miRTarBase - #MIRT537417


—
pre-miRNA Information
pre-miRNA hsa-mir-3133   
Genomic Coordinates chr2: 241477905 - 241477982
Description Homo sapiens miR-3133 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3133
Sequence 10| UAAAGAACUCUUAAAACCCAAU |31
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1030052469 1 dbSNP
rs955010137 12 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FBXO47   
Synonyms -
Description F-box protein 47
Transcript NM_001008777   
Expression
Putative miRNA Targets on FBXO47
3'UTR of FBXO47
(miRNA target sites are highlighted)		 
>FBXO47|NM_001008777|3'UTR
   1 ATCCTCAGAAAGCCTTGCCTTTAGAGAACGTCACTGAACGAATGATTAGAGGAGTGCTACTTTTTCACTCAAAAAATAGC
  81 ATCCATGGGACTTTTTATCATCTAAGTAACCTAAGAATTCAAAAGCTGGATAGAATTTTAGAAGCAACTACGTACATCAT
 161 TATTAATATAAAAATAACAGGCAGCCTCAAGAATGTGCTGAGATTTCTCTGGAAAACAAGCTCTGCCTCTCCGGGTTTTA
 241 GTCAACCTAACACCAAACCAAAATAGAATGTTAGCTGTTCAAGAATCTGGGACCAGCCAACCTGTATGTATGCATTTTTG
 321 AAGCAAGAGAAAATTCCATTTTATAGTTAGACCCAAATTCACTAAATAGTGTGTATGTTCACTTTGTTTAAGTTGTATAG
 401 ACATAGCCCAGAATGTTTTGTGAAGATTTGCAATATGGTGTTTTGGAATGTGTAGAATACAAATCACAGTTTTTACTACC
 481 TTCTTGGCATATGCTTACAAAGAACATTATATTTTGTTCATGTTTTACATGAACTAATGGATAAAAAACAAAGTATACAT
 561 ATATGTCTATATATATATATAGACACACACACACAGACATATATTTCCTTCTTTAAGGTAATCATACAAAAGGTCTATAC
 641 ATACAGGAAGGTATATATTGTCTCAATGCAATCAAATCATCTTTTACTGGGGATTCAAATAAAATGTAGCAAATAAGAGA
 721 AAAATAAAATGAAAGAAAATAGC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaaccCAAAAUUCUCAAGAAAu 5'
               ||  |:||| |||| | 
Target 5' agaatGTGCTGAGATTTCTCTg 3'
 190 - 211 101.00 -6.20
2 
miRNA  3' uaaccCAAAA--UUCU--CAAGAAAu 5'
               | |||  || |  || :||| 
Target 5' gtgaaGATTTGCAATATGGTGTTTTg 3'
 420 - 445 101.00 -5.17
3 
miRNA  3' uaacccaAAAUUCUCAAGAaau 5'
                 | |  |:|||:|   
Target 5' ctctgccTCTCCGGGTTTTagt 3'
 221 - 242 91.00 -7.57
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30150849 8 COSMIC
COSN31613717 12 COSMIC
COSN31501491 14 COSMIC
COSN31593608 15 COSMIC
COSN19732476 39 COSMIC
COSN30489821 40 COSMIC
COSN30101154 53 COSMIC
COSN30178339 77 COSMIC
COSN30186959 111 COSMIC
COSN28869091 121 COSMIC
COSN28816528 128 COSMIC
COSN31525895 133 COSMIC
COSN19386857 390 COSMIC
COSN20113874 568 COSMIC
COSN1718730 599 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1051938457 13 dbSNP
rs755425778 14 dbSNP
rs1265722305 19 dbSNP
rs754162621 24 dbSNP
rs780539908 29 dbSNP
rs370967139 30 dbSNP
rs749935471 39 dbSNP
rs1485778789 40 dbSNP
rs377610296 40 dbSNP
rs1398242535 41 dbSNP
rs1329776039 42 dbSNP
rs1181078920 43 dbSNP
rs1325738760 51 dbSNP
rs188856616 54 dbSNP
rs1473490854 57 dbSNP
rs1323827779 58 dbSNP
rs892752969 60 dbSNP
rs1054183407 66 dbSNP
rs1413926861 85 dbSNP
rs1174079325 90 dbSNP
rs1377392883 101 dbSNP
rs8072207 102 dbSNP
rs905213102 106 dbSNP
rs1307721741 110 dbSNP
rs948966605 111 dbSNP
rs917456383 115 dbSNP
rs753042066 120 dbSNP
rs1344965185 125 dbSNP
rs1218024750 129 dbSNP
rs929087332 151 dbSNP
rs918986662 152 dbSNP
rs1204001615 169 dbSNP
rs973499285 179 dbSNP
rs949481895 180 dbSNP
rs917744640 183 dbSNP
rs594415 185 dbSNP
rs986079287 194 dbSNP
rs954604941 195 dbSNP
rs1192900141 221 dbSNP
rs1030192035 226 dbSNP
rs1396951555 228 dbSNP
rs1009390020 232 dbSNP
rs551863145 233 dbSNP
rs1368972839 239 dbSNP
rs929867898 241 dbSNP
rs1411963714 243 dbSNP
rs956333080 245 dbSNP
rs1434931266 249 dbSNP
rs1306365375 255 dbSNP
rs1371013586 262 dbSNP
rs1227041677 266 dbSNP
rs1031731893 268 dbSNP
rs555985271 285 dbSNP
rs1385601514 297 dbSNP
rs539543102 314 dbSNP
rs755453959 323 dbSNP
rs1449710676 327 dbSNP
rs1215482301 332 dbSNP
rs919875360 337 dbSNP
rs1444222136 339 dbSNP
rs1454727959 343 dbSNP
rs1188041736 358 dbSNP
rs1388445317 363 dbSNP
rs1476501500 369 dbSNP
rs750098782 369 dbSNP
rs1390463468 376 dbSNP
rs184155803 395 dbSNP
rs1328450757 396 dbSNP
rs1395879257 403 dbSNP
rs1044790376 406 dbSNP
rs1195428025 415 dbSNP
rs1013145456 427 dbSNP
rs151224893 433 dbSNP
rs765024576 435 dbSNP
rs1227686012 437 dbSNP
rs1283304480 452 dbSNP
rs1353913668 455 dbSNP
rs192679400 455 dbSNP
rs1215349775 460 dbSNP
rs1273694777 463 dbSNP
rs1017959842 465 dbSNP
rs1464362802 466 dbSNP
rs1206800930 479 dbSNP
rs1429162860 480 dbSNP
rs896059642 490 dbSNP
rs986507752 517 dbSNP
rs1368132996 546 dbSNP
rs1474400801 550 dbSNP
rs955147946 552 dbSNP
rs1167584972 559 dbSNP
rs761386773 561 dbSNP
rs1203874174 565 dbSNP
rs199733207 567 dbSNP
rs201417957 569 dbSNP
rs200964012 571 dbSNP
rs3760153 571 dbSNP
rs1009767169 576 dbSNP
rs1386486088 578 dbSNP
rs892692895 579 dbSNP
rs200352802 580 dbSNP
rs1172368046 582 dbSNP
rs1234792813 582 dbSNP
rs1338370584 582 dbSNP
rs3834564 582 dbSNP
rs397840955 582 dbSNP
rs398058699 582 dbSNP
rs763599921 582 dbSNP
rs1205820741 586 dbSNP
rs1001540019 594 dbSNP
rs1037422988 596 dbSNP
rs1255680678 596 dbSNP
rs941766206 596 dbSNP
rs1258635408 601 dbSNP
rs1356841337 605 dbSNP
rs1472506688 608 dbSNP
rs748425756 614 dbSNP
rs561660234 616 dbSNP
rs910255894 617 dbSNP
rs1366071987 624 dbSNP
rs985772962 625 dbSNP
rs905159908 628 dbSNP
rs374374893 630 dbSNP
rs1325329519 636 dbSNP
rs933251042 637 dbSNP
rs1416232247 641 dbSNP
rs1045082188 646 dbSNP
rs1293400276 647 dbSNP
rs35705041 648 dbSNP
rs546457983 650 dbSNP
rs923154008 651 dbSNP
rs1407786043 656 dbSNP
rs1309002297 666 dbSNP
rs987991398 678 dbSNP
rs956526145 692 dbSNP
rs1009161216 710 dbSNP
rs1302327024 716 dbSNP
rs1032180566 717 dbSNP
rs1213285928 717 dbSNP
rs1281310370 722 dbSNP
rs1422449569 730 dbSNP
rs796899187 734 dbSNP
rs528290298 744 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 494188.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000378079.2 | 3UTR | AUAUAUUUCCUUCUUUAAGGUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
174 hsa-miR-3133 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057804 SLC30A7 solute carrier family 30 member 7 2 2
MIRT075401 ZFHX3 zinc finger homeobox 3 2 2
MIRT088350 MAPRE3 microtubule associated protein RP/EB family member 3 2 6
MIRT107288 FAM73B mitoguardin 2 2 2
MIRT141571 ABHD2 abhydrolase domain containing 2 2 2
MIRT161036 CDV3 CDV3 homolog 2 2
MIRT167732 RNF146 ring finger protein 146 8 3
MIRT209559 PAK2 p21 (RAC1) activated kinase 2 2 2
MIRT214631 SMAD5 SMAD family member 5 2 8
MIRT258393 KIAA0895 KIAA0895 2 2
MIRT272744 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT309347 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 6
MIRT329705 SCD stearoyl-CoA desaturase 2 2
MIRT336556 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT363351 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT386753 TAOK1 TAO kinase 1 2 2
MIRT441580 EXOC5 exocyst complex component 5 2 2
MIRT441735 SEPT8 septin 8 2 2
MIRT441817 LRRC40 leucine rich repeat containing 40 2 2
MIRT442180 TRIM59 tripartite motif containing 59 2 4
MIRT442277 TLX3 T-cell leukemia homeobox 3 2 2
MIRT442489 TBC1D19 TBC1 domain family member 19 2 2
MIRT443242 ANKRD26 ankyrin repeat domain 26 2 2
MIRT443270 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT444114 CEPT1 choline/ethanolamine phosphotransferase 1 2 2
MIRT444725 LAMA2 laminin subunit alpha 2 2 2
MIRT445346 FAM169A family with sequence similarity 169 member A 2 2
MIRT445693 GJB1 gap junction protein beta 1 2 2
MIRT446051 CDC73 cell division cycle 73 2 2
MIRT447746 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT447955 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT449199 ZNF623 zinc finger protein 623 2 2
MIRT449564 GPC5 glypican 5 2 2
MIRT450938 BDP1 B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB 2 2
MIRT459811 POTED POTE ankyrin domain family member D 2 8
MIRT461692 ZNF426 zinc finger protein 426 2 2
MIRT462014 SNRNP27 small nuclear ribonucleoprotein U4/U6.U5 subunit 27 2 2
MIRT465150 TSC22D2 TSC22 domain family member 2 2 2
MIRT467144 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT474929 KCTD15 potassium channel tetramerization domain containing 15 2 8
MIRT475118 IPPK inositol-pentakisphosphate 2-kinase 2 2
MIRT476844 FIGN fidgetin, microtubule severing factor 2 10
MIRT477336 EPHA2 EPH receptor A2 2 2
MIRT477853 DYRK3 dual specificity tyrosine phosphorylation regulated kinase 3 2 2
MIRT481113 B2M beta-2-microglobulin 2 2
MIRT481296 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT485094 SLC30A1 solute carrier family 30 member 1 2 4
MIRT491908 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT492458 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 8
MIRT493341 LAPTM4A lysosomal protein transmembrane 4 alpha 2 12
MIRT494771 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT497837 GPR26 G protein-coupled receptor 26 2 2
MIRT497958 DGAT2 diacylglycerol O-acyltransferase 2 2 2
MIRT498445 INO80D INO80 complex subunit D 2 2
MIRT498997 HAT1 histone acetyltransferase 1 2 10
MIRT499257 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT500067 SFT2D2 SFT2 domain containing 2 2 4
MIRT501385 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT503084 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503272 SLC7A5 solute carrier family 7 member 5 2 2
MIRT504341 ASGR2 asialoglycoprotein receptor 2 2 2
MIRT505453 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 6
MIRT505905 RIMS3 regulating synaptic membrane exocytosis 3 2 6
MIRT507917 C7orf60 base methyltransferase of 25S rRNA 2 homolog 2 6
MIRT508174 FRK fyn related Src family tyrosine kinase 2 4
MIRT508287 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT509232 KIF14 kinesin family member 14 2 6
MIRT509481 GNL3L G protein nucleolar 3 like 2 6
MIRT509530 INTU inturned planar cell polarity protein 2 6
MIRT509548 BTLA B and T lymphocyte associated 2 8
MIRT511328 KIAA1522 KIAA1522 2 4
MIRT511427 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 4
MIRT511477 HNRNPC heterogeneous nuclear ribonucleoprotein C (C1/C2) 2 4
MIRT512471 CCDC149 coiled-coil domain containing 149 2 2
MIRT512996 SEZ6L seizure related 6 homolog like 2 2
MIRT514755 ACER3 alkaline ceramidase 3 2 8
MIRT515764 KRTAP5-6 keratin associated protein 5-6 2 2
MIRT517392 TBK1 TANK binding kinase 1 2 4
MIRT518720 FTH1 ferritin heavy chain 1 2 2
MIRT521923 PHIP pleckstrin homology domain interacting protein 2 4
MIRT522849 KIAA2022 neurite extension and migration factor 2 4
MIRT522887 KDELR1 KDEL endoplasmic reticulum protein retention receptor 1 2 2
MIRT523153 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT525149 ZNF256 zinc finger protein 256 2 2
MIRT525941 C11orf74 chromosome 11 open reading frame 74 2 2
MIRT526876 ERCC8 ERCC excision repair 8, CSA ubiquitin ligase complex subunit 2 2
MIRT527366 KRTAP13-2 keratin associated protein 13-2 2 2
MIRT527549 DLGAP5 DLG associated protein 5 2 4
MIRT527604 ANKRD42 ankyrin repeat domain 42 2 2
MIRT527803 KLRD1 killer cell lectin like receptor D1 2 2
MIRT528046 PRKD3 protein kinase D3 2 2
MIRT528397 PGK1 phosphoglycerate kinase 1 2 2
MIRT529673 SLC28A1 solute carrier family 28 member 1 2 2
MIRT530358 HPSE heparanase 2 2
MIRT530908 KIAA1161 myogenesis regulating glycosidase (putative) 2 2
MIRT531169 ZNF333 zinc finger protein 333 2 2
MIRT531438 PAK1 p21 (RAC1) activated kinase 1 2 2
MIRT531562 CENPC1P1 centromere protein C pseudogene 1 1 1
MIRT532783 LDHD lactate dehydrogenase D 2 2
MIRT532848 ZNF699 zinc finger protein 699 2 2
MIRT534287 SLC12A7 solute carrier family 12 member 7 2 2
MIRT535078 PPIG peptidylprolyl isomerase G 2 4
MIRT535968 MFAP3L microfibril associated protein 3 like 2 2
MIRT536163 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT537417 FBXO47 F-box protein 47 2 2
MIRT538665 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT540291 RGR retinal G protein coupled receptor 2 4
MIRT543332 KIAA1456 KIAA1456 2 2
MIRT543392 CC2D2A coiled-coil and C2 domain containing 2A 2 2
MIRT543891 AIMP1 aminoacyl tRNA synthetase complex interacting multifunctional protein 1 2 2
MIRT545609 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT545839 ZNF275 zinc finger protein 275 2 2
MIRT546689 RORA RAR related orphan receptor A 2 4
MIRT547513 MAT2A methionine adenosyltransferase 2A 2 4
MIRT549431 ACVR1 activin A receptor type 1 2 2
MIRT550567 MYC MYC proto-oncogene, bHLH transcription factor 2 4
MIRT552517 ZIC5 Zic family member 5 2 2
MIRT552743 YRDC yrdC N6-threonylcarbamoyltransferase domain containing 2 2
MIRT552942 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT555752 PDCD10 programmed cell death 10 2 2
MIRT558002 FAM160B1 family with sequence similarity 160 member B1 2 2
MIRT559422 ASF1B anti-silencing function 1B histone chaperone 2 2
MIRT560276 SF1 splicing factor 1 2 2
MIRT560713 ZNF324B zinc finger protein 324B 2 2
MIRT561190 TNFRSF10A TNF receptor superfamily member 10a 2 2
MIRT561817 NUP50 nucleoporin 50 2 2
MIRT562018 LCLAT1 lysocardiolipin acyltransferase 1 2 2
MIRT562847 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT563252 SETD6 SET domain containing 6 2 2
MIRT563978 GCC2 GRIP and coiled-coil domain containing 2 2 2
MIRT564383 BAAT bile acid-CoA:amino acid N-acyltransferase 2 2
MIRT566552 PANK3 pantothenate kinase 3 2 2
MIRT566933 LIN28B lin-28 homolog B 2 2
MIRT566989 LBR lamin B receptor 2 2
MIRT567645 EXT1 exostosin glycosyltransferase 1 2 2
MIRT568268 BICD2 BICD cargo adaptor 2 2 2
MIRT571407 MED4 mediator complex subunit 4 2 2
MIRT571784 PPP2CA protein phosphatase 2 catalytic subunit alpha 2 2
MIRT572437 ATM ATM serine/threonine kinase 2 2
MIRT573613 COX6A1P2 cytochrome c oxidase subunit 6A1 pseudogene 2 2 2
MIRT574289 COX6A1 cytochrome c oxidase subunit 6A1 2 2
MIRT574375 YY1 YY1 transcription factor 2 2
MIRT613142 DSEL dermatan sulfate epimerase-like 2 2
MIRT616661 ORAI1 ORAI calcium release-activated calcium modulator 1 2 2
MIRT619345 SASH1 SAM and SH3 domain containing 1 2 2
MIRT626315 ABCC9 ATP binding cassette subfamily C member 9 2 2
MIRT628235 FAM117B family with sequence similarity 117 member B 2 2
MIRT630452 GTPBP8 GTP binding protein 8 (putative) 2 2
MIRT631013 TMEM30B transmembrane protein 30B 2 2
MIRT637315 FBXO18 F-box protein, helicase, 18 2 2
MIRT640658 FRY FRY microtubule binding protein 2 2
MIRT642081 FUT11 fucosyltransferase 11 2 2
MIRT644607 C17orf77 chromosome 17 open reading frame 77 2 2
MIRT644829 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT652465 TMEM2 transmembrane protein 2 2 2
MIRT657514 HAS2 hyaluronan synthase 2 2 2
MIRT658290 FAM86C1 family with sequence similarity 86 member C1 2 2
MIRT659570 CGGBP1 CGG triplet repeat binding protein 1 2 2
MIRT675457 SRP19 signal recognition particle 19 2 2
MIRT687828 ITGB8 integrin subunit beta 8 2 2
MIRT693550 MYO16 myosin XVI 2 2
MIRT697294 ZNF654 zinc finger protein 654 2 2
MIRT699804 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT704867 CD164 CD164 molecule 2 2
MIRT705309 AVL9 AVL9 cell migration associated 2 2
MIRT705323 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 2
MIRT707180 HOXC4 homeobox C4 2 2
MIRT709331 CLEC12B C-type lectin domain family 12 member B 2 2
MIRT712321 PER2 period circadian clock 2 2 2
MIRT713817 XRCC2 X-ray repair cross complementing 2 2 2
MIRT713854 HHLA2 HERV-H LTR-associating 2 2 2
MIRT717257 SLC44A1 solute carrier family 44 member 1 2 2
MIRT719956 BLOC1S6 biogenesis of lysosomal organelles complex 1 subunit 6 2 2
MIRT725408 KIF6 kinesin family member 6 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3133 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3133 Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-mir-3133 Androstenedione+Anastrozole sensitive cell line (MCF-7)
hsa-mir-3133 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3133 Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3133 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-3133 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3133 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission