333 COSMIC
COSN14496065 2547 COSMIC
COSN17768240 2599 COSMIC
COSN20616591 2657 COSMIC
COSN17294090 2771 COSMIC
COSN4942055 3291 COSMIC
COSN9681547 3336 COSMIC
COSN23524012 3431 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs867798259 1 dbSNP
rs1440237446 8 dbSNP
rs762591490 9 dbSNP
rs757476130 19 dbSNP
rs774043064 20 dbSNP
rs1244017642 21 dbSNP
rs1360990375 21 dbSNP
rs1432562667 28 dbSNP
rs990158309 30 dbSNP
rs750098380 31 dbSNP
rs760999154 38 dbSNP
rs1305786447 42 dbSNP
rs1403365043 45 dbSNP
rs1351565643 46 dbSNP
rs555016915 48 dbSNP
rs1287354563 49 dbSNP
rs191674190 51 dbSNP
rs1299294752 56 dbSNP
rs1384534016 60 dbSNP
rs533948255 74 dbSNP
rs1313056267 76 dbSNP
rs75753933 80 dbSNP
rs899243326 82 dbSNP
rs1239851263 98 dbSNP
rs1285631573 103 dbSNP
rs948849552 106 dbSNP
rs1420183945 113 dbSNP
rs558462281 114 dbSNP
rs1161717838 115 dbSNP
rs1426699963 125 dbSNP
rs1487419653 129 dbSNP
rs928849873 130 dbSNP
rs184219960 136 dbSNP
rs1426994993 137 dbSNP
rs376135655 161 dbSNP
rs1047880124 164 dbSNP
rs1187519551 172 dbSNP
rs890728112 173 dbSNP
rs543832058 176 dbSNP
rs1009173052 210 dbSNP
rs1006393846 212 dbSNP
rs746261703 212 dbSNP
rs1037330446 213 dbSNP
rs1265513388 214 dbSNP
rs1226195273 223 dbSNP
rs1488120000 229 dbSNP
rs1297433170 230 dbSNP
rs899517420 231 dbSNP
rs995950316 234 dbSNP
rs1252563701 239 dbSNP
rs1301282754 240 dbSNP
rs770126489 245 dbSNP
rs1157503881 262 dbSNP
rs1391456061 263 dbSNP
rs1167432105 268 dbSNP
rs189722115 269 dbSNP
rs574067573 279 dbSNP
rs1171823810 281 dbSNP
rs1480345736 287 dbSNP
rs988403278 289 dbSNP
rs1020803306 291 dbSNP
rs780352013 292 dbSNP
rs1030955839 293 dbSNP
rs957945419 295 dbSNP
rs1194785546 298 dbSNP
rs1267384408 298 dbSNP
rs1366517375 300 dbSNP
rs541564743 307 dbSNP
rs1292358062 310 dbSNP
rs1252773171 316 dbSNP
rs926485970 320 dbSNP
rs1219000811 322 dbSNP
rs938030935 329 dbSNP
rs914590294 332 dbSNP
rs778049793 335 dbSNP
rs1225214387 337 dbSNP
rs980236588 338 dbSNP
rs1328231524 340 dbSNP
rs1801420 345 dbSNP
rs928711016 364 dbSNP
rs920707403 365 dbSNP
rs1351828983 376 dbSNP
rs1248363857 381 dbSNP
rs938898788 388 dbSNP
rs929390504 394 dbSNP
rs1048254380 404 dbSNP
rs551180835 405 dbSNP
rs749654762 408 dbSNP
rs1179065867 409 dbSNP
rs908008760 410 dbSNP
rs1363770339 425 dbSNP
rs1180463223 431 dbSNP
rs1435632761 440 dbSNP
rs1239482061 455 dbSNP
rs944843876 457 dbSNP
rs1039264314 458 dbSNP
rs1202005092 462 dbSNP
rs900194032 462 dbSNP
rs879042741 479 dbSNP
rs1234578296 483 dbSNP
rs1337541532 491 dbSNP
rs1310112542 497 dbSNP
rs900760832 500 dbSNP
rs996503513 502 dbSNP
rs1404252553 505 dbSNP
rs1415471545 506 dbSNP
rs931621864 508 dbSNP
rs1177500711 510 dbSNP
rs1471445310 520 dbSNP
rs1381583920 525 dbSNP
rs1053438393 528 dbSNP
rs1051559660 533 dbSNP
rs893438215 534 dbSNP
rs1240958593 544 dbSNP
rs1009331722 560 dbSNP
rs1446091382 574 dbSNP
rs1203265501 588 dbSNP
rs1021088885 589 dbSNP
rs576780237 591 dbSNP
rs970588509 596 dbSNP
rs1286802424 602 dbSNP
rs1003373248 605 dbSNP
rs1380854278 617 dbSNP
rs1030858991 626 dbSNP
rs566304801 631 dbSNP
rs772613575 637 dbSNP
rs1163099480 638 dbSNP
rs1402903454 643 dbSNP
rs959260211 648 dbSNP
rs893615533 657 dbSNP
rs1010857093 667 dbSNP
rs1382866793 674 dbSNP
rs1183171008 675 dbSNP
rs528723015 680 dbSNP
rs1241252002 686 dbSNP
rs370449011 688 dbSNP
rs1263904742 693 dbSNP
rs527462175 694 dbSNP
rs1357301518 710 dbSNP
rs950749734 719 dbSNP
rs1292124948 721 dbSNP
rs970125446 729 dbSNP
rs983564904 731 dbSNP
rs911927526 732 dbSNP
rs980504320 733 dbSNP
rs1374687543 737 dbSNP
rs1268756586 742 dbSNP
rs1341665748 747 dbSNP
rs1402317072 747 dbSNP
rs944916014 751 dbSNP
rs1363118439 752 dbSNP
rs1166314666 780 dbSNP
rs1405565719 789 dbSNP
rs1418403775 796 dbSNP
rs1454637006 797 dbSNP
rs1165939437 798 dbSNP
rs1478715379 802 dbSNP
rs1316078231 804 dbSNP
rs1238225366 805 dbSNP
rs1378691524 808 dbSNP
rs1198519095 821 dbSNP
rs1189941971 827 dbSNP
rs1489848777 836 dbSNP
rs1222468792 862 dbSNP
rs960115329 871 dbSNP
rs983475174 871 dbSNP
rs1226419668 872 dbSNP
rs908061670 873 dbSNP
rs942188060 873 dbSNP
rs1302662379 874 dbSNP
rs149069891 874 dbSNP
rs374254210 874 dbSNP
rs566697950 874 dbSNP
rs1274808991 875 dbSNP
rs759971804 876 dbSNP
rs866583602 878 dbSNP
rs922175422 882 dbSNP
rs1306496616 885 dbSNP
rs1256060922 889 dbSNP
rs1335805290 891 dbSNP
rs1400639588 891 dbSNP
rs34597437 893 dbSNP
rs867494529 893 dbSNP
rs1462316305 895 dbSNP
rs193061239 897 dbSNP
rs1236590150 899 dbSNP
rs1484410202 900 dbSNP
rs1471578919 901 dbSNP
rs1256961386 907 dbSNP
rs569294604 908 dbSNP
rs73244987 916 dbSNP
rs1478443004 926 dbSNP
rs1283236349 931 dbSNP
rs771298183 937 dbSNP
rs1009606629 946 dbSNP
rs1170669882 950 dbSNP
rs931699938 951 dbSNP
rs1313846241 958 dbSNP
rs1051875478 966 dbSNP
rs1381017540 973 dbSNP
rs1303232148 974 dbSNP
rs548400352 978 dbSNP
rs1358834770 979 dbSNP
rs1042175968 980 dbSNP
rs148672708 998 dbSNP
rs1362464017 1003 dbSNP
rs1384706432 1008 dbSNP
rs1003404138 1014 dbSNP
rs1162866451 1031 dbSNP
rs1425816365 1035 dbSNP
rs6995601 1036 dbSNP
rs1276270695 1041 dbSNP
rs1485162204 1056 dbSNP
rs893667948 1058 dbSNP
rs1218004656 1067 dbSNP
rs1010744209 1069 dbSNP
rs146105381 1077 dbSNP
rs1242100532 1081 dbSNP
rs140078419 1082 dbSNP
rs1027952915 1083 dbSNP
rs185350387 1095 dbSNP
rs1036117594 1112 dbSNP
rs1338323819 1113 dbSNP
rs950751629 1116 dbSNP
rs1488860354 1117 dbSNP
rs1364998129 1125 dbSNP
rs746474410 1130 dbSNP
rs1459621564 1131 dbSNP
rs1369314584 1161 dbSNP
rs1193357234 1169 dbSNP
rs760589732 1173 dbSNP
rs1422136036 1174 dbSNP
rs983855412 1182 dbSNP
rs912015887 1189 dbSNP
rs1194980276 1191 dbSNP
rs1490335922 1197 dbSNP
rs1267526004 1207 dbSNP
rs73244988 1209 dbSNP
rs974775290 1213 dbSNP
rs922116354 1221 dbSNP
rs765469326 1223 dbSNP
rs1412817144 1226 dbSNP
rs1320602768 1232 dbSNP
rs936136837 1235 dbSNP
rs776410776 1239 dbSNP
rs1279898764 1240 dbSNP
rs1219116798 1241 dbSNP
rs1054716434 1256 dbSNP
rs1321637032 1263 dbSNP
rs1388666685 1270 dbSNP
rs761501495 1274 dbSNP
rs1391709139 1283 dbSNP
rs1296066978 1294 dbSNP
rs1347358854 1297 dbSNP
rs963553216 1298 dbSNP
rs945094106 1299 dbSNP
rs1042431527 1300 dbSNP
rs1171890520 1303 dbSNP
rs906302736 1304 dbSNP
rs1049454 1306 dbSNP
rs1480376142 1310 dbSNP
rs973971009 1318 dbSNP
rs1196113046 1324 dbSNP
rs15257 1326 dbSNP
rs922090002 1342 dbSNP
rs939103987 1352 dbSNP
rs1456189548 1368 dbSNP
rs1284571733 1381 dbSNP
rs1259727723 1387 dbSNP
rs769576293 1394 dbSNP
rs1054854094 1399 dbSNP
rs894990113 1403 dbSNP
rs1352501325 1413 dbSNP
rs1199082640 1415 dbSNP
rs1322729012 1435 dbSNP
rs1273066652 1436 dbSNP
rs1235330017 1437 dbSNP
rs1306413566 1442 dbSNP
rs987713997 1442 dbSNP
rs1444808047 1448 dbSNP
rs1379442989 1453 dbSNP
rs1216381837 1455 dbSNP
rs995041726 1456 dbSNP
rs556145458 1457 dbSNP
rs1400529191 1473 dbSNP
rs1261394359 1477 dbSNP
rs765153783 1485 dbSNP
rs911590127 1487 dbSNP
rs934966929 1490 dbSNP
rs773101016 1498 dbSNP
rs143650128 1499 dbSNP
rs886348511 1503 dbSNP
rs1441577167 1504 dbSNP
rs190599500 1508 dbSNP
rs1202059482 1515 dbSNP
rs1018919618 1535 dbSNP
rs1477102700 1540 dbSNP
rs1285359409 1543 dbSNP
rs1160346970 1555 dbSNP
rs1045305779 1556 dbSNP
rs1310185651 1560 dbSNP
rs965989177 1565 dbSNP
rs1419288694 1569 dbSNP
rs1156621308 1578 dbSNP
rs1367147830 1580 dbSNP
rs1384925107 1593 dbSNP
rs553636259 1597 dbSNP
rs572087616 1598 dbSNP
rs1381640208 1600 dbSNP
rs1158833836 1601 dbSNP
rs895842251 1602 dbSNP
rs1329246174 1604 dbSNP
rs1235499891 1605 dbSNP
rs1189408573 1607 dbSNP
rs1443806049 1607 dbSNP
rs1262453400 1618 dbSNP
rs1004836322 1626 dbSNP
rs1309303758 1628 dbSNP
rs1286873203 1643 dbSNP
rs1375697713 1654 dbSNP
rs1227910992 1655 dbSNP
rs957572491 1660 dbSNP
rs1237432744 1662 dbSNP
rs1246073481 1668 dbSNP
rs963437196 1677 dbSNP
rs57998597 1678 dbSNP
rs796638646 1678 dbSNP
rs994892348 1678 dbSNP
rs1298328867 1687 dbSNP
rs953560863 1687 dbSNP
rs1404361366 1690 dbSNP
rs990714928 1693 dbSNP
rs1164762903 1694 dbSNP
rs1210774326 1696 dbSNP
rs1472968552 1697 dbSNP
rs1289848757 1706 dbSNP
rs571979427 1707 dbSNP
rs182160364 1717 dbSNP
rs539304690 1718 dbSNP
rs1220984360 1721 dbSNP
rs927630344 1725 dbSNP
rs532723067 1726 dbSNP
rs146791381 1728 dbSNP
rs1054885163 1745 dbSNP
rs762993262 1747 dbSNP
rs1292362872 1749 dbSNP
rs894895315 1752 dbSNP
rs563132360 1753 dbSNP
rs930529324 1755 dbSNP
rs1049355855 1756 dbSNP
rs914873164 1763 dbSNP
rs530079701 1765 dbSNP
rs1317607816 1767 dbSNP
rs1276722370 1790 dbSNP
rs1220978107 1792 dbSNP
rs1387308761 1796 dbSNP
rs1341723203 1799 dbSNP
rs1270268029 1802 dbSNP
rs886382083 1823 dbSNP
rs1005220577 1826 dbSNP
rs1325035441 1828 dbSNP
rs1405624839 1829 dbSNP
rs1399217898 1839 dbSNP
rs1162412007 1848 dbSNP
rs184894359 1850 dbSNP
rs926476665 1855 dbSNP
rs1411526234 1865 dbSNP
rs1477048915 1871 dbSNP
rs939177490 1874 dbSNP
rs901853192 1875 dbSNP
rs535816752 1876 dbSNP
rs1457521509 1879 dbSNP
rs887018120 1881 dbSNP
rs1200988366 1886 dbSNP
rs1319193127 1890 dbSNP
rs60669505 1895 dbSNP
rs1217978305 1907 dbSNP
rs1276125431 1908 dbSNP
rs1443929854 1928 dbSNP
rs751654878 1937 dbSNP
rs1036322584 1942 dbSNP
rs957671078 1946 dbSNP
rs990354415 1947 dbSNP
rs1020887824 1954 dbSNP
rs114332891 1966 dbSNP
rs981700383 1983 dbSNP
rs1412721617 1986 dbSNP
rs1427326416 1987 dbSNP
rs188242683 2040 dbSNP
rs1259255349 2044 dbSNP
rs570317794 2051 dbSNP
rs1009061145 2054 dbSNP
rs139238535 2055 dbSNP
rs1237294098 2059 dbSNP
rs757331564 2063 dbSNP
rs181081667 2064 dbSNP
rs1245254017 2066 dbSNP
rs1424566914 2073 dbSNP
rs1186618937 2077 dbSNP
rs1021980604 2084 dbSNP
rs916363795 2091 dbSNP
rs930370429 2094 dbSNP
rs1048780468 2119 dbSNP
rs1448539989 2120 dbSNP
rs781321143 2127 dbSNP
rs1302071922 2139 dbSNP
rs1445687769 2145 dbSNP
rs1360890140 2146 dbSNP
rs1476262759 2148 dbSNP
rs1419110860 2152 dbSNP
rs1171380380 2156 dbSNP
rs1399412881 2157 dbSNP
rs967724905 2168 dbSNP
rs1440571387 2169 dbSNP
rs1255875871 2170 dbSNP
rs1484525138 2183 dbSNP
rs1238619630 2186 dbSNP
rs568343399 2196 dbSNP
rs113871383 2204 dbSNP
rs535136044 2209 dbSNP
rs1395025892 2211 dbSNP
rs901758397 2213 dbSNP
rs1317182919 2218 dbSNP
rs1311737639 2220 dbSNP
rs113605744 2226 dbSNP
rs1339141817 2236 dbSNP
rs1050366297 2254 dbSNP
rs893111486 2255 dbSNP
rs908342974 2257 dbSNP
rs1313335541 2260 dbSNP
rs1220849097 2261 dbSNP
rs939958212 2267 dbSNP
rs1399356324 2272 dbSNP
rs868109532 2282 dbSNP
rs1012090254 2287 dbSNP
rs1300166634 2312 dbSNP
rs1038238817 2319 dbSNP
rs1368184062 2321 dbSNP
rs899186482 2323 dbSNP
rs1216901540 2324 dbSNP
rs1020336784 2330 dbSNP
rs1257795540 2337 dbSNP
rs1483707968 2340 dbSNP
rs756292880 2345 dbSNP
rs1200151022 2353 dbSNP
rs1419042885 2360 dbSNP
rs1254330520 2372 dbSNP
rs1477142610 2388 dbSNP
rs1260382827 2393 dbSNP
rs1218244355 2398 dbSNP
rs780401393 2400 dbSNP
rs1003041129 2401 dbSNP
rs1194083611 2403 dbSNP
rs749597883 2404 dbSNP
rs1218927164 2405 dbSNP
rs1422853474 2413 dbSNP
rs1323244322 2418 dbSNP
rs1035979991 2439 dbSNP
rs958932059 2440 dbSNP
rs1217910377 2443 dbSNP
rs1338387278 2445 dbSNP
rs1280167969 2446 dbSNP
rs1382906263 2448 dbSNP
rs1390126589 2453 dbSNP
rs1291936579 2456 dbSNP
rs1050978828 2461 dbSNP
rs571913894 2463 dbSNP
rs990508564 2465 dbSNP
rs150069038 2473 dbSNP
rs1377643418 2474 dbSNP
rs889216675 2479 dbSNP
rs1426480978 2490 dbSNP
rs1194529556 2495 dbSNP
rs112322925 2503 dbSNP
rs1266089845 2504 dbSNP
rs1300788466 2514 dbSNP
rs1386647477 2519 dbSNP
rs767689733 2529 dbSNP
rs1489285942 2533 dbSNP
rs1273545437 2543 dbSNP
rs892611941 2552 dbSNP
rs572579100 2558 dbSNP
rs1315976320 2577 dbSNP
rs1009849871 2590 dbSNP
rs1228071620 2614 dbSNP
rs34200741 2627 dbSNP
rs1340485850 2631 dbSNP
rs1022534167 2632 dbSNP
rs968155469 2633 dbSNP
rs1304030624 2635 dbSNP
rs779442696 2636 dbSNP
rs185411733 2637 dbSNP
rs1312915738 2640 dbSNP
rs1464336342 2647 dbSNP
rs533171607 2659 dbSNP
rs1168953050 2670 dbSNP
rs746548196 2676 dbSNP
rs1254531806 2680 dbSNP
rs1356057785 2683 dbSNP
rs940553498 2684 dbSNP
rs1455301061 2685 dbSNP
rs960489024 2691 dbSNP
rs1040168743 2699 dbSNP
rs923213204 2700 dbSNP
rs386726965 2702 dbSNP
rs931916572 2703 dbSNP
rs1062248 2704 dbSNP
rs893136954 2709 dbSNP
rs939840283 2714 dbSNP
rs974000680 2717 dbSNP
rs1267972274 2718 dbSNP
rs919846094 2722 dbSNP
rs1348700591 2724 dbSNP
rs1173316085 2733 dbSNP
rs1444876878 2736 dbSNP
rs1011539780 2743 dbSNP
rs1050454052 2748 dbSNP
rs1042235347 2755 dbSNP
rs1400777347 2760 dbSNP
rs1170286104 2762 dbSNP
rs1040467414 2770 dbSNP
rs73244995 2770 dbSNP
rs563084671 2771 dbSNP
rs1437463967 2773 dbSNP
rs1365305046 2778 dbSNP
rs1418248036 2782 dbSNP
rs1035843697 2783 dbSNP
rs1009734440 2786 dbSNP
rs958837542 2787 dbSNP
rs1044034042 2789 dbSNP
rs530398377 2793 dbSNP
rs541891381 2802 dbSNP
rs560548807 2805 dbSNP
rs759262392 2808 dbSNP
rs1299232616 2816 dbSNP
rs377754389 2829 dbSNP
rs552263839 2847 dbSNP
rs951839714 2849 dbSNP
rs984464741 2857 dbSNP
rs1356171296 2863 dbSNP
rs1241070249 2864 dbSNP
rs775481177 2864 dbSNP
rs1285565178 2871 dbSNP
rs1351319949 2873 dbSNP
rs1336645288 2878 dbSNP
rs1415973401 2880 dbSNP
rs1375469118 2881 dbSNP
rs961749987 2884 dbSNP
rs1002828118 2887 dbSNP
rs1386774785 2898 dbSNP
rs762834690 2905 dbSNP
rs1158797419 2908 dbSNP
rs975778673 2911 dbSNP
rs923118489 2920 dbSNP
rs1366526237 2923 dbSNP
rs1189913250 2924 dbSNP
rs1475522445 2929 dbSNP
rs960622049 2938 dbSNP
rs1489048864 2941 dbSNP
rs961229410 2942 dbSNP
rs1209474684 2956 dbSNP
rs931784261 2978 dbSNP
rs564231778 2988 dbSNP
rs1177693754 2992 dbSNP
rs919717452 2997 dbSNP
rs1277017470 2999 dbSNP
rs1216329361 3019 dbSNP
rs138761173 3026 dbSNP
rs555509099 3030 dbSNP
rs1167287360 3035 dbSNP
rs1318521989 3041 dbSNP
rs1404415562 3045 dbSNP
rs1351007687 3054 dbSNP
rs763980878 3055 dbSNP
rs774325705 3056 dbSNP
rs910584163 3057 dbSNP
rs549544895 3058 dbSNP
rs1291871712 3060 dbSNP
rs1402624345 3082 dbSNP
rs575252508 3084 dbSNP
rs1476395376 3086 dbSNP
rs1041706727 3087 dbSNP
rs569619575 3089 dbSNP
rs903291944 3095 dbSNP
rs761611127 3097 dbSNP
rs535758898 3114 dbSNP
rs1374925553 3123 dbSNP
rs1229847929 3126 dbSNP
rs1313116083 3128 dbSNP
rs1057209880 3133 dbSNP
rs894648823 3141 dbSNP
rs1317831335 3142 dbSNP
rs1256657506 3148 dbSNP
rs1321056549 3154 dbSNP
rs547344775 3160 dbSNP
rs1270313896 3173 dbSNP
rs1259907417 3177 dbSNP
rs767671236 3178 dbSNP
rs754182006 3180 dbSNP
rs1197430670 3182 dbSNP
rs1441287814 3184 dbSNP
rs1399281910 3202 dbSNP
rs1027682382 3204 dbSNP
rs903996330 3205 dbSNP
rs1183969676 3207 dbSNP
rs191305432 3208 dbSNP
rs750435939 3210 dbSNP
rs1002471891 3215 dbSNP
rs1055767574 3216 dbSNP
rs1194522544 3225 dbSNP
rs1006321541 3237 dbSNP
rs1014608230 3238 dbSNP
rs896195629 3239 dbSNP
rs181875757 3241 dbSNP
rs975809989 3247 dbSNP
rs1273091148 3249 dbSNP
rs1218190561 3250 dbSNP
rs1345133903 3265 dbSNP
rs1029999818 3266 dbSNP
rs961115441 3269 dbSNP
rs866040957 3273 dbSNP
rs985976970 3275 dbSNP
rs1444258016 3280 dbSNP
rs756343766 3282 dbSNP
rs954002127 3300 dbSNP
rs947306948 3301 dbSNP
rs1174440313 3311 dbSNP
rs1439365478 3312 dbSNP
rs1417278335 3315 dbSNP
rs1179387870 3329 dbSNP
rs543421916 3337 dbSNP
rs766576518 3339 dbSNP
rs1450389260 3342 dbSNP
rs1208644029 3346 dbSNP
rs1303228464 3350 dbSNP
rs910977883 3354 dbSNP
rs1234543176 3361 dbSNP
rs924621007 3364 dbSNP
rs938630951 3374 dbSNP
rs766476840 3376 dbSNP
rs1225314297 3378 dbSNP
rs966067157 3379 dbSNP
rs976087210 3383 dbSNP
rs1283461590 3385 dbSNP
rs557924256 3398 dbSNP
rs913863681 3408 dbSNP
rs1412878230 3422 dbSNP
rs945460891 3438 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 5569.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agucggCGACAGUGUGC-GUGUc 5'
                | | | |:| | ||:| 
Target 5' --caaaGAUUUGAUAAGACAUAg 3'
 		1 - 21
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000396418.2 | 3UTR | ACAAAGAUUUGAUAAGACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000396418.2 | 3UTR | CAAAGAUUUGAUAAGACAUAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.511 0 -0.490 0 42 Click to see details
PAAD 0.995 0 1.000 0.5 4 Click to see details
LUAD -0.604 0.02 -0.545 0.03 12 Click to see details
BRCA -0.182 0.05 -0.199 0.03 84 Click to see details
COAD -0.622 0.05 -0.714 0.02 8 Click to see details
CESC -0.986 0.05 -1.000 0.5 3 Click to see details
LUSC 0.257 0.06 0.269 0.05 38 Click to see details
STAD -0.278 0.06 -0.277 0.06 32 Click to see details
UCEC -0.276 0.13 -0.249 0.15 19 Click to see details
BLCA -0.271 0.14 -0.245 0.16 18 Click to see details
KIRP 0.198 0.14 0.111 0.27 32 Click to see details
THCA -0.123 0.18 -0.093 0.24 59 Click to see details
KICH -0.142 0.25 -0.127 0.27 25 Click to see details
KIRC 0.075 0.27 0.082 0.25 68 Click to see details
ESCA -0.182 0.3 -0.264 0.22 11 Click to see details
CHOL 0.172 0.33 0.117 0.38 9 Click to see details
LIHC -0.031 0.42 0.022 0.44 49 Click to see details
PRAD 0.022 0.44 -0.134 0.18 50 Click to see details
PCPG 0.166 0.45 -0.500 0.33 3 Click to see details
PCPG 0.166 0.45 -0.500 0.33 3 Click to see details
PCPG 0.166 0.45 -0.500 0.33 3 Click to see details
126 hsa-miR-210-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT000149 HOXA9 homeobox A9 4 1
MIRT000150 TP53I11 tumor protein p53 inducible protein 11 2 1
MIRT000151 PIM1 Pim-1 proto-oncogene, serine/threonine kinase 2 1
MIRT000152 HOXA1 homeobox A1 2 1
MIRT000153 FGFRL1 fibroblast growth factor receptor like 1 6 3
MIRT000156 RAD52 RAD52 homolog, DNA repair protein 5 3
MIRT001930 NPTX1 neuronal pentraxin 1 3 2
MIRT002024 EFNA3 ephrin A3 8 8
MIRT003153 BDNF brain derived neurotrophic factor 5 1
MIRT003154 PTPN1 protein tyrosine phosphatase, non-receptor type 1 5 1
MIRT003155 P4HB prolyl 4-hydroxylase subunit beta 6 2
MIRT003156 UBQLN1 ubiquilin 1 3 1
MIRT003157 SERTAD2 SERTA domain containing 2 3 1
MIRT003158 SEH1L SEH1 like nucleoporin 3 1
MIRT003159 NCAM1 neural cell adhesion molecule 1 4 1
MIRT003160 MID1IP1 MID1 interacting protein 1 3 1
MIRT003161 MDGA1 MAM domain containing glycosylphosphatidylinositol anchor 1 3 1
MIRT003162 KIAA1161 myogenesis regulating glycosidase (putative) 3 1
MIRT003163 ISCU iron-sulfur cluster assembly enzyme 6 7
MIRT003164 HOXA3 homeobox A3 3 1
MIRT003165 GPD1L glycerol-3-phosphate dehydrogenase 1 like 7 2
MIRT003166 DENND6A DENN domain containing 6A 3 1
MIRT003167 CPEB2 cytoplasmic polyadenylation element binding protein 2 5 1
MIRT003168 CDK10 cyclin dependent kinase 10 3 1
MIRT003169 ABCB9 ATP binding cassette subfamily B member 9 3 1
MIRT003170 CBX1 chromobox 1 3 1
MIRT003171 XIST X inactive specific transcript (non-protein coding) 4 1
MIRT003172 TNPO1 transportin 1 3 1
MIRT003173 SMCHD1 structural maintenance of chromosomes flexible hinge domain containing 1 3 1
MIRT003174 PTAR1 protein prenyltransferase alpha subunit repeat containing 1 3 1
MIRT003175 NIPBL NIPBL, cohesin loading factor 3 1
MIRT003176 MIB1 mindbomb E3 ubiquitin protein ligase 1 3 1
MIRT003177 HECTD1 HECT domain E3 ubiquitin protein ligase 1 3 1
MIRT003178 ELK3 ELK3, ETS transcription factor 3 1
MIRT003179 DDAH1 dimethylarginine dimethylaminohydrolase 1 4 1
MIRT003180 CLASP2 cytoplasmic linker associated protein 2 3 1
MIRT003181 CHD9 chromodomain helicase DNA binding protein 9 3 1
MIRT003182 ATP11C ATPase phospholipid transporting 11C 3 1
MIRT003183 APC APC, WNT signaling pathway regulator 3 1
MIRT003184 E2F3 E2F transcription factor 3 7 5
MIRT003185 ACVR1B activin A receptor type 1B 2 1
MIRT003916 MRE11A MRE11 homolog, double strand break repair nuclease 2 1
MIRT003917 XPA XPA, DNA damage recognition and repair factor 2 1
MIRT004672 MNT MAX network transcriptional repressor 4 2
MIRT006326 AIFM3 apoptosis inducing factor, mitochondria associated 3 3 2
MIRT006519 CASP8AP2 caspase 8 associated protein 2 4 1
MIRT006663 VMP1 vacuole membrane protein 1 3 2
MIRT006830 TFRC transferrin receptor 3 2
MIRT047002 PFDN2 prefoldin subunit 2 1 1
MIRT047003 U2AF2 U2 small nuclear RNA auxiliary factor 2 1 1
MIRT047004 UBA1 ubiquitin like modifier activating enzyme 1 1 1
MIRT047005 ESPL1 extra spindle pole bodies like 1, separase 1 1
MIRT047006 ACTR1A ARP1 actin related protein 1 homolog A 1 1
MIRT047007 SCN1B sodium voltage-gated channel beta subunit 1 1 1
MIRT047008 RCC2 regulator of chromosome condensation 2 1 1
MIRT053179 HSD17B1 hydroxysteroid 17-beta dehydrogenase 1 2 1
MIRT054098 NDUFA4 NDUFA4, mitochondrial complex associated 4 2
MIRT054099 SDHD succinate dehydrogenase complex subunit D 6 4
MIRT054141 STMN1 stathmin 1 3 1
MIRT054142 DIMT1L DIM1 dimethyladenosine transferase 1 homolog 4 2
MIRT054186 ROD1 polypyrimidine tract binding protein 3 3 1
MIRT054203 ALDH5A1 aldehyde dehydrogenase 5 family member A1 4 1
MIRT054204 FOXN3 forkhead box N3 5 2
MIRT054205 MCM3 minichromosome maintenance complex component 3 4 1
MIRT054206 IGFBP3 insulin like growth factor binding protein 3 6 2
MIRT054207 COL4A2 collagen type IV alpha 2 chain 6 2
MIRT054208 INPP5A inositol polyphosphate-5-phosphatase A 4 1
MIRT054209 EHD2 EH domain containing 2 4 1
MIRT054210 SH3BGRL SH3 domain binding glutamate rich protein like 5 2
MIRT054248 PTPN2 protein tyrosine phosphatase, non-receptor type 2 3 1
MIRT054321 LDHA lactate dehydrogenase A 2 1
MIRT054324 LDHB lactate dehydrogenase B 2 1
MIRT054349 HIF1A hypoxia inducible factor 1 alpha subunit 5 2
MIRT054714 FOXP3 forkhead box P3 3 1
MIRT054794 HIF3A hypoxia inducible factor 3 alpha subunit 3 1
MIRT115688 MGRN1 mahogunin ring finger 1 2 3
MIRT170674 INSIG1 insulin induced gene 1 1 1
MIRT437785 BNIP3 BCL2 interacting protein 3 5 2
MIRT438739 KCMF1 potassium channel modulatory factor 1 1 1
MIRT439407 TNPO3 transportin 3 1 1
MIRT439629 SIPA1L3 signal induced proliferation associated 1 like 3 1 1
MIRT439632 SIN3A SIN3 transcription regulator family member A 1 1
MIRT439740 RPL22 ribosomal protein L22 1 1
MIRT439886 PSAP prosaposin 1 1
MIRT439918 PPP1R2 protein phosphatase 1 regulatory inhibitor subunit 2 1 1
MIRT439928 POU2AF1 POU class 2 associating factor 1 1 1
MIRT440033 ICMT isoprenylcysteine carboxyl methyltransferase 2 3
MIRT440255 MEF2D myocyte enhancer factor 2D 1 1
MIRT440491 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 3
MIRT440570 GIT2 GIT ArfGAP 2 1 1
MIRT440647 FCHSD2 FCH and double SH3 domains 2 1 1
MIRT440830 DEAF1 DEAF1, transcription factor 1 1
MIRT440866 CSNK1E casein kinase 1 epsilon 1 1
MIRT472232 NFIC nuclear factor I C 2 2
MIRT473190 MITF melanogenesis associated transcription factor 2 2
MIRT477856 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT497528 ZNF607 zinc finger protein 607 2 2
MIRT509770 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT524407 CNTNAP5 contactin associated protein like 5 2 4
MIRT535209 PKIA cAMP-dependent protein kinase inhibitor alpha 2 4
MIRT554511 RUNX1T1 RUNX1 translocation partner 1 2 4
MIRT558069 ESCO2 establishment of sister chromatid cohesion N-acetyltransferase 2 2 2
MIRT572273 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT574255 DOCK7 dedicator of cytokinesis 7 2 4
MIRT575621 Foxn3 forkhead box N3 2 2
MIRT575742 Zfp618 zinc finger protein 618 1 1
MIRT609050 VAMP4 vesicle associated membrane protein 4 2 2
MIRT611143 TNRC6B trinucleotide repeat containing 6B 2 4
MIRT699226 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT703060 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT716005 ASB11 ankyrin repeat and SOCS box containing 11 2 2
MIRT731682 BTK Bruton tyrosine kinase 3 1
MIRT733090 DLEU2L deleted in lymphocytic leukemia 2-like 3 0
MIRT733091 BRCA2 BRCA2, DNA repair associated 3 0
MIRT733156 ITGA5 integrin subunit alpha 5 1 0
MIRT733501 GATA1 GATA binding protein 1 3 0
MIRT733503 SMAD2 SMAD family member 2 3 0
MIRT733525 MIR210HG MIR210 host gene 2 0
MIRT733615 TGFBI transforming growth factor beta induced 2 0
MIRT734175 KRAS KRAS proto-oncogene, GTPase 2 0
MIRT734293 PTEN phosphatase and tensin homolog 1 0
MIRT734568 STAT6 signal transducer and activator of transcription 6 1 0
MIRT734966 ADAMTS6 ADAM metallopeptidase with thrombospondin type 1 motif 6 1 0
MIRT736294 ID2 inhibitor of DNA binding 2, HLH protein 1 0
MIRT737104 FABP4 fatty acid binding protein 4, adipocyte 3 0
MIRT756028 NTN4 netrin 4 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-210 Vincristine approved 5978 Quantitative real-time PCR Hep-2 cells 23780424 2013 up-regualted
miR-210 Lenalidomide approved 216326 Quantitative real-time PCR peripheral blood CD14+ monocytes 25287904 2014 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray lymphoblast cell line TK-6 17108120 2006 down-regulated
miR-210 5-Fluorouracil approved 3385 Quantitative real-time PCR colon cancer cells 17702597 2007 down-regulated
miR-210 Arsenic trioxide approved 14888 Microarray HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Arsenic trioxide approved 14888 Quantitative real-time PCR HepG-2 human hepatocellular carcinoma cell line 21175813 2011 up-regulated
miR-210 Ginsenoside Rh2 NULL 119307 Microarray human glioma cells U251 21372826 2011 down-regulated
miR-210 Aidi injection NULL NULL Microarray human breast cancer cells 21563499 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer HB2 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer MDA-MB231 22076154 2011 down-regulated
miR-210 5-aza-2'-deoxycytidine (5-Aza-CdR) approved 451668 Microarray breast cancer SKBR3 22076154 2011 down-regulated
miR-210 Trastuzumab approved NULL Microarray HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Quantitative real-time PCR HER2-positive breast cancer 22384020 2012 down-regulated
miR-210 Trastuzumab approved NULL Microarray BT474 cells 22384020 2012 down-regulated
miR-210 Curcumin NULL 969516 Quantitative real-time PCR Y79 RB cells. 22510010 2012 down-regulated
miR-210 Bicalutamide approved 2375 Microarray prostate 22674191 2012 down-regulated
miR-210 Goserelin approved 47725 Microarray prostate 22674191 2012 down-regulated
miR-210 Olea europaea leaf extract NULL NULL Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Temozolomide approved 5394 Quantitative real-time PCR glioblastoma cells. 22722712 2012 up-regulated
miR-210 Nicotine approved 89594 Microarray Rat adrenal pheochromocytoma PC12 cell 18845019 2009 down-regulated
miR-210 Comfrey NULL 6440495 Microarray rat liver 21370286 2011 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-210 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-210 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-210 Androstenedione 6128 NSC9563 sensitive cell line (MCF-7)
hsa-mir-210 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-210 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-210 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-mir-210 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-mir-210 Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)
hsa-miR-210-3p (E)-1-[3,5-bis[(dimethylamino)methyl]-4-hydroxyphenyl]-3-phenylprop-2-en-1-one 6374691 NSC677784 resistant
hsa-miR-210-3p (e)-3-chloro-3-(4-methoxyphenyl)-2-(4-nitrophenyl)prop-2-enal 5387396 NSC623175 resistant
hsa-miR-210-3p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 resistant
hsa-miR-210-3p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-210-3p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-copper; 2-(2-pyridyl)pyridine 135484845 NSC638302 resistant
hsa-miR-210-3p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 sensitive
hsa-miR-210-3p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 sensitive
hsa-miR-210-3p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 resistant
hsa-miR-210-3p 1-[2-(4-nitrophenyl)-2-oxoethyl]-4-pentylpyridin-1-ium bromide 24181037 NSC4290 resistant
hsa-miR-210-3p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 resistant
hsa-miR-210-3p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-210-3p 1h-benz[g]indol-5-ol, 2-phenyl 371327 NSC645431 resistant
hsa-miR-210-3p 2-[[4-anilino-5-[8-[4-anilino-5-[(1-hydroxynaphthalen-2-yl)oxymethyl]-1,2,4-triazol-3-yl]octyl]-1,2,4-triazol-3-yl]methoxy]naphthalen-1-ol 394049 NSC697167 resistant
hsa-miR-210-3p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 resistant
hsa-miR-210-3p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 resistant
hsa-miR-210-3p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 sensitive
hsa-miR-210-3p 2-hydroxy-5-({(e)-[(10-hydroxyacridin-9(10h)-ylidene)methyl]diazenyl}sulfonyl)benzoic acid 363212 NSC627890 resistant
hsa-miR-210-3p 3'-chloro-3-nitro-o-salicylotoluidide 332278 NSC328477 resistant
hsa-miR-210-3p 3-((4-(methylthio)phenoxy)methyl)-2-oxiranol 366923 NSC636087 resistant
hsa-miR-210-3p 4-(2-phenylethylamino)naphthalene-1,2-dione 367789 NSC637731 resistant
hsa-miR-210-3p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 resistant
hsa-miR-210-3p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 resistant
hsa-miR-210-3p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-210-3p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 resistant
hsa-miR-210-3p 4-acetamido-n-[(e)-(2,4-dichlorophenyl)methylideneamino]-2-methoxybenzamide 9572428 NSC716142 sensitive
hsa-miR-210-3p 4-aminodithiolane-4-carboxylic acid 269217 NSC109825 resistant
hsa-miR-210-3p 4-hydroxy-3-[1-(1-hydroxy-3,4-dioxonaphthalen-2-yl)-3-phenylpropyl]naphthalene-1,2-dione 272651 NSC117274 resistant
hsa-miR-210-3p 4,4-dimethylspiro[1,3,2-oxazaphospholidin-2-ium-2,2'-3h-1,3,2-benzoxazaphosphol-2-ium]-5-one 6330525 NSC351866 resistant
hsa-miR-210-3p 4b-hydroxy-10,10-dimethoxy-9ah-indeno[1,2-a]inden-9-one 363252 NSC628000 resistant
hsa-miR-210-3p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 resistant
hsa-miR-210-3p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 resistant
hsa-miR-210-3p 6-(3-chloropropyl)-3-nitroindeno[1,2-c]isoquinoline-5,11-dione 17755848 NSC731154 resistant
hsa-miR-210-3p 6-benzyloxyhexanal 389877 NSC686505 resistant
hsa-miR-210-3p 7-[(E)-2-(1,6-dimethylquinolin-1-ium-2-yl)ethenyl]-5-methylquinolin-8-ol 135483953 NSC86371 resistant
hsa-miR-210-3p 7-[(naphthalen-1-ylamino)(phenyl)methyl]quinolin-8-ol 256754 NSC84092 resistant
hsa-miR-210-3p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 resistant
hsa-miR-210-3p 7-o,8-o-isopropylidene iriomoteolide 3a 24808220 NSC753164 resistant
hsa-miR-210-3p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 resistant
hsa-miR-210-3p Acetyltrophanthidin 261075 NSC92954 resistant
hsa-miR-210-3p Adenosine, 2-bromo-2'-deoxy- 334838 NSC341936 resistant
hsa-miR-210-3p Asimicinone 393461 NSC695394 resistant
hsa-miR-210-3p Benzo[b]naphtho[2,3-d]furan-6,11-dione, 4-chloro-3-hydroxy 371025 NSC644902 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(2,4-dimethylphenyl)-3-methyl- 363228 NSC627974 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 10-(4-chlorophenyl)-3,7,8-trimethyl- 363246 NSC627992 resistant
hsa-miR-210-3p Benzo[g]pteridine-2,4(3h,10h)-dione, 3-methyl-10-[3-(methylthio)phenyl]- 363242 NSC627988 resistant
hsa-miR-210-3p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 resistant
hsa-miR-210-3p Celcot rm 67277 NSC37168 resistant
hsa-miR-210-3p Cytarabine 6253 NSC287459 approved resistant
hsa-miR-210-3p Destruxin a 122810 NSC361126 resistant
hsa-miR-210-3p Di-p-tolyliodinium bromide 54601177 NSC8985 resistant
hsa-miR-210-3p Diethoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368297 NSC638842 resistant
hsa-miR-210-3p Dihydrorotenone 243725 NSC53866 resistant
hsa-miR-210-3p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 resistant
hsa-miR-210-3p Discorhabdin i 135409047 NSC656206 resistant
hsa-miR-210-3p Dpbq 364074 NSC629713 resistant
hsa-miR-210-3p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 resistant
hsa-miR-210-3p Ethyl 6-hydroxy-4-(4-methoxyphenyl)-6-methyl-3-oxo-2-phenyl-1,4,5,7-tetrahydroindazole-5-carboxylate 392845 NSC693857 resistant
hsa-miR-210-3p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 sensitive
hsa-miR-210-3p Gw612286x 9822610 NSC756278 sensitive
hsa-miR-210-3p Gw811761x 6539382 NSC756375 sensitive
hsa-miR-210-3p Herbimycin 6436247 NSC305978 resistant
hsa-miR-210-3p Hypothemycin 5458809 NSC354462 resistant
hsa-miR-210-3p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 sensitive
hsa-miR-210-3p J3.572.907k 396709 NSC703318 resistant
hsa-miR-210-3p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 resistant
hsa-miR-210-3p Methyl 8-[(4-chlorophenyl)carbamoyl]naphthalene-1-carboxylate 364289 NSC630307 resistant
hsa-miR-210-3p N-(2-morpholin-4-ylethyl)-5-nitroquinolin-4-amine;hydrochloride 372042 NSC646859 resistant
hsa-miR-210-3p N-(3-chloro-1,4-dioxonaphthalen-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)butanamide 369463 NSC641233 resistant
hsa-miR-210-3p N-(3,5-dicyano-2-(4-methylphenyl)-6-oxo-4-phenyl-1(6h)-pyridinyl)-4-methylbenzenesulfonamide 390286 NSC687578 resistant
hsa-miR-210-3p N-[(1E)-1-(1-hydroxypyridin-2-ylidene)ethyl]iminoazepane-1-carbothioamide 5369124 NSC351075 resistant
hsa-miR-210-3p N-[1,1,1,3,3,3-hexafluoro-2-(4-fluoroanilino)propan-2-yl]butanamide 389152 NSC684836 resistant
hsa-miR-210-3p Naphtho[2,3-d]-1,3-dioxepin-6,11-dione, 4-methyl- NSC626868 resistant
hsa-miR-210-3p Naphtho[2,3-d]oxazole-4,9-dione, 2-(1,1-dimethylethyl)- 370622 NSC643915 resistant
hsa-miR-210-3p Niosh/br9826000 359483 NSC620462 resistant
hsa-miR-210-3p NSC619321 NSC619321 sensitive
hsa-miR-210-3p NSC621321 NSC621321 resistant
hsa-miR-210-3p NSC631451 NSC631451 resistant
hsa-miR-210-3p NSC634766 NSC634766 resistant
hsa-miR-210-3p NSC635414 NSC635414 resistant
hsa-miR-210-3p Pentyl 6-(chloromethyl)-2-oxo-2h-chromene-3-carboxylate 402498 NSC716524 resistant
hsa-miR-210-3p Pmp (van) 72508 NSC1906 resistant
hsa-miR-210-3p Scillirosidin, glycoside 222160 NSC7534 resistant
hsa-miR-210-3p Sesbanimide 163490 NSC355461 resistant
hsa-miR-210-3p Snc 80 123924 NSC707484 resistant
hsa-miR-210-3p Streptovaricin b 135443622 NSC156215 resistant
hsa-miR-210-3p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 resistant
hsa-miR-210-3p Tolonium chloride 7083 NSC36758 resistant
hsa-miR-210-3p Z48861686 4784054 NSC745813 resistant
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant High Glioblastoma cell line (U251MG, U251R, U87MG, M059K, M059J)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved resistant High Myelogenous Leukemia cell line (MYL)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colon Cancer cell line (HT-29)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Ehrlich Ascites Tumor cell line (EHR2,P6, P12, P36, P72, EHR2/1.3)
hsa-miR-210-3p Trastuzumab resistant Low Breast Cancer tissue and cell line (BT-474, BTR65)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Vincristine 5978 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Gastric Cancer cell line (SGC7901)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant Low Cervical Cancer tissue and cell line (SiHa, Cask)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Laryngeal Cancer cell line (Hep2)
hsa-miR-210-3p Fluorouracil + Oxaliplatin resistant High Colorectal Cancer tissue
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Prostate Cancer cell line (DU-145)
hsa-miR-210-3p Asparaginate 5460875 sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive Low Pediatric Acute Lymphoblastic Leukemia Reh cells
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive High Esophageal Adenocarcinoma cell line (OE19)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma tissue and cell line (HepG2)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (SW1990)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR20)
hsa-miR-210-3p Taxane 9548828 sensitive High Prostate Cancer cell line (PC-3, PR70)
hsa-miR-210-3p Dexamethasone 5743 NSC34521 approved sensitive High Myeloma cell line (MM1R, MM1S)
hsa-miR-210-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-210-3p Daunorubicin 30323 NSC82151 approved sensitive High Acute Myeloid Leukemia cell line (U-937, KG-1)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Ductal Adenocarcinoma cell line (MIA-PaCa-2)
hsa-miR-210-3p Trametinib 11707110 NSC758246 approved sensitive Low Melanoma cell line (MML-1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant Low Breast Cancer cell line (TAMR4, TAMR8)
hsa-miR-210-3p Aromatase Inhibitor sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Epirubicin 41867 NSC256942 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p Vinorelbine 44424639 approved resistant High Breast Cancer cell line (MDA-MB-231)
hsa-miR-210-3p 1'-Acetoxychavicol acetate 119104 NSC711510 resistant Low Cervical Cancer cell line (Ca Ski, SiHa)
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Vinblastine 442111 NSC90636 approved sensitive Low Renal Cell Cancer cell line (Caki-2)
hsa-miR-210-3p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Cancer cell line (LS174T)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Cholangiocarcinoma cell line (KKU-213, KKU-055, KKU-100)
hsa-miR-210-3p Docetaxel 148124 NSC628503 approved resistant Low Breast Cancer tissue
hsa-miR-210-3p Palbociclib 5330286 NSC758247 approved sensitive High Breast Cancer cell line (T47D)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-210-3p Cetuximab + Folfox(Fluorouracil + Leucovorin + Oxaliplatin) sensitive High Metastatic Colorectal Cancer tissue
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved sensitive Low Colorectal Cancer cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (BXPC-3)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved resistant Low Pancreatic Cancer cell line (PANC-1)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant Low Oral Cancer cell line (SAS, HSC-3, HSC-4)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-210-3p Imatinib 5291 NSC743414 approved sensitive Low Chronic Myelogenous Leukemia tissue
hsa-miR-210-3p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant Low Renal Cell Cancer tissue
hsa-miR-210-3p Temozolomide 5394 NSC362856 approved resistant Low Glioma cell line (U87)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-210-3p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive Low Breast Cancer cell line (MCF-7)
hsa-miR-210-3p Sorafenib 216239 NSC747971 approved resistant High Hepatocellular Carcinoma cell line (PLC/PRF5-R1, PLC/PRF5-R2, PLC/PRF5)
hsa-miR-210-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (A375)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (total RNA)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKVO3ip1)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (HeyA8)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM43)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-210-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-210-3p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-210-3p Exemestane 60198 NSC713563 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone 6013 NSC9700 approved resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Exemestane resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Letrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Anastrozole resistant cell line (MCF-7)
hsa-miR-210-3p Testosterone+Tamoxifen resistant cell line (MCF-7)
hsa-miR-210-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-210-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-210-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-210-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved resistant cell line (SKOV3)
hsa-miR-210-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR4)
hsa-miR-210-3p Tamoxifen 2733525 NSC180973 approved resistant cell line (TamR8)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR200)
hsa-miR-210-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR70)
hsa-miR-210-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (100 nM)
hsa-miR-210-3p Bortezomib 387447 NSC681239 approved sensitive cell line (CCRF-CEM) (200 nM)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-210-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-210-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-210-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-210-3p Cetuximab sensitive tissue (colorectal carcinoma)

Error report submission