miRTarBase - #MIRT535579


—
pre-miRNA Information
pre-miRNA hsa-mir-6868   
Genomic Coordinates chr17: 76098019 - 76098076
Description Homo sapiens miR-6868 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6868-3p
Sequence 38| UUCCUUCUGUUGUCUGUGCAG |58
Evidence Experimental
Experiments Meta-analysis
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM4415890 16 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1268215934 1 dbSNP
rs199573454 9 dbSNP
rs893365109 12 dbSNP
rs370367037 13 dbSNP
rs7208391 16 dbSNP
rs752026363 19 dbSNP
rs113525369 20 dbSNP
Putative Targets

Gene Information
Gene Symbol NUP35   
Synonyms MP-44, MP44, NP44, NUP53
Description nucleoporin 35
Transcript NM_138285   
Expression
Putative miRNA Targets on NUP35
3'UTR of NUP35
(miRNA target sites are highlighted)		 
>NUP35|NM_138285|3'UTR
   1 TAGAACACCAAGAAGGAGGTTGCTACACTAAAACAGAGTTAGCAGAGTGCTGCTGGTTCCTTCGGTTAGTTATATAACTG
  81 TTCCTGCAGTATTGGATAGCTATCTCATACTTCTTTTAGAAAGAAGCCTTTTTCATTAAGGATACAACCTATTTGTAGCT
 161 CGCACTTTAAAAGATGCTTGAGATACATTTTAAAGAAAACTAAAAATCCCTGTAAATAGGATTTTGTGCTTTCTGTAACA
 241 GTGCATGCTTCAGCACAGAAAACTCAGCATTGATTATTGTAAATTAAATAACTGAAATTGTGGTGAGACGTCATAGTCTT
 321 CATGAGAACGTGGGGGTGAATTTCATGAAGGGGAACTATAGTTATTTCTACCGACACAAATATTATAATTAGCAATTTGA
 401 ATTATGGTCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTGTATATGTCCTGTCACAGAGTGTCCTCTT
 481 GGTGTATTCTAAAACGAGCATTCTTTTAAAAAACCTAAAGTTTCTTGATAATAAACATTGTCAATGATATGTG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacguGUC-UGUUG-UCUUCCUu 5'
               :|| ||| | ||||||| 
Target 5' -----TAGAACACCAAGAAGGAg 3'
 1 - 18 152.00 -12.40
2 
miRNA  3' gacGUGUCUGUUG----UCUUCCUu 5'
             | || ||  |    |||| || 
Target 5' tatCTCATACTTCTTTTAGAAAGAa 3'
 101 - 125 112.00 -6.10
3 
miRNA  3' gacgugucuguuguCUUCCUu 5'
                        |||||: 
Target 5' ggggtgaatttcatGAAGGGg 3'
 333 - 353 104.00 -9.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30456805 10 COSMIC
COSN20121741 38 COSMIC
COSN30473700 51 COSMIC
COSN30117268 85 COSMIC
COSN31582962 124 COSMIC
COSN31610760 177 COSMIC
COSN31558241 206 COSMIC
COSN22547835 259 COSMIC
COSN20090687 384 COSMIC
COSN28158758 405 COSMIC
COSN21067206 472 COSMIC
COSN9120420 497 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs773115663 4 dbSNP
rs1249767936 7 dbSNP
rs762537479 9 dbSNP
rs751039361 12 dbSNP
rs759033297 13 dbSNP
rs202005464 14 dbSNP
rs74849582 17 dbSNP
rs79259445 18 dbSNP
rs1404791252 19 dbSNP
rs192556307 26 dbSNP
rs750745259 28 dbSNP
rs377536338 29 dbSNP
rs1259585483 32 dbSNP
rs1396985013 32 dbSNP
rs1385962929 33 dbSNP
rs1297308935 42 dbSNP
rs1298798996 43 dbSNP
rs1179883364 44 dbSNP
rs1332430349 45 dbSNP
rs1383163689 47 dbSNP
rs547826649 49 dbSNP
rs370967150 52 dbSNP
rs755149474 53 dbSNP
rs1232804634 57 dbSNP
rs1335518215 65 dbSNP
rs571989835 69 dbSNP
rs1031805426 77 dbSNP
rs1335558078 82 dbSNP
rs1288950332 97 dbSNP
rs1386446631 101 dbSNP
rs960518640 103 dbSNP
rs1324781939 104 dbSNP
rs1039335592 105 dbSNP
rs1324773875 107 dbSNP
rs183519395 108 dbSNP
rs749709044 110 dbSNP
rs1156878310 111 dbSNP
rs1306726299 111 dbSNP
rs1316284667 115 dbSNP
rs1239618952 117 dbSNP
rs774106282 118 dbSNP
rs1183799409 123 dbSNP
rs1265586670 129 dbSNP
rs557352324 129 dbSNP
rs56987972 130 dbSNP
rs769844038 131 dbSNP
rs1275066002 138 dbSNP
rs536247437 141 dbSNP
rs555424403 143 dbSNP
rs999649704 149 dbSNP
rs1253850819 150 dbSNP
rs775873597 154 dbSNP
rs1329676589 161 dbSNP
rs553435481 162 dbSNP
rs1441118562 163 dbSNP
rs896109684 180 dbSNP
rs572959374 183 dbSNP
rs1396039774 206 dbSNP
rs57022552 210 dbSNP
rs1023152841 218 dbSNP
rs564711138 219 dbSNP
rs1036697862 223 dbSNP
rs575073471 227 dbSNP
rs1385642896 228 dbSNP
rs544135601 240 dbSNP
rs748934668 240 dbSNP
rs764301401 241 dbSNP
rs1476937621 243 dbSNP
rs1193255682 246 dbSNP
rs1454822038 262 dbSNP
rs1255118579 267 dbSNP
rs1206969028 270 dbSNP
rs970239634 284 dbSNP
rs1285620044 292 dbSNP
rs561019003 293 dbSNP
rs919090997 310 dbSNP
rs973534407 311 dbSNP
rs1027744342 312 dbSNP
rs1279978214 314 dbSNP
rs3208309 322 dbSNP
rs1372803421 324 dbSNP
rs983920515 330 dbSNP
rs1161880097 331 dbSNP
rs1326463850 333 dbSNP
rs911911719 334 dbSNP
rs1412630208 336 dbSNP
rs1374629008 346 dbSNP
rs933190736 347 dbSNP
rs966427950 353 dbSNP
rs1365089170 354 dbSNP
rs756764023 354 dbSNP
rs1397170909 359 dbSNP
rs1184965746 362 dbSNP
rs1475142104 366 dbSNP
rs974681495 371 dbSNP
rs1195968292 373 dbSNP
rs1051780198 374 dbSNP
rs1163847476 380 dbSNP
rs889228736 380 dbSNP
rs921846345 383 dbSNP
rs773254221 384 dbSNP
rs72896520 386 dbSNP
rs1213577972 387 dbSNP
rs923732898 391 dbSNP
rs935107086 405 dbSNP
rs766185234 410 dbSNP
rs745814006 411 dbSNP
rs1056602688 420 dbSNP
rs896174962 422 dbSNP
rs1445166594 426 dbSNP
rs999108890 434 dbSNP
rs1012320801 449 dbSNP
rs1416429007 452 dbSNP
rs1368423690 455 dbSNP
rs771941726 457 dbSNP
rs1409542962 464 dbSNP
rs775397957 468 dbSNP
rs1169788155 474 dbSNP
rs1014458687 477 dbSNP
rs1257485706 496 dbSNP
rs546233892 497 dbSNP
rs1486871365 503 dbSNP
rs1023151380 507 dbSNP
rs1203383202 517 dbSNP
rs560204710 518 dbSNP
rs980517713 525 dbSNP
rs1226166305 527 dbSNP
rs1333487315 530 dbSNP
rs908846058 536 dbSNP
rs963411732 537 dbSNP
rs1348411088 538 dbSNP
rs995009999 547 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 129401.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000295119.4 | 3UTR | AGUUCUAGACUCUUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
178 hsa-miR-6868-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT107800 SLC1A1 solute carrier family 1 member 1 2 2
MIRT164443 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT180168 NOTCH2 notch 2 2 2
MIRT363961 IMPAD1 inositol monophosphatase domain containing 1 2 2
MIRT445561 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT468817 RSRC2 arginine and serine rich coiled-coil 2 2 4
MIRT475452 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT478206 DDX6 DEAD-box helicase 6 2 2
MIRT506235 PEX13 peroxisomal biogenesis factor 13 2 4
MIRT507651 CREBRF CREB3 regulatory factor 2 4
MIRT509448 CAPRIN1 cell cycle associated protein 1 2 4
MIRT520196 WASL Wiskott-Aldrich syndrome like 2 2
MIRT521020 SLC38A1 solute carrier family 38 member 1 2 4
MIRT526334 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT527175 LRRTM4 leucine rich repeat transmembrane neuronal 4 2 2
MIRT527348 FAM69C family with sequence similarity 69 member C 2 2
MIRT527514 FOXB1 forkhead box B1 2 4
MIRT527955 MTAP methylthioadenosine phosphorylase 2 2
MIRT528474 STAMBPL1 STAM binding protein like 1 2 2
MIRT528929 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT531496 NONO non-POU domain containing octamer binding 2 2
MIRT531608 ACP1 acid phosphatase 1, soluble 2 2
MIRT535579 NUP35 nucleoporin 35 2 2
MIRT536158 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 6
MIRT536194 MAML2 mastermind like transcriptional coactivator 2 2 2
MIRT549649 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT551819 TMEM138 transmembrane protein 138 2 2
MIRT557174 HOXA11 homeobox A11 2 2
MIRT558889 CCND2 cyclin D2 2 2
MIRT559109 C16orf52 chromosome 16 open reading frame 52 2 2
MIRT569341 EFHC1 EF-hand domain containing 1 2 2
MIRT608169 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT609642 PACS2 phosphofurin acidic cluster sorting protein 2 2 2
MIRT610274 PLCXD3 phosphatidylinositol specific phospholipase C X domain containing 3 2 2
MIRT611130 CTBP2 C-terminal binding protein 2 2 2
MIRT611350 KIAA2018 upstream transcription factor family member 3 2 2
MIRT612894 HMGB1 high mobility group box 1 2 2
MIRT613291 BACE2 beta-site APP-cleaving enzyme 2 2 4
MIRT614162 MYO1F myosin IF 2 2
MIRT614217 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT615474 RPS6KA3 ribosomal protein S6 kinase A3 2 2
MIRT615863 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT616022 PRRG4 proline rich and Gla domain 4 2 2
MIRT616349 RASGEF1B RasGEF domain family member 1B 2 2
MIRT616679 FJX1 four jointed box 1 2 2
MIRT616811 PAPPA-AS1 PAPPA antisense RNA 1 2 2
MIRT616964 LMX1A LIM homeobox transcription factor 1 alpha 2 2
MIRT617067 SPIB Spi-B transcription factor 2 2
MIRT618597 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT618656 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT618914 KLHL4 kelch like family member 4 2 2
MIRT620197 VN1R1 vomeronasal 1 receptor 1 2 2
MIRT620644 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT620762 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621142 RNF122 ring finger protein 122 2 2
MIRT621248 QTRT1 queuine tRNA-ribosyltransferase catalytic subunit 1 2 2
MIRT622711 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT622941 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT623329 MAK16 MAK16 homolog 2 2
MIRT623539 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT624413 CCDC149 coiled-coil domain containing 149 2 2
MIRT624478 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT624574 BCL9L B-cell CLL/lymphoma 9 like 2 2
MIRT624584 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT624685 AR androgen receptor 2 2
MIRT625750 GPC5 glypican 5 2 2
MIRT626539 EMCN endomucin 2 2
MIRT627474 STRN striatin 2 2
MIRT628183 GLP1R glucagon like peptide 1 receptor 2 2
MIRT634165 XKR4 XK related 4 2 2
MIRT634553 LYVE1 lymphatic vessel endothelial hyaluronan receptor 1 2 2
MIRT637463 DEFB105B defensin beta 105B 2 4
MIRT637495 DEFB105A defensin beta 105A 2 4
MIRT638102 ZBTB7A zinc finger and BTB domain containing 7A 2 2
MIRT638313 RNF157 ring finger protein 157 2 2
MIRT639297 OPTN optineurin 2 2
MIRT639588 RGS5 regulator of G protein signaling 5 2 2
MIRT639721 RAB17 RAB17, member RAS oncogene family 2 2
MIRT640060 KPNA6 karyopherin subunit alpha 6 2 2
MIRT640117 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT640387 ZNF785 zinc finger protein 785 2 2
MIRT640579 MYO5A myosin VA 2 2
MIRT640591 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT640627 ZFP30 ZFP30 zinc finger protein 2 2
MIRT640761 GLO1 glyoxalase I 2 2
MIRT640808 ZMAT1 zinc finger matrin-type 1 2 2
MIRT641827 TRIM71 tripartite motif containing 71 2 2
MIRT643955 GALNT13 polypeptide N-acetylgalactosaminyltransferase 13 2 2
MIRT644218 ADD1 adducin 1 2 2
MIRT644356 NDUFAF6 NADH:ubiquinone oxidoreductase complex assembly factor 6 2 2
MIRT644560 SPOP speckle type BTB/POZ protein 2 2
MIRT645486 TRIM63 tripartite motif containing 63 2 2
MIRT645595 MRPS15 mitochondrial ribosomal protein S15 2 2
MIRT645840 BRS3 bombesin receptor subtype 3 2 2
MIRT645944 TTF2 transcription termination factor 2 2 2
MIRT646154 VASH2 vasohibin 2 2 2
MIRT648097 LRRFIP1 LRR binding FLII interacting protein 1 2 2
MIRT648131 JAGN1 jagunal homolog 1 2 2
MIRT648469 TCERG1 transcription elongation regulator 1 2 2
MIRT648954 ZNF385D zinc finger protein 385D 2 4
MIRT649447 ST3GAL6 ST3 beta-galactoside alpha-2,3-sialyltransferase 6 2 2
MIRT649559 POLD3 DNA polymerase delta 3, accessory subunit 2 2
MIRT649641 SAMHD1 SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 2 2
MIRT650541 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT651104 ZNF48 zinc finger protein 48 2 2
MIRT651197 ZNF281 zinc finger protein 281 2 2
MIRT651682 VPS13D vacuolar protein sorting 13 homolog D 2 2
MIRT651995 UBA6 ubiquitin like modifier activating enzyme 6 2 2
MIRT652062 TTC39B tetratricopeptide repeat domain 39B 2 2
MIRT652310 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT654265 RGS17 regulator of G protein signaling 17 2 2
MIRT654402 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT654679 PSMB5 proteasome subunit beta 5 2 2
MIRT654741 PRKCB protein kinase C beta 2 2
MIRT656172 MRPL44 mitochondrial ribosomal protein L44 2 2
MIRT656583 LSAMP limbic system-associated membrane protein 2 2
MIRT656700 LNPEP leucyl and cystinyl aminopeptidase 2 2
MIRT657492 HBEGF heparin binding EGF like growth factor 2 2
MIRT658487 EXOC7 exocyst complex component 7 2 2
MIRT658583 EPHB1 EPH receptor B1 2 2
MIRT658657 EMX2 empty spiracles homeobox 2 2 2
MIRT659123 DENND5B DENN domain containing 5B 2 2
MIRT659188 CYSLTR2 cysteinyl leukotriene receptor 2 2 2
MIRT659329 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT660376 B4GALT6 beta-1,4-galactosyltransferase 6 2 2
MIRT660636 ANKRD50 ankyrin repeat domain 50 2 2
MIRT660689 ANAPC1 anaphase promoting complex subunit 1 2 4
MIRT662434 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT662562 IL2RA interleukin 2 receptor subunit alpha 2 2
MIRT662966 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT666429 SH2B3 SH2B adaptor protein 3 2 2
MIRT668902 CREB1 cAMP responsive element binding protein 1 2 2
MIRT673056 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT687429 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT694785 DHFRL1 dihydrofolate reductase 2 2 2
MIRT708677 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT708853 TMSB4X thymosin beta 4, X-linked 2 2
MIRT709605 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT709993 IFIT1 interferon induced protein with tetratricopeptide repeats 1 2 2
MIRT710881 MTG1 mitochondrial ribosome associated GTPase 1 2 2
MIRT711023 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT711338 FMNL2 formin like 2 2 2
MIRT711351 HMGCR 3-hydroxy-3-methylglutaryl-CoA reductase 2 2
MIRT712163 SURF4 surfeit 4 2 2
MIRT712225 RIMS3 regulating synaptic membrane exocytosis 3 2 2
MIRT713028 MAP3K2 mitogen-activated protein kinase kinase kinase 2 2 2
MIRT713719 CD244 CD244 molecule 2 2
MIRT713970 ASIC4 acid sensing ion channel subunit family member 4 2 2
MIRT714872 SPDL1 spindle apparatus coiled-coil protein 1 2 2
MIRT715837 SZT2 SZT2, KICSTOR complex subunit 2 2
MIRT717031 KRTAP4-9 keratin associated protein 4-9 2 2
MIRT717158 SHB SH2 domain containing adaptor protein B 2 2
MIRT717292 KCTD20 potassium channel tetramerization domain containing 20 2 2
MIRT717670 CDC42BPA CDC42 binding protein kinase alpha 2 2
MIRT717838 NEGR1 neuronal growth regulator 1 2 2
MIRT718148 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT719726 SLC39A11 solute carrier family 39 member 11 2 2
MIRT719909 IL5 interleukin 5 2 2
MIRT720245 FAM83F family with sequence similarity 83 member F 2 2
MIRT720352 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT720803 NUDT5 nudix hydrolase 5 2 2
MIRT720930 PPP1R3E protein phosphatase 1 regulatory subunit 3E 2 2
MIRT721609 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT722090 SUSD1 sushi domain containing 1 2 2
MIRT722271 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722548 FGFR1OP FGFR1 oncogene partner 2 2
MIRT723141 METTL24 methyltransferase like 24 2 2
MIRT723271 TAL2 TAL bHLH transcription factor 2 2 2
MIRT723396 OAF out at first homolog 2 2
MIRT723633 STK25 serine/threonine kinase 25 2 2
MIRT723680 CIRH1A UTP4, small subunit processome component 2 2
MIRT723803 BDKRB2 bradykinin receptor B2 2 2
MIRT723894 NUDT21 nudix hydrolase 21 2 2
MIRT724672 NCAPG non-SMC condensin I complex subunit G 2 2
MIRT724759 PSG4 pregnancy specific beta-1-glycoprotein 4 2 2
MIRT724973 TNS1 tensin 1 2 2
MIRT725046 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT725428 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-6868-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-6868-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-6868-3p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission