miRTarBase - #MIRT537263


—
pre-miRNA Information
pre-miRNA hsa-mir-4473   
Genomic Coordinates chr9: 20411148 - 20411238
Description Homo sapiens miR-4473 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4473
Sequence 57| CUAGUGCUCUCCGUUACAAGUA |78
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs987949614 1 dbSNP
rs1199578146 4 dbSNP
rs1261784605 4 dbSNP
rs950939079 6 dbSNP
rs573478506 9 dbSNP
rs182397728 12 dbSNP
rs963590806 17 dbSNP
rs1452942530 19 dbSNP
rs1016614368 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GALNT3   
Synonyms GalNAc-T3, HFTC, HHS
Description polypeptide N-acetylgalactosaminyltransferase 3
Transcript NM_004482   
Expression
Putative miRNA Targets on GALNT3
3'UTR of GALNT3
(miRNA target sites are highlighted)		 
>GALNT3|NM_004482|3'UTR
   1 GTGTTCCTTAAAATTAAGTTGAAAAAGGAAATATTCTTTCTCATAAAACTGTGACTAGGCATACACTGTAGTTTTTGAAA
  81 ATTATGCAAAAGCAGCTAAATGTAACTTATTCCAAGTGCATTTTTCTTATTTATATCTTTATGTAGCACTACTACAGAAA
 161 TTCTGCAAGTTTCTGTTTCAAAGCACAATAACTAGTAATACCAAAGACTATTTCAAAATGTCCAGATGTAGGGGAAGAGA
 241 TGTTTACAGTATGATGAAAATAATTTTCCAAGTAAAGTGATGTTTGTGTGTTTTGTACACTTAGGGATATATATATATAG
 321 CTACATTCACACACTCACAATTTAAAATATTTCCCCTAGTTTTTTGGGGGGATAGGAAGAAAGATTTGTTACTGTATTTT
 401 TTTAACTACATAAAAATAGATCAATAAATGTCAGCATTGGCCTCTGTGTACAAACCAAGAGCTTTTACAGATCCAGAATT
 481 TATTAGTTTAAAATGCAGGTGAACTTTTTTTTGCGTTTGGTTTACTTGTCTGTCAAATGTTTCCTTAAACATGAAACTGA
 561 ATAAGGAGAAGAGTATTTTTAACACTTAAATTTCTTGGCAAATTTTAAAACATTTTTTAGTCTGTAATACACTCCACTTG
 641 AAGCACTTAAGTCTTCCTTAAATGACTTTTCTTAAGTAATGATACTGTGTGTTTTCCCAAAGCACTTTTAAAAAAATTTT
 721 TATAAATTACTATCTGTTGAAAAGGTGTCCTTTTCCTTTCTTCTAGTATTTTTTTCTTACCAAAATTCACTAATCTTGAA
 801 TGTTTGTGATATTAAATTTCAAATGCAGAATACTTGACTCATTTAAAGCTAAATTTTGTTACTGATTCAATTATAATTGT
 881 AATGGATTTTTGACTTTGTAATGGATTCTTTTCATCAAAAAGCCTTATTTTTTTATCTATGTGGAAAACACAATAAAAAA
 961 TCCTCAACACTATTGTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' auGAACAUUGCCUCUCGUGAUc 5'
            ||| | |:|   ||||||| 
Target 5' atCTT-T-ATG--TAGCACTAc 3'
 135 - 152 142.00 -7.50
2 
miRNA  3' auGA-ACAU---UGCCUCUCGUGAuc 5'
            || |||:    |  | ||||||  
Target 5' taCTGTGTGTTTTCCCAAAGCACTtt 3'
 683 - 708 124.00 -8.76
3 
miRNA  3' augaacauUGCCUCUCGUGAuc 5'
                  ||  : ||||||  
Target 5' tacactccACTTGAAGCACTta 3'
 628 - 649 122.00 -7.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
331780 27 ClinVar
894427 28 ClinVar
331779 143 ClinVar
894426 186 ClinVar
331778 281 ClinVar
331777 318 ClinVar
331776 319 ClinVar
331775 320 ClinVar
331774 515 ClinVar
331773 783 ClinVar
894027 806 ClinVar
331772 870 ClinVar
331771 897 ClinVar
331770 935 ClinVar
331769 937 ClinVar
COSN30452000 6 COSMIC
COSN30474303 7 COSMIC
COSN32062914 18 COSMIC
COSN31499146 24 COSMIC
COSN13946739 27 COSMIC
COSN31599072 36 COSMIC
COSN31585188 40 COSMIC
COSN31526436 57 COSMIC
COSN1804325 61 COSMIC
COSN31547368 78 COSMIC
COSN31586298 120 COSMIC
COSN31573314 131 COSMIC
COSN16714330 138 COSMIC
COSN28244414 185 COSMIC
COSN26563039 186 COSMIC
COSN32057615 186 COSMIC
COSN31545537 271 COSMIC
COSN23360675 307 COSMIC
COSN31538975 315 COSMIC
COSN9114272 684 COSMIC
COSN216716 717 COSMIC
COSN6152604 917 COSMIC
COSN14982187 1143 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs146884408 1 dbSNP
rs1441358218 2 dbSNP
rs112704936 4 dbSNP
rs949650232 17 dbSNP
rs1411062808 23 dbSNP
rs775247455 27 dbSNP
rs1459938916 34 dbSNP
rs751175924 36 dbSNP
rs1200570927 37 dbSNP
rs1366658758 40 dbSNP
rs745692359 40 dbSNP
rs765852862 42 dbSNP
rs1258623795 44 dbSNP
rs1241858554 49 dbSNP
rs907761597 62 dbSNP
rs1292128463 66 dbSNP
rs992689994 71 dbSNP
rs1036329315 87 dbSNP
rs940771268 92 dbSNP
rs1224578140 101 dbSNP
rs909327801 105 dbSNP
rs1351617902 110 dbSNP
rs1248180339 116 dbSNP
rs1441435511 118 dbSNP
rs1292496330 119 dbSNP
rs1393974651 129 dbSNP
rs983953948 136 dbSNP
rs560094844 140 dbSNP
rs1234363018 141 dbSNP
rs771919992 143 dbSNP
rs1177647089 154 dbSNP
rs1385776637 164 dbSNP
rs1445928442 167 dbSNP
rs1163657986 183 dbSNP
rs183674066 186 dbSNP
rs774056375 194 dbSNP
rs975714494 195 dbSNP
rs1397494161 215 dbSNP
rs965290220 220 dbSNP
rs1194621116 227 dbSNP
rs1454133034 242 dbSNP
rs912196420 250 dbSNP
rs1245720581 252 dbSNP
rs1443313268 254 dbSNP
rs987836650 255 dbSNP
rs1374951616 256 dbSNP
rs577885163 263 dbSNP
rs1454704027 264 dbSNP
rs956438725 269 dbSNP
rs115677211 272 dbSNP
rs1378399677 278 dbSNP
rs13429321 281 dbSNP
rs969930594 284 dbSNP
rs1274966993 295 dbSNP
rs1307869145 295 dbSNP
rs1197701369 303 dbSNP
rs748933834 306 dbSNP
rs1462366397 307 dbSNP
rs989193733 309 dbSNP
rs777467692 310 dbSNP
rs575253569 317 dbSNP
rs886055013 318 dbSNP
rs886055012 319 dbSNP
rs1020249634 320 dbSNP
rs140333197 320 dbSNP
rs886055011 320 dbSNP
rs889947897 330 dbSNP
rs1339968401 331 dbSNP
rs1445834691 335 dbSNP
rs77911197 341 dbSNP
rs1464967538 344 dbSNP
rs1271858556 356 dbSNP
rs1362565333 360 dbSNP
rs1217843084 364 dbSNP
rs1276037663 366 dbSNP
rs1325371839 366 dbSNP
rs995869830 371 dbSNP
rs898862052 372 dbSNP
rs1217306395 377 dbSNP
rs1244391799 385 dbSNP
rs555480906 392 dbSNP
rs1037391849 398 dbSNP
rs940322743 404 dbSNP
rs1273240507 410 dbSNP
rs535541886 419 dbSNP
rs1004863950 424 dbSNP
rs1401680551 427 dbSNP
rs566500389 432 dbSNP
rs887857655 437 dbSNP
rs1327314832 438 dbSNP
rs1297642642 446 dbSNP
rs1049585976 451 dbSNP
rs1057399607 472 dbSNP
rs1345762531 481 dbSNP
rs938529041 486 dbSNP
rs1417992726 487 dbSNP
rs1296217357 489 dbSNP
rs867223511 494 dbSNP
rs1223830181 499 dbSNP
rs932105616 504 dbSNP
rs80130906 505 dbSNP
rs574156879 507 dbSNP
rs1174842564 513 dbSNP
rs927098234 513 dbSNP
rs774826168 514 dbSNP
rs144354033 515 dbSNP
rs1188729847 530 dbSNP
rs373178990 532 dbSNP
rs1216546393 537 dbSNP
rs1490943190 542 dbSNP
rs1476184176 548 dbSNP
rs747575057 554 dbSNP
rs1200016187 558 dbSNP
rs912520696 561 dbSNP
rs1048222 567 dbSNP
rs528708894 572 dbSNP
rs987787338 573 dbSNP
rs956602641 575 dbSNP
rs554303172 584 dbSNP
rs956194519 590 dbSNP
rs912851484 609 dbSNP
rs924984500 611 dbSNP
rs987452908 619 dbSNP
rs954241389 621 dbSNP
rs533691845 622 dbSNP
rs1329036516 626 dbSNP
rs539759975 627 dbSNP
rs963112306 629 dbSNP
rs1311323115 631 dbSNP
rs1279718827 634 dbSNP
rs1276236433 641 dbSNP
rs979566680 644 dbSNP
rs1216169372 646 dbSNP
rs1362199035 649 dbSNP
rs1016394361 653 dbSNP
rs1277839255 664 dbSNP
rs1398175591 672 dbSNP
rs1267068580 683 dbSNP
rs1450188274 687 dbSNP
rs191523871 687 dbSNP
rs1057077171 690 dbSNP
rs1002770865 708 dbSNP
rs550502314 709 dbSNP
rs11538293 710 dbSNP
rs960927155 716 dbSNP
rs1015161254 717 dbSNP
rs1005106692 721 dbSNP
rs947167219 722 dbSNP
rs1375684084 726 dbSNP
rs1357989827 730 dbSNP
rs887753271 740 dbSNP
rs1049063453 743 dbSNP
rs530688611 745 dbSNP
rs1246197266 746 dbSNP
rs1265316001 763 dbSNP
rs1354698475 766 dbSNP
rs914661643 768 dbSNP
rs11538294 774 dbSNP
rs1172965443 776 dbSNP
rs996629431 777 dbSNP
rs115493554 783 dbSNP
rs1457468066 795 dbSNP
rs934711426 795 dbSNP
rs1039552276 803 dbSNP
rs1169542374 841 dbSNP
rs1424420162 848 dbSNP
rs912542463 849 dbSNP
rs987038458 857 dbSNP
rs1366576847 858 dbSNP
rs189290881 870 dbSNP
rs1259008259 873 dbSNP
rs758798822 874 dbSNP
rs1399151709 883 dbSNP
rs150039125 892 dbSNP
rs886055010 897 dbSNP
rs921489779 908 dbSNP
rs1402316650 913 dbSNP
rs974221095 914 dbSNP
rs746288555 918 dbSNP
rs1220899322 922 dbSNP
rs1339218761 922 dbSNP
rs1279203376 928 dbSNP
rs1206319989 934 dbSNP
rs144647329 935 dbSNP
rs886055009 937 dbSNP
rs1265165802 953 dbSNP
rs1483621199 955 dbSNP
rs1257601926 957 dbSNP
rs1199937423 961 dbSNP
rs1254067901 963 dbSNP
rs1430211230 980 dbSNP
rs1005032569 991 dbSNP
rs1422691054 992 dbSNP
rs1337312088 995 dbSNP
rs1293973282 997 dbSNP
rs950436201 999 dbSNP
rs1377586286 1015 dbSNP
rs1035782293 1035 dbSNP
rs745423968 1036 dbSNP
rs1465162504 1037 dbSNP
rs1400042271 1039 dbSNP
rs1400743867 1042 dbSNP
rs924901435 1047 dbSNP
rs979155589 1053 dbSNP
rs529333562 1054 dbSNP
rs779239605 1060 dbSNP
rs1217112537 1066 dbSNP
rs916355769 1068 dbSNP
rs560131723 1069 dbSNP
rs184957636 1070 dbSNP
rs1411472470 1080 dbSNP
rs1254293886 1091 dbSNP
rs1486865098 1094 dbSNP
rs756135285 1100 dbSNP
rs12477203 1101 dbSNP
rs1262305058 1103 dbSNP
rs1487226127 1108 dbSNP
rs1011453458 1113 dbSNP
rs1425494723 1117 dbSNP
rs752688437 1119 dbSNP
rs960834060 1123 dbSNP
rs193294976 1131 dbSNP
rs1015066422 1133 dbSNP
rs1237338234 1135 dbSNP
rs544569972 1137 dbSNP
rs1159788325 1138 dbSNP
rs1360442031 1141 dbSNP
rs983630722 1157 dbSNP
rs575843062 1159 dbSNP
rs1295629292 1169 dbSNP
rs1368619591 1172 dbSNP
rs952335435 1174 dbSNP
rs1299401658 1182 dbSNP
rs1053239229 1183 dbSNP
rs934723920 1186 dbSNP
rs1469977681 1188 dbSNP
rs767291380 1190 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 2591.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' auGAACAUUGCCUCUCGUGAUc 5'
            ||| | |:|   ||||||| 
Target 5' auCUU-U-AUG--UAGCACUAc 3'
 		17 - 34
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000392701.3 | 3UTR | CAUUUUUCUUAUUUAUAUCUUUAUGUAGCACUACUACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
53 hsa-miR-4473 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT193963 GLCE glucuronic acid epimerase 2 2
MIRT232832 NUPL1 nucleoporin 58 2 2
MIRT306237 ZMAT3 zinc finger matrin-type 3 2 4
MIRT441353 ZNF75A zinc finger protein 75a 2 2
MIRT443665 FLT1 fms related tyrosine kinase 1 2 2
MIRT448553 RAP1A RAP1A, member of RAS oncogene family 2 2
MIRT448625 OSBPL8 oxysterol binding protein like 8 2 2
MIRT449138 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT462942 ZNF800 zinc finger protein 800 2 12
MIRT463962 WIPF2 WAS/WASL interacting protein family member 2 2 2
MIRT466315 THRA thyroid hormone receptor, alpha 2 2
MIRT493504 IL6ST interleukin 6 signal transducer 2 2
MIRT502727 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT503464 ZNF154 zinc finger protein 154 2 6
MIRT506738 LMLN leishmanolysin like peptidase 2 4
MIRT507282 FEM1B fem-1 homolog B 2 2
MIRT510711 SPG20 spartin 2 6
MIRT524495 CEP170 centrosomal protein 170 2 4
MIRT529425 MALT1 MALT1 paracaspase 2 2
MIRT533482 TRIM71 tripartite motif containing 71 2 2
MIRT533715 TMEM30A transmembrane protein 30A 2 2
MIRT534115 SOCS3 suppressor of cytokine signaling 3 2 2
MIRT534473 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT536519 KCTD10 potassium channel tetramerization domain containing 10 2 2
MIRT537263 GALNT3 polypeptide N-acetylgalactosaminyltransferase 3 2 2
MIRT537597 ESRP2 epithelial splicing regulatory protein 2 2 2
MIRT537918 DSTYK dual serine/threonine and tyrosine protein kinase 2 2
MIRT538074 DIAPH2 diaphanous related formin 2 2 2
MIRT538707 CAPRIN2 caprin family member 2 2 4
MIRT546187 TPD52 tumor protein D52 2 4
MIRT546942 SFTPA1 surfactant protein A1 2 2
MIRT549590 TMEM101 transmembrane protein 101 2 2
MIRT551686 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT551948 RNF157 ring finger protein 157 2 2
MIRT553176 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT555074 PURG purine rich element binding protein G 2 2
MIRT556214 MB21D2 Mab-21 domain containing 2 2 2
MIRT556476 LIPA lipase A, lysosomal acid type 2 2
MIRT556683 KLHL28 kelch like family member 28 2 2
MIRT556863 JMY junction mediating and regulatory protein, p53 cofactor 2 2
MIRT558402 DEPDC1 DEP domain containing 1 2 2
MIRT558716 CLCN3 chloride voltage-gated channel 3 2 2
MIRT559512 ARHGEF26 Rho guanine nucleotide exchange factor 26 2 2
MIRT566872 LRP12 LDL receptor related protein 12 2 2
MIRT567038 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT574515 PRC1 protein regulator of cytokinesis 1 2 2
MIRT642220 RABAC1 Rab acceptor 1 2 2
MIRT651915 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT654128 RPL14 ribosomal protein L14 2 2
MIRT654344 RBM27 RNA binding motif protein 27 2 2
MIRT669250 C4orf36 chromosome 4 open reading frame 36 2 2
MIRT683176 UBL3 ubiquitin like 3 2 2
MIRT718768 ABHD15 abhydrolase domain containing 15 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4473 Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-miR-4473 Ceritinib 57379345 NSC776422 approved sensitive High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-4473 Vincristine 5978 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-4473 Doxorubicin 31703 NSC123127 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-4473 Etoposide 36462 NSC141540 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-4473 Vinorelbine 44424639 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-miR-4473 Paclitaxel 36314 NSC125973 approved sensitive High Colorectal Cancer cell line (HCT8)
hsa-mir-4473 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-4473 Ceritinib 57379345 NSC776422 approved sensitive cell line (H3122)
hsa-miR-4473 Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-4473 Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil resistant tissue (myasthenia gravis)

Error report submission