pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1179 |
Genomic Coordinates | chr15: 88608107 - 88608197 |
Synonyms | MIRN1179, hsa-mir-1179, MIR1179 |
Description | Homo sapiens miR-1179 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1179 | ||||||||||||||||||
Sequence | 15| AAGCAUUCUUUCAUUGGUUGG |35 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | ||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | HNRNPA1 | ||||||||||||||||||||
Synonyms | ALS19, ALS20, HNRPA1, HNRPA1L3, IBMPFD3, UP 1, hnRNP A1, hnRNP-A1 | ||||||||||||||||||||
Description | heterogeneous nuclear ribonucleoprotein A1 | ||||||||||||||||||||
Transcript | NM_002136 | ||||||||||||||||||||
Other Transcripts | NM_031157 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on HNRNPA1 | |||||||||||||||||||||
3'UTR of HNRNPA1 (miRNA target sites are highlighted) |
>HNRNPA1|NM_002136|3'UTR 1 TTAGGAAACAAAGCTTAGCAGGAGAGGAGAGCCAGAGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCA 81 GCCAAGCACAGTGGTGGCAGGGCCTAGCTGCTACAAAGAAGACATGTTTTAGACAAATACTCATGTGTATGGGCAAAAAA 161 CTCGAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCCAACA 241 AAGGGTTTTAATGTAGATTTTTTTTTTTGCACCCCATGCTGTTGATTGCTAAATGTAACAGTCTGATCGTGACGCTGAAT 321 AAATGTCTTTTTTTTAATGTGCTGTGTAAAGTTAGTCTACTCTTAAGCCATCTTGGTAAATTTCCCCAACAGTGTGAAGT 401 TAGAATTCCTTCAGGGTGATGCCAGGTTCTATTTGGAATTTATATACAACCTGCTTGGGTGGAGAAGCCATTGTCTTCGG 481 AAACCTTGGTGTAGTTGAACTGATAGTTACTGTTGTGACCTGAAGTTCACCATTAAAAGGGATTACCCAAGCAAAATCAT 561 GGAATGGTTATAAAAGTGATTGTTGGCACATCCTATGCAATATATCTAAATTGAATAATGGTACCAGATAAAATTATAGA 641 TGGGAATGAAGCTTGTGTATCCATTATCATGTGTAATCAATAAACGATTTAATTCTCTTGAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | hESCs (WA-09) |
Disease | 3178.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
CLIP-seq Support 1 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000546500.1 | 3UTR | CUUCUAUCACAAUUCAAGUUCAAAGCUCU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
56 hsa-miR-1179 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT055796 | PLEKHA1 | pleckstrin homology domain containing A1 | 2 | 2 | ||||||||
MIRT165931 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT193416 | RORA | RAR related orphan receptor A | 2 | 4 | ||||||||
MIRT270559 | SETD1B | SET domain containing 1B | 2 | 2 | ||||||||
MIRT379031 | CDK6 | cyclin dependent kinase 6 | 2 | 2 | ||||||||
MIRT397265 | WEE1 | WEE1 G2 checkpoint kinase | 2 | 2 | ||||||||
MIRT397728 | PAWR | pro-apoptotic WT1 regulator | 2 | 4 | ||||||||
MIRT442893 | MYNN | myoneurin | 2 | 2 | ||||||||
MIRT443223 | ARL5B | ADP ribosylation factor like GTPase 5B | 2 | 2 | ||||||||
MIRT455068 | ARHGAP39 | Rho GTPase activating protein 39 | 2 | 2 | ||||||||
MIRT457420 | CASC5 | kinetochore scaffold 1 | 2 | 2 | ||||||||
MIRT459303 | PHYKPL | 5-phosphohydroxy-L-lysine phospho-lyase | 2 | 2 | ||||||||
MIRT474139 | LIN54 | lin-54 DREAM MuvB core complex component | 2 | 4 | ||||||||
MIRT480804 | BLOC1S2 | biogenesis of lysosomal organelles complex 1 subunit 2 | 2 | 6 | ||||||||
MIRT483224 | ZWINT | ZW10 interacting kinetochore protein | 2 | 2 | ||||||||
MIRT494968 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT496531 | ID2 | inhibitor of DNA binding 2, HLH protein | 2 | 2 | ||||||||
MIRT497593 | SLC23A1 | solute carrier family 23 member 1 | 2 | 2 | ||||||||
MIRT500683 | TRIM37 | tripartite motif containing 37 | 2 | 2 | ||||||||
MIRT506538 | MORF4L1 | mortality factor 4 like 1 | 2 | 4 | ||||||||
MIRT514699 | SOD2 | superoxide dismutase 2 | 2 | 2 | ||||||||
MIRT516421 | ADAMTS4 | ADAM metallopeptidase with thrombospondin type 1 motif 4 | 2 | 2 | ||||||||
MIRT516864 | TYW5 | tRNA-yW synthesizing protein 5 | 2 | 2 | ||||||||
MIRT521048 | SLC2A3 | solute carrier family 2 member 3 | 2 | 4 | ||||||||
MIRT523817 | FAM179A | TOG array regulator of axonemal microtubules 2 | 2 | 4 | ||||||||
MIRT528884 | ATF3 | activating transcription factor 3 | 2 | 2 | ||||||||
MIRT530375 | PCSK1 | proprotein convertase subtilisin/kexin type 1 | 2 | 2 | ||||||||
MIRT536813 | HNRNPA1 | heterogeneous nuclear ribonucleoprotein A1 | 2 | 2 | ||||||||
MIRT537030 | GRIN2B | glutamate ionotropic receptor NMDA type subunit 2B | 2 | 2 | ||||||||
MIRT537864 | EFNA5 | ephrin A5 | 2 | 2 | ||||||||
MIRT544600 | FOXO3 | forkhead box O3 | 2 | 4 | ||||||||
MIRT547016 | PPP1R12A | protein phosphatase 1 regulatory subunit 12A | 2 | 4 | ||||||||
MIRT551016 | DMPK | DM1 protein kinase | 2 | 9 | ||||||||
MIRT551306 | MARVELD2 | MARVEL domain containing 2 | 2 | 2 | ||||||||
MIRT556932 | IREB2 | iron responsive element binding protein 2 | 2 | 2 | ||||||||
MIRT562241 | HMGB1 | high mobility group box 1 | 5 | 2 | ||||||||
MIRT566610 | NR3C1 | nuclear receptor subfamily 3 group C member 1 | 2 | 2 | ||||||||
MIRT567498 | FOXJ3 | forkhead box J3 | 2 | 2 | ||||||||
MIRT573432 | ALDOA | aldolase, fructose-bisphosphate A | 2 | 2 | ||||||||
MIRT575921 | Dmpk | dystrophia myotonica-protein kinase | 2 | 6 | ||||||||
MIRT621349 | AADAC | arylacetamide deacetylase | 2 | 2 | ||||||||
MIRT623719 | HACE1 | HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 | 2 | 2 | ||||||||
MIRT628303 | CREB5 | cAMP responsive element binding protein 5 | 2 | 2 | ||||||||
MIRT629775 | FAM57A | family with sequence similarity 57 member A | 2 | 2 | ||||||||
MIRT668030 | GXYLT2 | glucoside xylosyltransferase 2 | 2 | 2 | ||||||||
MIRT668681 | DPH3 | diphthamide biosynthesis 3 | 2 | 2 | ||||||||
MIRT674268 | ZNF284 | zinc finger protein 284 | 2 | 2 | ||||||||
MIRT681490 | DIP2A | disco interacting protein 2 homolog A | 2 | 2 | ||||||||
MIRT699899 | RUNX1 | runt related transcription factor 1 | 2 | 2 | ||||||||
MIRT700856 | PERP | PERP, TP53 apoptosis effector | 2 | 2 | ||||||||
MIRT701079 | PARD6B | par-6 family cell polarity regulator beta | 2 | 2 | ||||||||
MIRT701503 | NEGR1 | neuronal growth regulator 1 | 2 | 2 | ||||||||
MIRT719117 | MAML1 | mastermind like transcriptional coactivator 1 | 2 | 2 | ||||||||
MIRT720375 | NUDT3 | nudix hydrolase 3 | 2 | 2 | ||||||||
MIRT723639 | STK25 | serine/threonine kinase 25 | 2 | 2 | ||||||||
MIRT737393 | FOXM1 | forkhead box M1 | 4 | 0 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|