pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-5691 |
Genomic Coordinates | chr11: 9090312 - 9090379 |
Description | Homo sapiens miR-5691 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | ||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-5691 | |||||||||||||||
Sequence | 9| UUGCUCUGAGCUCCGAGAAAGC |30 | |||||||||||||||
Evidence | Experimental | |||||||||||||||
Experiments | Illumina | |||||||||||||||
SNPs in miRNA |
|
|||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | LIMA1 | ||||||||||||||||||||
Synonyms | EPLIN, SREBP3 | ||||||||||||||||||||
Description | LIM domain and actin binding 1 | ||||||||||||||||||||
Transcript | NM_001113546 | ||||||||||||||||||||
Other Transcripts | NM_001113547 , NM_016357 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on LIMA1 | |||||||||||||||||||||
3'UTR of LIMA1 (miRNA target sites are highlighted) |
>LIMA1|NM_001113546|3'UTR 1 CAAATTGCAATGATGCTGGGCCTTAAATTCATGTTAGTGTTAGCGAGCCACTGCCCTTTGTCAAAATGTGATGCACATAA 81 GCAGGTATCCCAGCATGAAATGTAATTTACTTGGAAGTAACTTTGGAAAAGAATTCCTTCTTAAAATCAAAAACAAAACA 161 AAAAAACACAAAAAACACATTCTAAATACTAGAGATAACTTTACTTAAATTCTTCATTTTAGCAGTGATGATATGCATAA 241 GTGCTGTAAGGCTTGTAACTGGGGAAATATTCCACCTGATAATAGCCCAGATTCTACTGTATTCCCAAAAGGCAATATTA 321 AGGTAGACAGATGATTAGTAGTATATTGTTACACACTATTTTGGAATTAGAGAACATACAGAAGGAATTTAGGGGCTTAA 401 ACATTACGACTGAATGCACTTTAGTATAAAGGGCACAGTTTGTATATTTTTAAATGAATACCAATTTAATTTTTTAGTAT 481 TTACCTGTTAAGAGATTATTTAGTCTTTAAATTTTTTAGGTTAATTTTCTTGCTGTGATATATATGAGGAATTTACTACT 561 TTATGTCCTGCTCTCTAAACTACATCCTGAACTCGACGTCCTGAGGTATAATACAACAGAGCACTTTTTGAGGCAATTGA 641 AAAACCAACCTACACTCTTCGGTGCTTAGAGAGATCTGCTGTCTCCCAAATAAGCTTTTGTATCTGCCAGTGAATTTACT 721 GTACTCCAAATGATTGCTTTCTTTTCTGGTGATATCTGTGCTTCTCATAATTACTGAAAGCTGCAATATTTTAGTAATAC 801 CTTCGGGATCACTGTCCCCCATCTTCCGTGTTAGAGCAAAGTGAAGAGTTTAAAGGAGGAAGAAGAAAGAACTGTCTTAC 881 ACCACTTGAGCTCAGACCTCTAAACCCTGTATTTCCCTTATGATGTCCCCTTTTTGAGACACTAATTTTTAAATACTTAC 961 TAGCTCTGAAATATATTGATTTTTATCACAGTATTCTCAGGGTGAAATTAAACCAACTATAGGCCTTTTTCTTGGGATGA 1041 TTTTCTAGTCTTAAGGTTTGGGGACATTATAAACTTGAGTACATTTGTTGTACACAGTTGATATTCCAAATTGTATGGAT 1121 GGGAGGGAGAGGTGTCTTAAGCTGTAGGCTTTTCTTTGTACTGCATTTATAGAGATTTAGCTTTAATATTTTTTAGAGAT 1201 GTAAAACATTCTGCTTTCTTAGTCTTACCTAGTCTGAAACATTTTTATTCAATAAAGATTTTAATTAAAATTTGAACTTT 1281 TCAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 51474.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000552491.1 | 3UTR | UAUAAUACAACAGAGCACUUUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
91 hsa-miR-5691 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT091162 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | 2 | 2 | ||||||||
MIRT242227 | TTC9 | tetratricopeptide repeat domain 9 | 2 | 4 | ||||||||
MIRT246192 | TXNIP | thioredoxin interacting protein | 2 | 2 | ||||||||
MIRT251553 | DCAF7 | DDB1 and CUL4 associated factor 7 | 2 | 4 | ||||||||
MIRT387267 | SOX9 | SRY-box 9 | 2 | 2 | ||||||||
MIRT463486 | ZC3H11A | zinc finger CCCH-type containing 11A | 2 | 12 | ||||||||
MIRT494446 | BTG2 | BTG anti-proliferation factor 2 | 2 | 2 | ||||||||
MIRT496478 | ADAMTS17 | ADAM metallopeptidase with thrombospondin type 1 motif 17 | 2 | 2 | ||||||||
MIRT501825 | NCOA3 | nuclear receptor coactivator 3 | 2 | 2 | ||||||||
MIRT503072 | C6orf120 | chromosome 6 open reading frame 120 | 2 | 2 | ||||||||
MIRT504755 | TEP1 | telomerase associated protein 1 | 2 | 4 | ||||||||
MIRT505971 | RAB11FIP1 | RAB11 family interacting protein 1 | 2 | 4 | ||||||||
MIRT511868 | GOLGA7 | golgin A7 | 2 | 6 | ||||||||
MIRT512900 | UBL4A | ubiquitin like 4A | 2 | 2 | ||||||||
MIRT513048 | LYPD6 | LY6/PLAUR domain containing 6 | 2 | 6 | ||||||||
MIRT523772 | FAM83D | family with sequence similarity 83 member D | 2 | 2 | ||||||||
MIRT525126 | RPS11 | ribosomal protein S11 | 2 | 2 | ||||||||
MIRT525816 | VIMP | selenoprotein S | 2 | 10 | ||||||||
MIRT531222 | HIST1H2BD | histone cluster 1 H2B family member d | 2 | 2 | ||||||||
MIRT531729 | SLC2A9 | solute carrier family 2 member 9 | 2 | 2 | ||||||||
MIRT536282 | LIMA1 | LIM domain and actin binding 1 | 2 | 2 | ||||||||
MIRT537291 | G3BP1 | G3BP stress granule assembly factor 1 | 2 | 2 | ||||||||
MIRT537724 | ELAVL2 | ELAV like RNA binding protein 2 | 2 | 2 | ||||||||
MIRT547940 | HNRNPA0 | heterogeneous nuclear ribonucleoprotein A0 | 2 | 2 | ||||||||
MIRT554177 | SLC35E2B | solute carrier family 35 member E2B | 2 | 2 | ||||||||
MIRT555015 | RAB2B | RAB2B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT576717 | Wars | tryptophanyl-tRNA synthetase | 2 | 2 | ||||||||
MIRT607484 | HEBP2 | heme binding protein 2 | 2 | 2 | ||||||||
MIRT610786 | KLK2 | kallikrein related peptidase 2 | 2 | 2 | ||||||||
MIRT611491 | ZNF440 | zinc finger protein 440 | 2 | 2 | ||||||||
MIRT613986 | DBT | dihydrolipoamide branched chain transacylase E2 | 2 | 2 | ||||||||
MIRT615782 | KIAA0319L | KIAA0319 like | 2 | 2 | ||||||||
MIRT620563 | WBSCR27 | methyltransferase like 27 | 2 | 4 | ||||||||
MIRT624157 | DGKE | diacylglycerol kinase epsilon | 2 | 2 | ||||||||
MIRT626088 | MKLN1 | muskelin 1 | 2 | 2 | ||||||||
MIRT629481 | GSN | gelsolin | 2 | 2 | ||||||||
MIRT636645 | CDK4 | cyclin dependent kinase 4 | 2 | 2 | ||||||||
MIRT638074 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | 2 | 2 | ||||||||
MIRT638442 | PLXDC2 | plexin domain containing 2 | 2 | 2 | ||||||||
MIRT641025 | KLHL7 | kelch like family member 7 | 2 | 2 | ||||||||
MIRT641539 | MOCOS | molybdenum cofactor sulfurase | 2 | 2 | ||||||||
MIRT643004 | ZNF829 | zinc finger protein 829 | 2 | 2 | ||||||||
MIRT643092 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | 2 | 2 | ||||||||
MIRT644979 | IL2RA | interleukin 2 receptor subunit alpha | 2 | 2 | ||||||||
MIRT645912 | PLXNA3 | plexin A3 | 2 | 2 | ||||||||
MIRT646605 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | 2 | 2 | ||||||||
MIRT648033 | FADS6 | fatty acid desaturase 6 | 2 | 2 | ||||||||
MIRT657491 | HBEGF | heparin binding EGF like growth factor | 2 | 2 | ||||||||
MIRT658381 | FAM26E | calcium homeostasis modulator family member 5 | 2 | 2 | ||||||||
MIRT659695 | CD200 | CD200 molecule | 2 | 2 | ||||||||
MIRT661276 | TEX9 | testis expressed 9 | 2 | 2 | ||||||||
MIRT661348 | DYRK4 | dual specificity tyrosine phosphorylation regulated kinase 4 | 2 | 2 | ||||||||
MIRT662948 | JPH2 | junctophilin 2 | 2 | 2 | ||||||||
MIRT663225 | PPY | pancreatic polypeptide | 2 | 2 | ||||||||
MIRT663280 | SPN | sialophorin | 2 | 2 | ||||||||
MIRT663335 | ZNF74 | zinc finger protein 74 | 2 | 2 | ||||||||
MIRT664344 | C16orf45 | chromosome 16 open reading frame 45 | 2 | 2 | ||||||||
MIRT664855 | TBRG4 | transforming growth factor beta regulator 4 | 2 | 2 | ||||||||
MIRT665484 | VPS53 | VPS53, GARP complex subunit | 2 | 2 | ||||||||
MIRT666428 | SH2B3 | SH2B adaptor protein 3 | 2 | 2 | ||||||||
MIRT668162 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 2 | ||||||||
MIRT670170 | CCDC142 | coiled-coil domain containing 142 | 2 | 2 | ||||||||
MIRT671277 | MTO1 | mitochondrial tRNA translation optimization 1 | 2 | 2 | ||||||||
MIRT672284 | GP2 | glycoprotein 2 | 2 | 2 | ||||||||
MIRT672435 | RAB10 | RAB10, member RAS oncogene family | 2 | 2 | ||||||||
MIRT672646 | SLC25A16 | solute carrier family 25 member 16 | 2 | 4 | ||||||||
MIRT672760 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | 2 | 2 | ||||||||
MIRT672834 | AKR7L | aldo-keto reductase family 7 like (gene/pseudogene) | 2 | 2 | ||||||||
MIRT672841 | ICOSLG | inducible T-cell costimulator ligand | 2 | 2 | ||||||||
MIRT673080 | AK1 | adenylate kinase 1 | 2 | 2 | ||||||||
MIRT673148 | C1orf50 | chromosome 1 open reading frame 50 | 2 | 2 | ||||||||
MIRT673323 | THAP1 | THAP domain containing 1 | 2 | 2 | ||||||||
MIRT673893 | DCTN6 | dynactin subunit 6 | 2 | 2 | ||||||||
MIRT674182 | PLEKHM3 | pleckstrin homology domain containing M3 | 2 | 2 | ||||||||
MIRT674607 | RBBP4 | RB binding protein 4, chromatin remodeling factor | 2 | 2 | ||||||||
MIRT674740 | SLC16A1 | solute carrier family 16 member 1 | 2 | 2 | ||||||||
MIRT675140 | MOGAT1 | monoacylglycerol O-acyltransferase 1 | 2 | 4 | ||||||||
MIRT675194 | NKPD1 | NTPase KAP family P-loop domain containing 1 | 2 | 2 | ||||||||
MIRT675886 | SNAP29 | synaptosome associated protein 29 | 2 | 2 | ||||||||
MIRT679163 | PSMB2 | proteasome subunit beta 2 | 2 | 2 | ||||||||
MIRT680337 | ZNF281 | zinc finger protein 281 | 2 | 2 | ||||||||
MIRT706699 | GPR155 | G protein-coupled receptor 155 | 2 | 2 | ||||||||
MIRT706911 | THAP6 | THAP domain containing 6 | 2 | 2 | ||||||||
MIRT707880 | SLC45A4 | solute carrier family 45 member 4 | 2 | 2 | ||||||||
MIRT709097 | SEPT4 | septin 4 | 2 | 2 | ||||||||
MIRT709408 | FBXL20 | F-box and leucine rich repeat protein 20 | 2 | 2 | ||||||||
MIRT710845 | FAM210A | family with sequence similarity 210 member A | 2 | 2 | ||||||||
MIRT711358 | VPS8 | VPS8, CORVET complex subunit | 2 | 2 | ||||||||
MIRT718590 | SCD5 | stearoyl-CoA desaturase 5 | 2 | 2 | ||||||||
MIRT723649 | RPTN | repetin | 2 | 2 | ||||||||
MIRT724208 | NUP205 | nucleoporin 205 | 2 | 2 |