pre-miRNA Information
pre-miRNA hsa-mir-4677   
Genomic Coordinates chr1: 243346176 - 243346255
Description Homo sapiens miR-4677 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4677-5p
Sequence 13| UUGUUCUUUGGUCUUUCAGCCA |34
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN10045564 8 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1050583047 19 dbSNP
rs1425855779 21 dbSNP
Putative Targets

Gene Information
Gene Symbol MTRNR2L11
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' accgacuuucUGGUUUCUUGUu 5'
                    ||| ||||||| 
Target 5' -------ccuACCCAAGAACAg 3'
1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 100463489.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1
miRNA  3' accgacuuucUGGUUUCUUGUu 5'
                    ||| ||||||| 
Target 5' ------cccuACCCAAGAACAg 3'
1 - 16
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 100463489.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545215
Method / RBP PAR-CLIP / AGO4
Cell line / Condition HEK293 / Control
Location of target site ENST00000604646.1 | 3UTR | CCUACCCAAGAACAGGGUUUGUUAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000604646.1 | 3UTR | CCCUACCCAAGAACAGGGUUUGUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000604646.1 | 3UTR | CCCUACCCAAGAACAGGGUUUGUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
84 hsa-miR-4677-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080553 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT089446 STAMBP STAM binding protein 2 2
MIRT135057 ADSS adenylosuccinate synthase 2 4
MIRT263519 RPS24 ribosomal protein S24 2 2
MIRT357966 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT384298 GOLT1B golgi transport 1B 2 2
MIRT407003 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT442312 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT443782 ST13 ST13, Hsp70 interacting protein 2 2
MIRT446864 NBPF3 NBPF member 3 2 2
MIRT447642 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT448464 SLC45A4 solute carrier family 45 member 4 2 2
MIRT449117 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT450240 TRIM66 tripartite motif containing 66 2 2
MIRT450265 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450682 RPN2 ribophorin II 2 2
MIRT465594 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT481118 AZIN1 antizyme inhibitor 1 2 4
MIRT497203 CDH7 cadherin 7 2 4
MIRT502954 CCNT2 cyclin T2 2 2
MIRT506337 NUP54 nucleoporin 54 2 4
MIRT509224 KIF14 kinesin family member 14 2 6
MIRT514595 NDUFA12 NADH:ubiquinone oxidoreductase subunit A12 2 4
MIRT515392 ARHGAP21 Rho GTPase activating protein 21 2 4
MIRT525555 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525604 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT533249 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT535778 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535799 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT552784 YAF2 YY1 associated factor 2 2 2
MIRT556213 MB21D2 Mab-21 domain containing 2 2 2
MIRT558192 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT565809 SDCCAG3 serologically defined colon cancer antigen 3 2 2
MIRT566341 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT567792 DEK DEK proto-oncogene 2 2
MIRT572455 ZNF516 zinc finger protein 516 2 2
MIRT572582 HGFAC HGF activator 2 2
MIRT573357 PDE3A phosphodiesterase 3A 2 2
MIRT574649 LMAN2 lectin, mannose binding 2 2 2
MIRT608164 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT610690 FAM89A family with sequence similarity 89 member A 2 2
MIRT618457 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT621924 SYAP1 synapse associated protein 1 2 4
MIRT622279 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624610 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT631040 TAS2R30 taste 2 receptor member 30 2 2
MIRT636153 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT638255 SIX1 SIX homeobox 1 2 2
MIRT638330 RCAN1 regulator of calcineurin 1 2 2
MIRT641621 KIAA1244 ARFGEF family member 3 3 3
MIRT644556 SPOP speckle type BTB/POZ protein 2 2
MIRT645900 LRIF1 ligand dependent nuclear receptor interacting factor 1 2 2
MIRT649115 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT652244 TPI1 triosephosphate isomerase 1 2 2
MIRT657249 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT659857 CAPRIN1 cell cycle associated protein 1 2 4
MIRT665369 XIAP X-linked inhibitor of apoptosis 2 2
MIRT669214 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT682579 CPA4 carboxypeptidase A4 2 2
MIRT698725 STX6 syntaxin 6 2 4
MIRT699788 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT700290 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT710374 LMBR1 limb development membrane protein 1 2 2
MIRT710407 YTHDC1 YTH domain containing 1 2 2
MIRT710569 TNPO1 transportin 1 2 2
MIRT711384 PLEKHG4B pleckstrin homology and RhoGEF domain containing G4B 2 2
MIRT712042 STYK1 serine/threonine/tyrosine kinase 1 2 2
MIRT712717 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713288 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT715649 USP6NL USP6 N-terminal like 2 2
MIRT716167 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT716756 TRABD2A TraB domain containing 2A 2 2
MIRT718209 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT718361 SOX1 SRY-box 1 2 2
MIRT718806 SLC25A33 solute carrier family 25 member 33 2 2
MIRT719339 VGLL4 vestigial like family member 4 2 2
MIRT719671 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT720827 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT722184 DNAJC9 DnaJ heat shock protein family (Hsp40) member C9 2 2
MIRT722398 BCAS2 BCAS2, pre-mRNA processing factor 2 2
MIRT723460 ST8SIA3 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 2 2
MIRT724072 NCKAP1L NCK associated protein 1 like 2 2
MIRT724594 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT725234 PDE1B phosphodiesterase 1B 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4677 Doxorubicin 31703 NSC123127 approved resistant High Triple-Negative Breast Cancer cell line (MDA-MB-231, MDA-MB-468)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-4677 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-4677-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4677-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4677-5p Platinum 23939 sensitive tissue (non-small cell lung cancer)
hsa-miR-4677-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-4677-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)

Error report submission