miRTarBase - #MIRT538429


—
pre-miRNA Information
pre-miRNA hsa-mir-513c   
Genomic Coordinates chrX: 147189704 - 147189787
Synonyms MIRN513C, hsa-mir-513c, MIR513C
Description Homo sapiens miR-513c stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-513c-5p
Sequence 14| UUCUCAAGGAGGUGUCGUUUAU |35
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 X - 147189768 28550310 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1198915942 4 dbSNP
rs781939345 15 dbSNP
rs782303096 16 dbSNP
rs782290927 17 dbSNP
rs782660543 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COL19A1   
Synonyms COL9A1L, D6S228E
Description collagen type XIX alpha 1 chain
Transcript NM_001858   
Expression
Putative miRNA Targets on COL19A1
3'UTR of COL19A1
(miRNA target sites are highlighted)		 
>COL19A1|NM_001858|3'UTR
   1 ACACACCTGAAGAAGACTTGGTTCCTGGTAACATTTCCTTGCCACTGGAGCTCTCTTAATACCGTCAAACCCTCATCATC
  81 TGTGGGTTGCTTTTTTTTTTTTTTTTTTTTTTTGGGAGTAAGCCAGGCATTAAAAGCAACCGTTTGAATCCTATTCCTAT
 161 AGCAATTGCAAATCAGCATTTTTTGATTTTTCCCAAATTCATTCCATATGTTTTGCTTTACAATTGCTATGATTTTTACT
 241 CAGAGTTTTATATGAAATATGCAAGTAAATCTTATCGTTAGTTCTTCTTCAAAAGGAAATTGCATCTTGTGACTTAGTAG
 321 ACTGATGATGATATCCATTTTGTAGACTCATCAACATGTGGTTGGCCTTTGATTTCTGAATTTTAAAGTTTCAGACTTAT
 401 CTTTTCCTTGGTGTTTAAATTTACTATCATTGCTAAACATCTCGTCAACTTTTTTGATATAGTGCATTGCTCCTGTTGAA
 481 TGTTTTTTGACTACTTTTTATAACTTAAGAATTTTTATACCATCTACATCTATCCTACTTATGCAGAAAAATAGGCAATA
 561 AGAACTTCATTTTACAATTTATGTTTTCAAAAAAAAAATGCAGGAAACTGTTTTATCAGGGAGCCCAAACACCCAGCATA
 641 GCCAACTACTGAAATGATTTTGTTAATTCTGTATAATGAGCTCAATTCAAAGCAATCACCACTGGCATGAATAAGTACTG
 721 CATGAAAAGGGAGTATCAAATTCCAGTTTTGTATGAGTTCTGCAAAAAAAGCCTAATATTCTGTGGTCCCCTCACTCAGT
 801 CTCTCATTTGGTAAACAGAAAGCTGTTTTCCCTACAAGGTGCTTGGTGGTGAAGCCACCAAGCTGTCTTTGGTACTCTTA
 881 AAGCTTCAGTGGCCTAGCAAGATCTTTGGGCCCTTGTATCCATTATCCTTATGACCTCATCACCCTCAGACTTTAAGACA
 961 AGAAGCCACCATCAAAACAAAGGATGGGATACGTATAGAATGGACTCACTTGTCCTAGAAGATGAATGTGTAGTGTCAGC
1041 AAATGCATGTTAAGAAGGTGAAGCCCAAAAGCTCTTAAGGAGAATTGTATTTCTCCAGAAGCTGCAGCAAGAGGTACAGC
1121 TCAACAAAGGAAAACCACAGGACTGGATATGCAACTAGTGCTCAGACCAAAGAGTTCACACCCACTCTAAAACCATGTCC
1201 TCTGAAAAGAAACAAAAATACAGTGATCATCAAATGCCTAAACAGTCTTTCTGTTGGTTAGCTGTACATTCATTGAGGAA
1281 CTGTTGATTGGCAGGCACTGATTCTCTAGAACACTGGGCATGAGGATGTTGCAGAAATCTAGATGGTGGGTCCCACAGAT
1361 GTGAGAACATGCTGCAAGAGCCTGCCAGCCACAGCAATCAGGACTCACAGCTCTTCAAGGAGCAGTGCAGATTTCAATTT
1441 GGCTAAAACAGGATGATTGCTTTTGTCTGTTTACTGAAAAATGAGTTTAGAAAGGCTAGCCCACTGACATTGGAAAAAGC
1521 TGTGAACAGAGTTGTGTCTGAGGAATGTGCCTAATTTAAGGCAGGGTTTGTTCCAATGCATCCGTGATTTGAACCGGTTT
1601 TCATTATAGATTAATGAACTGCTGGTCAGGTACTGTCTACAATGGCTGTGCATACCTATAACATTTTAGGTATTTCATAT
1681 TGAATTATGCTGTATATTTCAATTCCAAGTTTATTTATTTTCCAAGGTTATTTTATTTATTGTAAGCATTTTGACATTGA
1761 TTTTTTTTTTTTCGTTTTCTTTCTTGTGCAATACCTACAATGGTGCTGTGTTTTAAACTTACACAATTGGGACATACGTA
1841 TGTGTTTTCTTAGTAAAATGGTAATTTATCCCGAAAAAGTGTACATAGATCTAAAATTTGGTGCTATGTGTATATCTTGA
1921 GCTTTTAATTTGTTGAATTTTCTAAACGCTTACAACTTATCTGCCACTCATATTAATTTACTTGAATTTGTCATAAAGCT
2001 AAATATTTTATATGTTTTCAAAGATTATTTTTTCATATTAATAGGTTGTTTATCTTTTTGCCTGTTTGCTAATTTAAAAA
2081 TATTTATTTTATCATTTTAATGTTTTCATGGACTTTTTTGCTGATGGTAATCAACTTTTTTTGTTTTTTGGTTTTTGAGT
2161 TGTTCTTGTCATAGACATAAAAAGACAATTCATTTTCTTGTTTTATTAACTCTGTTCATTTTTATTCTACAAAATATGTC
2241 ATGCATTCTTTCTTATGAATTGTATATTTAGAAATCTTTCTAAATACCATTAAGGCTTGACTGGTTAATTCCTATTTCAA
2321 GGATTTGGATTTATTCAGGTAATTTGATGGGATGGGGAAATATAATATTGTGTGATGCATATTACAAAGTGGACTTGTCA
2401 CAATGACACAAACTCATTTTTTGTAACTGGGAAATATGACTAAATTTGACGTAACTAGAGAAACAAGGCTGTATCCACAT
2481 GGTACAAGCCTTTCTCACCCTACTCTATTATTTACCTTCAGATACTTTTTCCTGCCTCAGCTCTGTACACATGATATGCA
2561 ACAAAGGGCAGCAAGAAATGCTGGGTCCACCTAATTTAACACAAAATGAAGTTGAGATTCGGCAGTTGCCCAATTCCTTT
2641 AATAAAAAGAAACTAAATAATTTGGGCCCCAAAGTAGGGTGGGAAGTTTTCCTCTAAATGACTTGATGGTTGCCAAATCC
2721 CTTGCACCATTTTATTCCATTCCAAAACATGTGTTTATTTCCACATAGATGTTAATGATGTTCAAAGCAGGGGAGAAGAA
2801 TTATTCAATTTCATGAATAACTCTTGTTTGCACTCCAGAAAACAACATACATGTTTAAATACAAAATAATTATGGGCCAT
2881 GACGACGATTAATATTAAAACTGTGATTTCCATATACAAGTATGTTTGAGTTCCAATCTTACATTTTATACCAAGTTCAA
2961 AACACTTTCAGATAGAAGTCTTTCTATGCAAAGATTAAAGTATGACTTCAATTCATATTTATGGCCTTTGGAATCCAAAG
3041 AAAAACAGAAGAATAATTCATGGATTTGTTCATTGTTCTTTCCAACTGAAGGCAGTAACCATTACTTCTAACCGTAACAC
3121 AAACACAGCAAGTTTTAACCTTTTAAACTTTTCACTTTGTGAGCAAAGTAACCCCATAAGTTTATTTCCCTATTTCATGG
3201 TATTGTTTAAACTTTAAAATTTTAGTCACTTAAAGAACTTAAGCAATTATATTAAAATACGTTGTCTGTGAAAATTATCA
3281 TTTGATATTTGGCTTATAAAGTAATTTTTATGAATCTGTTTTATGAGTTAGGTAAGATTTAGCCTTTCTGCAGTCTGTCT
3361 CATCTGTTGGGAACCTGTGATATACCTCCATTTGTCCACAAGATGGTGTTTAAAACAATTTGTTCAGAAGAACTGAGCAA
3441 ACTAACAGAAATACAAGGCTACGAACAGTTTAGTGGACAACTAAATCAGACTCTTGCCTTTGCACTTTTTTTTAACTTTT
3521 GTAGATAATTTTTGTTAATTTGTTTTGTTAATTTATGTTTTTCCTAATTTTAAGCATCTTTATGAAACAGGCACAGTACC
3601 CTTTGGTTTGTTGACTGTTTTGATTTTATTTCTTTGGTGGATATATATGTACTTATACACTTAGTTAACATGCAGATTAA
3681 CTAGTCATAACTGTTTATACACCACTCTCATATTTTAGTGATCAATATGAAGACAGCTAAATAATTATCCTACTTTTTAG
3761 ACAGGACAGATACTCTCAACAGACAAGAAAAAAGATTTAGCTTATCACAAGAAGCAGACAATTTATAAAACTACACAATG
3841 TCTAAACTCTATGTTGCTCAGTGTACTTAAAATTTTACAGTTATATTTGTATAACGTTTATATTTTTCTAGAATACATCA
3921 CTATTTACAAAAGTACAATTAGAAACACTGTTTTTTTTAAGTACCGTTTTTATTTTCATAACACTAATAATACACTGGGA
4001 TTGAGAATTTCTGTTAAGTGTTTTGCTGACGTTGTTTTAATGAATACTCAAAAAAGCTTTGCAGATTTGTCCATTGCTCT
4081 TGTTCTTAAATTATTTTTCATACTTGTCTGTATCCACCTTCTGAAGACACACAAGTGTTTACTGTCGCAGTTTCCCAGCG
4161 TTATTTCTTAATACTTGAGTGTTGACACATTTTTGTACCATCCCCCTTTTGTACCATCTCTGCTCACAAAGATTATATGC
4241 AGGCTTTGAAGAGGAGGAGATGCAGAAGATAATTGAATTTGTATCTTGTATGCCTATGTAATTCAAAGTGACTTAGTCCA
4321 TTGAATTGTGTTCATTTATTAGTTGGCTGGTTAAGATAGCATTAATTATCTTAAATTTATTCAACTACTAAAAGTCTCAG
4401 GCAATAGGACAGATGAGTGTCATCATTTTTATTGTGTGGCATACTTGGAGCTATAATCCAAACGTTTTACTCAACAAAAT
4481 AATGCTAGAGTAACTGATCAATTTGGTTAAATTGAATGAAGAACCAAGTGAACACAGAGAAAACTTATTCGGACAAGTAG
4561 ACCCAGCACAGCAAAAATTTGTCTGAAAGATAAGACAAGCTTATAAGACCAAAGCTAAGTCTAAGAAAATCTAAATGGAA
4641 AAAAAATTGCGTGTTCAGATCCAATAGTGAGTGATGTGGTACAACTGGAGGAGTTAGCTACTTGCTTCATGAATTTGTCA
4721 AAAGTGAATACTAATAAAGTGGGAGGCTTCACTAAATGAGGGGGTAAATAAGATTTAAGTTTATCAGAAGTGTGTGTATT
4801 GTGTGACCATACTAAGCTTCTGGGTGTAAGTAAAGATGCTGGCTATTTTACAACTTTTTATTGTATTGTGTTATGCAAAG
4881 TACATTTTGGAGATAAATGTTTTTCAGCACATTAATGTCTTTAAATTCAGGTTGTATTGGGTGTATTTTACAACTATTTA
4961 TTTTTAAATAACATTTAGGGTGTGTTTTCCCCCATTTTGTTTGTTCTCTATCTTACCTCATCAAACTCTTTACGATTTAA
5041 TTGAATATACTCATGTTAAGTGCAATGGCATTAGTTTTATTCAAAATCCCACATGGGCATAATGCTTTGAGGCCTTGATT
5121 CCTACATGTTCATTATGCATAATGAGCTTGTCACCTATCTCAGCAATAAAGGTTCTGACC
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uauUUGCUGUGGAG------GAACUCuu 5'
             |:|| :|::||      ||||||  
Target 5' cccAGCGTTATTTCTTAATACTTGAGtg 3'
 4154 - 4181 133.00 -12.50
2 
miRNA  3' uaUUUGCUGUG--GAGGAACUCUu 5'
            ||| || |:  | :|||| || 
Target 5' caAAAGGAAATTGCATCTTGTGAc 3'
 290 - 313 126.00 -6.90
3 
miRNA  3' uauuUGC-UGUGGAGGAACUCuu 5'
              |:| ::|: | ||||||  
Target 5' tgctATGTGTATAT-CTTGAGct 3'
 1902 - 1923 125.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM7523657 1 COSMIC
COSN31498891 7 COSMIC
COSN30458077 13 COSMIC
COSN31504598 16 COSMIC
COSN15316403 21 COSMIC
COSN18731036 21 COSMIC
COSN1336355 25 COSMIC
COSN30457532 38 COSMIC
COSN30505054 52 COSMIC
COSN30527682 56 COSMIC
COSN30144917 64 COSMIC
COSN30544771 67 COSMIC
COSN30464572 70 COSMIC
COSN2531034 90 COSMIC
COSN30154646 114 COSMIC
COSN17037807 259 COSMIC
COSN17037808 262 COSMIC
COSN23432712 263 COSMIC
COSN17037809 267 COSMIC
COSN24049473 395 COSMIC
COSN6591963 444 COSMIC
COSN21420255 590 COSMIC
COSN15668255 852 COSMIC
COSN30174675 1379 COSMIC
COSN26646857 1420 COSMIC
COSN26668202 1444 COSMIC
COSN26642435 1551 COSMIC
COSN26641935 1574 COSMIC
COSN5090651 1625 COSMIC
COSN15668256 1677 COSMIC
COSN22612255 1710 COSMIC
COSN27239887 1773 COSMIC
COSN27591203 1773 COSMIC
COSN19658813 1774 COSMIC
COSN19658968 1775 COSMIC
COSN19658969 1784 COSMIC
COSN31516776 1867 COSMIC
COSN26670948 1888 COSMIC
COSN31607702 1999 COSMIC
COSN31567888 2009 COSMIC
COSN5635989 2675 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1227711146 11 dbSNP
rs1169330476 13 dbSNP
rs569155936 18 dbSNP
rs1347941468 19 dbSNP
rs1736 21 dbSNP
rs201530468 23 dbSNP
rs1172762322 25 dbSNP
rs577731720 29 dbSNP
rs1403039468 38 dbSNP
rs1290374095 40 dbSNP
rs139348805 41 dbSNP
rs553786350 48 dbSNP
rs762516133 51 dbSNP
rs1424135906 53 dbSNP
rs374101991 57 dbSNP
rs1481355488 63 dbSNP
rs896189642 64 dbSNP
rs113178987 65 dbSNP
rs1479355808 78 dbSNP
rs1023346239 87 dbSNP
rs1441496339 89 dbSNP
rs373201255 89 dbSNP
rs1491154188 90 dbSNP
rs1240945753 91 dbSNP
rs1299984352 91 dbSNP
rs1334395045 91 dbSNP
rs1358840027 91 dbSNP
rs1371270034 91 dbSNP
rs1417310020 91 dbSNP
rs1429791121 91 dbSNP
rs1470822806 91 dbSNP
rs1491069500 91 dbSNP
rs36112821 91 dbSNP
rs759423219 91 dbSNP
rs1251200928 94 dbSNP
rs1420776911 95 dbSNP
rs1156361196 96 dbSNP
rs1379136161 97 dbSNP
rs905338666 97 dbSNP
rs1424974047 98 dbSNP
rs1165086852 101 dbSNP
rs930788175 107 dbSNP
rs1409457267 113 dbSNP
rs1491090585 113 dbSNP
rs1491171818 114 dbSNP
rs995647709 114 dbSNP
rs1416183811 115 dbSNP
rs1215686555 117 dbSNP
rs1315663052 118 dbSNP
rs562180944 127 dbSNP
rs1027176796 128 dbSNP
rs572589187 129 dbSNP
rs1347691298 130 dbSNP
rs575511251 142 dbSNP
rs951703191 143 dbSNP
rs1454847749 147 dbSNP
rs1406530219 149 dbSNP
rs889304271 150 dbSNP
rs1376214585 151 dbSNP
rs1451449491 154 dbSNP
rs1346923952 157 dbSNP
rs1390143958 160 dbSNP
rs1422706252 161 dbSNP
rs983087313 163 dbSNP
rs1007773928 167 dbSNP
rs1248192169 179 dbSNP
rs544475579 186 dbSNP
rs1186329934 187 dbSNP
rs566215943 204 dbSNP
rs75921733 207 dbSNP
rs1262995581 224 dbSNP
rs975460897 230 dbSNP
rs1217187610 241 dbSNP
rs1220610285 242 dbSNP
rs1289761525 242 dbSNP
rs190503509 251 dbSNP
rs997847853 252 dbSNP
rs1481608242 254 dbSNP
rs147300564 257 dbSNP
rs1237418065 261 dbSNP
rs752935720 266 dbSNP
rs1363869422 273 dbSNP
rs1289343180 277 dbSNP
rs931779893 278 dbSNP
rs1424010344 298 dbSNP
rs1363154647 310 dbSNP
rs1164948865 314 dbSNP
rs1424858278 318 dbSNP
rs930199408 319 dbSNP
rs75910524 320 dbSNP
rs549053252 322 dbSNP
rs549375716 327 dbSNP
rs1264384640 331 dbSNP
rs1187603765 335 dbSNP
rs1490334804 336 dbSNP
rs958794434 337 dbSNP
rs1224853919 338 dbSNP
rs896102948 358 dbSNP
rs949067179 359 dbSNP
rs569244373 363 dbSNP
rs904931292 373 dbSNP
rs971368370 374 dbSNP
rs764481014 379 dbSNP
rs1404196681 397 dbSNP
rs1343598945 408 dbSNP
rs1282473918 412 dbSNP
rs777936014 414 dbSNP
rs1027557833 415 dbSNP
rs1395197431 426 dbSNP
rs751539911 427 dbSNP
rs1165790797 430 dbSNP
rs535129496 431 dbSNP
rs1296106226 434 dbSNP
rs1463256243 441 dbSNP
rs930693288 445 dbSNP
rs985284915 450 dbSNP
rs887321176 458 dbSNP
rs1257368105 459 dbSNP
rs531750217 461 dbSNP
rs1205060018 464 dbSNP
rs1490524579 467 dbSNP
rs1235218304 476 dbSNP
rs1249989393 480 dbSNP
rs1004832053 483 dbSNP
rs1040627647 484 dbSNP
rs1481749154 488 dbSNP
rs1251605002 489 dbSNP
rs1222696234 490 dbSNP
rs1321219882 490 dbSNP
rs1285083508 491 dbSNP
rs1224121163 501 dbSNP
rs1334649209 505 dbSNP
rs902128142 507 dbSNP
rs945644371 510 dbSNP
rs1019872258 518 dbSNP
rs1186748187 521 dbSNP
rs1421130809 523 dbSNP
rs756125918 524 dbSNP
rs1469589451 528 dbSNP
rs1404411312 531 dbSNP
rs1179203475 533 dbSNP
rs902859052 534 dbSNP
rs999867996 543 dbSNP
rs1033207356 544 dbSNP
rs965343448 551 dbSNP
rs375651906 554 dbSNP
rs1407527487 561 dbSNP
rs1013187800 567 dbSNP
rs1471232616 569 dbSNP
rs571452284 573 dbSNP
rs1358644880 577 dbSNP
rs1264839678 581 dbSNP
rs968778536 583 dbSNP
rs1349882217 584 dbSNP
rs35291700 584 dbSNP
rs78016920 584 dbSNP
rs79783524 585 dbSNP
rs1288353779 586 dbSNP
rs201731517 588 dbSNP
rs1335881271 589 dbSNP
rs199950167 589 dbSNP
rs201176064 589 dbSNP
rs867495497 590 dbSNP
rs978905008 595 dbSNP
rs1272154667 599 dbSNP
rs1404344041 606 dbSNP
rs1339119296 611 dbSNP
rs1338641432 629 dbSNP
rs1384910729 639 dbSNP
rs1157390091 648 dbSNP
rs1216604405 651 dbSNP
rs1277298038 659 dbSNP
rs1324251192 665 dbSNP
rs1183213516 670 dbSNP
rs1443027560 674 dbSNP
rs1244678314 678 dbSNP
rs1188039119 684 dbSNP
rs533990407 702 dbSNP
rs1446310270 706 dbSNP
rs1206863933 721 dbSNP
rs553726221 722 dbSNP
rs1200575 723 dbSNP
rs971995002 729 dbSNP
rs956570955 730 dbSNP
rs988431354 732 dbSNP
rs76762659 740 dbSNP
rs182981903 755 dbSNP
rs1026281856 756 dbSNP
rs1326251985 764 dbSNP
rs1193464548 767 dbSNP
rs1430410858 771 dbSNP
rs1481744593 774 dbSNP
rs952036168 782 dbSNP
rs949326068 786 dbSNP
rs984885214 788 dbSNP
rs187613825 798 dbSNP
rs910666813 801 dbSNP
rs1401377762 802 dbSNP
rs1422935607 805 dbSNP
rs375500609 807 dbSNP
rs926323788 808 dbSNP
rs796984679 809 dbSNP
rs931061060 811 dbSNP
rs1195218648 825 dbSNP
rs1488583158 833 dbSNP
rs923458811 839 dbSNP
rs1297413410 842 dbSNP
rs1361092169 850 dbSNP
rs945592110 850 dbSNP
rs1042626280 852 dbSNP
rs1213698250 853 dbSNP
rs1048144907 854 dbSNP
rs887266754 859 dbSNP
rs1004414710 860 dbSNP
rs1433423178 866 dbSNP
rs554475668 868 dbSNP
rs1054190236 873 dbSNP
rs1403162309 878 dbSNP
rs1041675284 879 dbSNP
rs901401898 890 dbSNP
rs1409665710 893 dbSNP
rs191176258 902 dbSNP
rs1024537292 903 dbSNP
rs1428543337 906 dbSNP
rs1223893245 907 dbSNP
rs1197239211 909 dbSNP
rs1028293431 913 dbSNP
rs1351133659 917 dbSNP
rs1203307359 919 dbSNP
rs1215441338 960 dbSNP
rs907039065 961 dbSNP
rs993383211 970 dbSNP
rs1269065902 972 dbSNP
rs1222298870 987 dbSNP
rs763385107 988 dbSNP
rs144942719 993 dbSNP
rs796160727 994 dbSNP
rs956730320 996 dbSNP
rs1201814 997 dbSNP
rs1405167981 1021 dbSNP
rs1160419423 1022 dbSNP
rs1174164145 1023 dbSNP
rs1481384278 1024 dbSNP
rs1425175583 1025 dbSNP
rs1176154567 1029 dbSNP
rs1198923030 1033 dbSNP
rs1378535054 1035 dbSNP
rs1262977300 1041 dbSNP
rs1202271713 1046 dbSNP
rs1314469549 1052 dbSNP
rs917764265 1058 dbSNP
rs970586562 1059 dbSNP
rs1223315334 1067 dbSNP
rs1371342163 1079 dbSNP
rs1017676373 1081 dbSNP
rs1447869355 1083 dbSNP
rs144878607 1085 dbSNP
rs1164468349 1096 dbSNP
rs926289530 1105 dbSNP
rs1367630600 1106 dbSNP
rs931029491 1111 dbSNP
rs540804525 1134 dbSNP
rs1048606856 1136 dbSNP
rs751166145 1138 dbSNP
rs1200574 1139 dbSNP
rs1330503523 1149 dbSNP
rs1409614465 1150 dbSNP
rs1442825754 1151 dbSNP
rs148619318 1159 dbSNP
rs543107122 1166 dbSNP
rs1242849112 1175 dbSNP
rs1182167396 1176 dbSNP
rs966883365 1184 dbSNP
rs901348298 1189 dbSNP
rs978308779 1196 dbSNP
rs1238715623 1197 dbSNP
rs1315188381 1199 dbSNP
rs925559982 1209 dbSNP
rs1241056909 1210 dbSNP
rs1292079000 1224 dbSNP
rs1359030829 1226 dbSNP
rs562977630 1231 dbSNP
rs1312582647 1249 dbSNP
rs1397534978 1258 dbSNP
rs997060346 1268 dbSNP
rs1054498924 1269 dbSNP
rs915600421 1273 dbSNP
rs142106286 1284 dbSNP
rs1045518851 1290 dbSNP
rs904514916 1295 dbSNP
rs551529403 1296 dbSNP
rs1165137897 1301 dbSNP
rs1438957730 1302 dbSNP
rs907029245 1312 dbSNP
rs183302394 1319 dbSNP
rs1047661170 1332 dbSNP
rs151180071 1333 dbSNP
rs1217462601 1341 dbSNP
rs1006151197 1351 dbSNP
rs1184246372 1357 dbSNP
rs1289818378 1359 dbSNP
rs1247338666 1364 dbSNP
rs1322093023 1378 dbSNP
rs1294604674 1379 dbSNP
rs1017982408 1382 dbSNP
rs1387360846 1384 dbSNP
rs187439102 1385 dbSNP
rs1294919413 1388 dbSNP
rs1458108217 1390 dbSNP
rs1014764876 1392 dbSNP
rs998000645 1393 dbSNP
rs1030412542 1395 dbSNP
rs1161308676 1403 dbSNP
rs1024725568 1412 dbSNP
rs970575150 1416 dbSNP
rs1426379893 1422 dbSNP
rs1195080967 1424 dbSNP
rs966829524 1438 dbSNP
rs980649077 1443 dbSNP
rs1033586429 1453 dbSNP
rs952464544 1456 dbSNP
rs1488934365 1465 dbSNP
rs1397959980 1467 dbSNP
rs978256509 1484 dbSNP
rs1445436324 1496 dbSNP
rs772782276 1499 dbSNP
rs1315095138 1500 dbSNP
rs1222900320 1528 dbSNP
rs1341945200 1530 dbSNP
rs1343028326 1534 dbSNP
rs908218366 1539 dbSNP
rs567095561 1548 dbSNP
rs760171140 1551 dbSNP
rs1242142012 1554 dbSNP
rs1395352745 1561 dbSNP
rs939752606 1562 dbSNP
rs976499458 1566 dbSNP
rs1296140024 1567 dbSNP
rs1284042555 1574 dbSNP
rs922761686 1581 dbSNP
rs932838210 1584 dbSNP
rs771481802 1585 dbSNP
rs1049989107 1590 dbSNP
rs904797916 1596 dbSNP
rs777098577 1597 dbSNP
rs1457686688 1598 dbSNP
rs1175743794 1602 dbSNP
rs928393051 1611 dbSNP
rs1258532515 1620 dbSNP
rs1204443884 1624 dbSNP
rs1053095118 1626 dbSNP
rs1321364371 1632 dbSNP
rs1257192041 1640 dbSNP
rs192758298 1646 dbSNP
rs759931957 1656 dbSNP
rs1014340411 1659 dbSNP
rs1373805840 1681 dbSNP
rs765668632 1693 dbSNP
rs1006516302 1695 dbSNP
rs1024379039 1697 dbSNP
rs1332469000 1710 dbSNP
rs1469706747 1715 dbSNP
rs1400723721 1717 dbSNP
rs756361358 1718 dbSNP
rs1002017208 1723 dbSNP
rs1363366762 1725 dbSNP
rs866643743 1727 dbSNP
rs1030358455 1728 dbSNP
rs185421001 1728 dbSNP
rs952630551 1741 dbSNP
rs1182777255 1742 dbSNP
rs966734322 1749 dbSNP
rs984452327 1754 dbSNP
rs1336882749 1757 dbSNP
rs1403712092 1758 dbSNP
rs1393724209 1760 dbSNP
rs1241788920 1761 dbSNP
rs550371166 1761 dbSNP
rs760355898 1761 dbSNP
rs1310390683 1764 dbSNP
rs1333111173 1773 dbSNP
rs1452349939 1773 dbSNP
rs1326613338 1774 dbSNP
rs79130291 1775 dbSNP
rs1220891324 1780 dbSNP
rs1276677073 1784 dbSNP
rs1317897519 1787 dbSNP
rs1224659929 1789 dbSNP
rs1258219891 1790 dbSNP
rs368318777 1792 dbSNP
rs1370032815 1799 dbSNP
rs1032886868 1801 dbSNP
rs1446359500 1807 dbSNP
rs558302117 1811 dbSNP
rs763254201 1825 dbSNP
rs1488361606 1831 dbSNP
rs961372746 1834 dbSNP
rs764159229 1838 dbSNP
rs922372747 1839 dbSNP
rs751757516 1845 dbSNP
rs1286336209 1859 dbSNP
rs1246084403 1868 dbSNP
rs1326381853 1868 dbSNP
rs1023932570 1871 dbSNP
rs1401887071 1873 dbSNP
rs652776 1874 dbSNP
rs1302764508 1884 dbSNP
rs985601108 1890 dbSNP
rs1415604184 1894 dbSNP
rs926124233 1908 dbSNP
rs936229304 1909 dbSNP
rs981133493 1913 dbSNP
rs928298451 1922 dbSNP
rs1477492418 1929 dbSNP
rs1053820439 1937 dbSNP
rs1477860335 1938 dbSNP
rs1379236754 1945 dbSNP
rs868283584 1947 dbSNP
rs140293017 1948 dbSNP
rs780191411 1949 dbSNP
rs865796310 1957 dbSNP
rs1001586936 1970 dbSNP
rs1054849835 1985 dbSNP
rs1039345455 2006 dbSNP
rs900442639 2006 dbSNP
rs933250447 2007 dbSNP
rs145761581 2009 dbSNP
rs888279222 2011 dbSNP
rs1351862356 2015 dbSNP
rs1324517311 2021 dbSNP
rs902523817 2024 dbSNP
rs999533085 2026 dbSNP
rs1005463936 2027 dbSNP
rs1466088702 2028 dbSNP
rs893966318 2030 dbSNP
rs1015960037 2045 dbSNP
rs1304085171 2046 dbSNP
rs187691186 2047 dbSNP
rs1478752023 2048 dbSNP
rs1310913955 2055 dbSNP
rs554518300 2074 dbSNP
rs1012442744 2076 dbSNP
rs997873150 2077 dbSNP
rs1232672211 2081 dbSNP
rs1261359275 2083 dbSNP
rs1319250568 2085 dbSNP
rs1029349970 2087 dbSNP
rs953744716 2088 dbSNP
rs1217529400 2114 dbSNP
rs985211988 2115 dbSNP
rs1275662124 2121 dbSNP
rs926142463 2130 dbSNP
rs1262662509 2134 dbSNP
rs1333126460 2136 dbSNP
rs1487847184 2144 dbSNP
rs1035316650 2145 dbSNP
rs1405234735 2146 dbSNP
rs574242253 2150 dbSNP
rs1191502854 2151 dbSNP
rs1269425626 2152 dbSNP
rs950396584 2157 dbSNP
rs1425331236 2172 dbSNP
rs753797892 2173 dbSNP
rs983196713 2179 dbSNP
rs1437433982 2181 dbSNP
rs957808006 2190 dbSNP
rs1174817801 2210 dbSNP
rs543244959 2214 dbSNP
rs1237383454 2220 dbSNP
rs192608304 2226 dbSNP
rs531884049 2237 dbSNP
rs545372730 2249 dbSNP
rs1045680072 2263 dbSNP
rs933198180 2271 dbSNP
rs1239612891 2278 dbSNP
rs1051640673 2281 dbSNP
rs1311121395 2284 dbSNP
rs1447204406 2285 dbSNP
rs868150108 2292 dbSNP
rs927305973 2296 dbSNP
rs1359166706 2302 dbSNP
rs1317057394 2314 dbSNP
rs937387445 2315 dbSNP
rs1458767695 2322 dbSNP
rs1417424269 2326 dbSNP
rs778780469 2331 dbSNP
rs1158918976 2338 dbSNP
rs1440699454 2352 dbSNP
rs888277049 2353 dbSNP
rs75082304 2366 dbSNP
rs73746899 2371 dbSNP
rs897037916 2380 dbSNP
rs184313799 2384 dbSNP
rs1237977025 2389 dbSNP
rs558932494 2390 dbSNP
rs1241223891 2391 dbSNP
rs953733290 2395 dbSNP
rs117232254 2408 dbSNP
rs1033205616 2410 dbSNP
rs145401181 2416 dbSNP
rs563151279 2417 dbSNP
rs989361997 2417 dbSNP
rs913414662 2422 dbSNP
rs1397556760 2423 dbSNP
rs1487503842 2429 dbSNP
rs1298421643 2436 dbSNP
rs1016353784 2437 dbSNP
rs1349593963 2438 dbSNP
rs549612301 2451 dbSNP
rs80133191 2452 dbSNP
rs921733636 2453 dbSNP
rs770394253 2458 dbSNP
rs1441031697 2460 dbSNP
rs1476874033 2463 dbSNP
rs927294483 2465 dbSNP
rs552628 2467 dbSNP
rs1379340445 2468 dbSNP
rs1424002927 2472 dbSNP
rs146488491 2486 dbSNP
rs1263402296 2503 dbSNP
rs1223464556 2512 dbSNP
rs868053086 2525 dbSNP
rs141077068 2531 dbSNP
rs1277484713 2536 dbSNP
rs1216787477 2538 dbSNP
rs778837840 2548 dbSNP
rs1053763723 2550 dbSNP
rs1385838325 2551 dbSNP
rs1037241317 2552 dbSNP
rs747185899 2558 dbSNP
rs1459763411 2560 dbSNP
rs16868705 2562 dbSNP
rs1170516203 2568 dbSNP
rs1403022657 2570 dbSNP
rs1464523420 2573 dbSNP
rs1425812611 2577 dbSNP
rs1194501576 2584 dbSNP
rs1432721482 2585 dbSNP
rs1045565962 2589 dbSNP
rs1308598981 2597 dbSNP
rs1193214719 2604 dbSNP
rs1488679024 2613 dbSNP
rs906696446 2614 dbSNP
rs529805 2621 dbSNP
rs889443496 2623 dbSNP
rs1310765979 2624 dbSNP
rs1006991746 2626 dbSNP
rs1319721975 2631 dbSNP
rs1309975608 2636 dbSNP
rs1302937487 2644 dbSNP
rs1387004390 2661 dbSNP
rs1032699104 2664 dbSNP
rs1220497459 2667 dbSNP
rs1372097295 2668 dbSNP
rs887326264 2680 dbSNP
rs1445143827 2688 dbSNP
rs1459013778 2700 dbSNP
rs892849341 2701 dbSNP
rs1196258850 2704 dbSNP
rs1465605957 2729 dbSNP
rs1015890293 2740 dbSNP
rs1178437428 2749 dbSNP
rs963380025 2749 dbSNP
rs1237298631 2754 dbSNP
rs995933762 2754 dbSNP
rs1458964715 2766 dbSNP
rs1238683657 2767 dbSNP
rs1483410265 2771 dbSNP
rs1183241020 2776 dbSNP
rs1342185508 2779 dbSNP
rs1028740584 2780 dbSNP
rs775930273 2781 dbSNP
rs954529531 2782 dbSNP
rs1020832101 2794 dbSNP
rs1306687889 2794 dbSNP
rs574430527 2798 dbSNP
rs1171782577 2799 dbSNP
rs1426473283 2807 dbSNP
rs1395976483 2808 dbSNP
rs1464508358 2809 dbSNP
rs1304697483 2816 dbSNP
rs763223865 2818 dbSNP
rs981650735 2822 dbSNP
rs1157126621 2824 dbSNP
rs536829204 2831 dbSNP
rs556832576 2832 dbSNP
rs1034592215 2840 dbSNP
rs576462701 2849 dbSNP
rs1186667902 2853 dbSNP
rs989807390 2875 dbSNP
rs985171691 2879 dbSNP
rs545145631 2880 dbSNP
rs9346371 2884 dbSNP
rs972216658 2886 dbSNP
rs11758956 2887 dbSNP
rs541419458 2888 dbSNP
rs1278577775 2890 dbSNP
rs1244655101 2904 dbSNP
rs1339249548 2910 dbSNP
rs928062635 2916 dbSNP
rs767726034 2917 dbSNP
rs1415445300 2921 dbSNP
rs375855033 2922 dbSNP
rs147000947 2923 dbSNP
rs372996993 2923 dbSNP
rs1257269371 2934 dbSNP
rs770041199 2937 dbSNP
rs1296516229 2944 dbSNP
rs1421756970 2950 dbSNP
rs560847298 2951 dbSNP
rs144903519 2952 dbSNP
rs1471713779 2968 dbSNP
rs1370083430 2970 dbSNP
rs1188651516 2975 dbSNP
rs1477201161 2978 dbSNP
rs78792977 2981 dbSNP
rs1218260855 2988 dbSNP
rs1488433010 2995 dbSNP
rs1039058087 3002 dbSNP
rs637054 3007 dbSNP
rs1354736561 3016 dbSNP
rs549800134 3019 dbSNP
rs1339848448 3032 dbSNP
rs1028686731 3034 dbSNP
rs1402026738 3037 dbSNP
rs1327225740 3041 dbSNP
rs1323183879 3047 dbSNP
rs1265790524 3054 dbSNP
rs532350752 3060 dbSNP
rs1170613802 3061 dbSNP
rs1008621932 3065 dbSNP
rs1010398330 3073 dbSNP
rs1020025097 3079 dbSNP
rs1030754585 3082 dbSNP
rs1195246348 3083 dbSNP
rs907367999 3092 dbSNP
rs1003018359 3094 dbSNP
rs765080898 3100 dbSNP
rs1034497586 3102 dbSNP
rs1196389491 3104 dbSNP
rs1416275135 3110 dbSNP
rs989406008 3111 dbSNP
rs138697919 3114 dbSNP
rs565767887 3115 dbSNP
rs1256768138 3119 dbSNP
rs1220508867 3124 dbSNP
rs1340225455 3130 dbSNP
rs56367430 3133 dbSNP
rs1016677264 3140 dbSNP
rs1332542138 3141 dbSNP
rs568103348 3141 dbSNP
rs1326371629 3159 dbSNP
rs1445894648 3164 dbSNP
rs774715446 3166 dbSNP
rs982871006 3174 dbSNP
rs923374964 3186 dbSNP
rs933411192 3199 dbSNP
rs941565641 3199 dbSNP
rs1170387933 3205 dbSNP
rs986604298 3207 dbSNP
rs112187973 3217 dbSNP
rs911066309 3227 dbSNP
rs1038600056 3243 dbSNP
rs1194627795 3244 dbSNP
rs1457628555 3251 dbSNP
rs548245762 3261 dbSNP
rs866815505 3262 dbSNP
rs932932555 3265 dbSNP
rs1217650779 3274 dbSNP
rs1397843420 3279 dbSNP
rs1350353059 3281 dbSNP
rs567946785 3284 dbSNP
rs1345579638 3287 dbSNP
rs1220492008 3289 dbSNP
rs890125426 3296 dbSNP
rs1008569467 3297 dbSNP
rs1358029850 3297 dbSNP
rs914214219 3307 dbSNP
rs1415728023 3309 dbSNP
rs945760077 3319 dbSNP
rs1041429176 3333 dbSNP
rs536134334 3338 dbSNP
rs892280001 3342 dbSNP
rs1439456936 3343 dbSNP
rs536975225 3347 dbSNP
rs1179394718 3349 dbSNP
rs556920661 3351 dbSNP
rs1236928439 3353 dbSNP
rs1208085568 3354 dbSNP
rs1281306039 3362 dbSNP
rs1055853191 3364 dbSNP
rs1351164633 3376 dbSNP
rs1308888641 3385 dbSNP
rs1022139715 3405 dbSNP
rs1378315618 3409 dbSNP
rs1282392084 3426 dbSNP
rs1449572671 3427 dbSNP
rs894683957 3431 dbSNP
rs1297134767 3435 dbSNP
rs1006878844 3436 dbSNP
rs1358978292 3443 dbSNP
rs980686403 3443 dbSNP
rs1161766160 3446 dbSNP
rs1420105028 3448 dbSNP
rs373958412 3463 dbSNP
rs762085638 3464 dbSNP
rs1180699031 3469 dbSNP
rs1476222343 3470 dbSNP
rs1016546872 3472 dbSNP
rs531951185 3483 dbSNP
rs1487442035 3494 dbSNP
rs962337586 3494 dbSNP
rs960731114 3506 dbSNP
rs982860957 3506 dbSNP
rs1479279624 3512 dbSNP
rs1287625459 3516 dbSNP
rs1189600667 3526 dbSNP
rs746692550 3527 dbSNP
rs1355466381 3532 dbSNP
rs1277051754 3539 dbSNP
rs1424540125 3543 dbSNP
rs1420310788 3548 dbSNP
rs993474844 3550 dbSNP
rs1160695133 3552 dbSNP
rs1358801514 3555 dbSNP
rs1417664702 3558 dbSNP
rs1349726463 3562 dbSNP
rs1030352232 3565 dbSNP
rs954743472 3566 dbSNP
rs1463482498 3579 dbSNP
rs566081403 3589 dbSNP
rs974619448 3597 dbSNP
rs1476903780 3598 dbSNP
rs756858249 3600 dbSNP
rs780695851 3601 dbSNP
rs1187383983 3605 dbSNP
rs149359013 3606 dbSNP
rs1438518217 3612 dbSNP
rs932868092 3614 dbSNP
rs1335414357 3615 dbSNP
rs1369630937 3621 dbSNP
rs1240182869 3624 dbSNP
rs1287761365 3625 dbSNP
rs911054907 3626 dbSNP
rs143710031 3627 dbSNP
rs1295835833 3632 dbSNP
rs624243 3636 dbSNP
rs1324338903 3637 dbSNP
rs572549299 3642 dbSNP
rs890114103 3643 dbSNP
rs1291025963 3646 dbSNP
rs1453899290 3654 dbSNP
rs914517600 3656 dbSNP
rs1464114615 3657 dbSNP
rs566385920 3659 dbSNP
rs945971493 3671 dbSNP
rs1041335177 3682 dbSNP
rs865785451 3686 dbSNP
rs1220005235 3690 dbSNP
rs1432851876 3695 dbSNP
rs189089670 3698 dbSNP
rs1195243976 3703 dbSNP
rs1468782643 3704 dbSNP
rs1246574928 3705 dbSNP
rs928308728 3710 dbSNP
rs55681900 3714 dbSNP
rs1251390959 3719 dbSNP
rs574513152 3726 dbSNP
rs181134127 3728 dbSNP
rs1055505814 3733 dbSNP
rs1378741520 3736 dbSNP
rs563608460 3738 dbSNP
rs1439294098 3740 dbSNP
rs892179527 3751 dbSNP
rs1010671897 3753 dbSNP
rs1331191148 3754 dbSNP
rs894625198 3754 dbSNP
rs866893388 3759 dbSNP
rs1038296325 3760 dbSNP
rs1398677275 3761 dbSNP
rs1298840293 3768 dbSNP
rs184906440 3773 dbSNP
rs201422576 3773 dbSNP
rs145103017 3775 dbSNP
rs138850638 3776 dbSNP
rs56767789 3776 dbSNP
rs66577377 3776 dbSNP
rs993759104 3776 dbSNP
rs1043908430 3781 dbSNP
rs1406820577 3791 dbSNP
rs905032520 3795 dbSNP
rs1002112960 3796 dbSNP
rs1321533549 3796 dbSNP
rs1034973313 3802 dbSNP
rs1281999734 3805 dbSNP
rs1482026257 3805 dbSNP
rs1393590996 3809 dbSNP
rs770403343 3813 dbSNP
rs1030298392 3818 dbSNP
rs954733548 3832 dbSNP
rs960680011 3840 dbSNP
rs1309027018 3850 dbSNP
rs1237452576 3852 dbSNP
rs1338026414 3854 dbSNP
rs1007641293 3861 dbSNP
rs1395523125 3875 dbSNP
rs1004245584 3877 dbSNP
rs1353707577 3877 dbSNP
rs775848778 3880 dbSNP
rs1156619299 3881 dbSNP
rs760158876 3885 dbSNP
rs964201068 3891 dbSNP
rs1364303822 3895 dbSNP
rs989974854 3896 dbSNP
rs148101758 3897 dbSNP
rs921400270 3900 dbSNP
rs967232968 3901 dbSNP
rs1487770294 3902 dbSNP
rs1283497773 3903 dbSNP
rs1203722091 3907 dbSNP
rs1284351927 3912 dbSNP
rs12665441 3920 dbSNP
rs1358919586 3924 dbSNP
rs1353571700 3926 dbSNP
rs1295238593 3933 dbSNP
rs622918 3938 dbSNP
rs528221793 3939 dbSNP
rs768873999 3942 dbSNP
rs548187658 3943 dbSNP
rs934925361 3948 dbSNP
rs938381122 3948 dbSNP
rs1052505097 3949 dbSNP
rs1385415357 3949 dbSNP
rs752618409 3949 dbSNP
rs570291878 3950 dbSNP
rs1164979356 3951 dbSNP
rs1419326768 3951 dbSNP
rs796427259 3951 dbSNP
rs946424128 3951 dbSNP
rs1239999993 3959 dbSNP
rs1477231761 3959 dbSNP
rs568034957 3961 dbSNP
rs1449041661 3964 dbSNP
rs991181836 3966 dbSNP
rs915642886 3967 dbSNP
rs622566 3979 dbSNP
rs550456858 3986 dbSNP
rs1317432882 3988 dbSNP
rs1236417886 3991 dbSNP
rs1037840055 3993 dbSNP
rs1326762244 3994 dbSNP
rs867693610 3996 dbSNP
rs17747812 4003 dbSNP
rs538855262 4014 dbSNP
rs1396555313 4016 dbSNP
rs1326571532 4019 dbSNP
rs555323687 4031 dbSNP
rs75689076 4032 dbSNP
rs1475556161 4035 dbSNP
rs1417145560 4042 dbSNP
rs557521946 4052 dbSNP
rs1193378921 4056 dbSNP
rs1467449495 4076 dbSNP
rs1214874696 4078 dbSNP
rs1015971302 4083 dbSNP
rs1271004985 4086 dbSNP
rs1332875725 4091 dbSNP
rs1397501965 4101 dbSNP
rs765339041 4104 dbSNP
rs1274526150 4112 dbSNP
rs1231800005 4122 dbSNP
rs533995110 4133 dbSNP
rs962752557 4133 dbSNP
rs1445963355 4147 dbSNP
rs1028448333 4148 dbSNP
rs954194909 4149 dbSNP
rs866078671 4160 dbSNP
rs1007589101 4161 dbSNP
rs1171444915 4171 dbSNP
rs1452896813 4174 dbSNP
rs752471740 4175 dbSNP
rs1343643630 4178 dbSNP
rs1018040954 4183 dbSNP
rs142814333 4183 dbSNP
rs1341849413 4189 dbSNP
rs773491898 4190 dbSNP
rs893860425 4196 dbSNP
rs1470091927 4199 dbSNP
rs1231721793 4202 dbSNP
rs1206676246 4203 dbSNP
rs1438533069 4204 dbSNP
rs760657344 4205 dbSNP
rs1021418178 4206 dbSNP
rs989082369 4207 dbSNP
rs967221668 4227 dbSNP
rs765263659 4229 dbSNP
rs1371067423 4235 dbSNP
rs1281255864 4241 dbSNP
rs946441349 4242 dbSNP
rs1339377099 4244 dbSNP
rs1310620121 4251 dbSNP
rs577325441 4274 dbSNP
rs1377598483 4278 dbSNP
rs1174629353 4284 dbSNP
rs926390352 4291 dbSNP
rs937757732 4297 dbSNP
rs534765210 4298 dbSNP
rs554658417 4316 dbSNP
rs1056287826 4317 dbSNP
rs960247972 4320 dbSNP
rs991144414 4326 dbSNP
rs915571299 4327 dbSNP
rs758313346 4343 dbSNP
rs1486790635 4347 dbSNP
rs1036987535 4350 dbSNP
rs898489872 4360 dbSNP
rs1185599499 4378 dbSNP
rs574451716 4395 dbSNP
rs1028292283 4399 dbSNP
rs543411791 4401 dbSNP
rs997953 4413 dbSNP
rs1333468841 4416 dbSNP
rs1290923774 4417 dbSNP
rs1416139309 4421 dbSNP
rs919426378 4433 dbSNP
rs1303808576 4438 dbSNP
rs929489170 4441 dbSNP
rs560152896 4448 dbSNP
rs751300073 4455 dbSNP
rs1172625269 4464 dbSNP
rs1403970074 4465 dbSNP
rs1401828485 4475 dbSNP
rs943614245 4481 dbSNP
rs1417194878 4484 dbSNP
rs1038998691 4491 dbSNP
rs1162853110 4494 dbSNP
rs1476253184 4499 dbSNP
rs1393917666 4501 dbSNP
rs1312723936 4502 dbSNP
rs893799481 4504 dbSNP
rs189071078 4513 dbSNP
rs956241621 4524 dbSNP
rs1216345468 4525 dbSNP
rs1467956065 4528 dbSNP
rs989465140 4541 dbSNP
rs180969920 4543 dbSNP
rs6937501 4551 dbSNP
rs1326324130 4552 dbSNP
rs1403657540 4558 dbSNP
rs1234114674 4571 dbSNP
rs73746900 4577 dbSNP
rs1212448746 4579 dbSNP
rs780822372 4583 dbSNP
rs1360261640 4586 dbSNP
rs1291024219 4595 dbSNP
rs1343217235 4600 dbSNP
rs1436344375 4604 dbSNP
rs1394354849 4609 dbSNP
rs979091829 4615 dbSNP
rs1463069369 4616 dbSNP
rs998624409 4623 dbSNP
rs1035502705 4624 dbSNP
rs35215505 4626 dbSNP
rs1169957546 4628 dbSNP
rs937705251 4632 dbSNP
rs1467919098 4639 dbSNP
rs1488509596 4639 dbSNP
rs991917290 4639 dbSNP
rs959914940 4644 dbSNP
rs1251044594 4647 dbSNP
rs745441834 4651 dbSNP
rs1250301394 4652 dbSNP
rs917750333 4654 dbSNP
rs143920140 4669 dbSNP
rs939911486 4674 dbSNP
rs541915409 4676 dbSNP
rs755558062 4689 dbSNP
rs1301810563 4691 dbSNP
rs1022628679 4698 dbSNP
rs898443345 4710 dbSNP
rs931239560 4711 dbSNP
rs1460560898 4713 dbSNP
rs1049675418 4716 dbSNP
rs1378858660 4718 dbSNP
rs1432261451 4722 dbSNP
rs1393041239 4727 dbSNP
rs1195382891 4734 dbSNP
rs1454673552 4737 dbSNP
rs889789082 4747 dbSNP
rs1174942428 4757 dbSNP
rs963409799 4759 dbSNP
rs973163183 4762 dbSNP
rs1209731740 4763 dbSNP
rs13206165 4766 dbSNP
rs1008255945 4769 dbSNP
rs1347531345 4772 dbSNP
rs376087237 4775 dbSNP
rs813861 4788 dbSNP
rs561778578 4789 dbSNP
rs950466385 4800 dbSNP
rs545633179 4802 dbSNP
rs550597557 4807 dbSNP
rs1296711660 4822 dbSNP
rs1375635373 4823 dbSNP
rs912070486 4825 dbSNP
rs1361935485 4827 dbSNP
rs1434370360 4834 dbSNP
rs564321244 4837 dbSNP
rs1175260415 4838 dbSNP
rs1387851544 4840 dbSNP
rs1010432748 4846 dbSNP
rs1363155068 4852 dbSNP
rs749792914 4863 dbSNP
rs1420295866 4868 dbSNP
rs1250622989 4869 dbSNP
rs968975350 4874 dbSNP
rs1329435222 4878 dbSNP
rs915235782 4882 dbSNP
rs946733448 4886 dbSNP
rs1233601390 4891 dbSNP
rs1310308956 4899 dbSNP
rs1213456852 4910 dbSNP
rs1346221556 4911 dbSNP
rs1356088875 4912 dbSNP
rs1237529133 4913 dbSNP
rs1318768510 4921 dbSNP
rs1289092471 4926 dbSNP
rs565967692 4933 dbSNP
rs1258727310 4938 dbSNP
rs1353764505 4942 dbSNP
rs1315090727 4944 dbSNP
rs1396382143 4955 dbSNP
rs1485542072 4959 dbSNP
rs1210364113 4977 dbSNP
rs1269316684 4979 dbSNP
rs532876342 4981 dbSNP
rs1455314882 4991 dbSNP
rs607716 4992 dbSNP
rs1163539400 5001 dbSNP
rs1192426657 5012 dbSNP
rs534485283 5018 dbSNP
rs1419549513 5024 dbSNP
rs1380579342 5029 dbSNP
rs561656397 5034 dbSNP
rs9455000 5035 dbSNP
rs1344974951 5036 dbSNP
rs1056855443 5039 dbSNP
rs895692449 5052 dbSNP
rs748518773 5055 dbSNP
rs1023333537 5061 dbSNP
rs1232749517 5064 dbSNP
rs1440317635 5067 dbSNP
rs939838348 5069 dbSNP
rs963057670 5071 dbSNP
rs1238244066 5089 dbSNP
rs1245808520 5094 dbSNP
rs185450278 5095 dbSNP
rs1315992592 5101 dbSNP
rs1383742509 5105 dbSNP
rs931209357 5109 dbSNP
rs1316135178 5121 dbSNP
rs1325204168 5123 dbSNP
rs1049665292 5140 dbSNP
rs1396036183 5141 dbSNP
rs1245195703 5142 dbSNP
rs1267188942 5151 dbSNP
rs1025998363 5157 dbSNP
rs1163435951 5158 dbSNP
rs1474890416 5166 dbSNP
rs911219232 5167 dbSNP
rs950413053 5185 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 1310.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uauuugcuguggaggAACUCUu 5'
                         |||||| 
Target 5' -----uacacugggaUUGAGAa 3'
 		1 - 17
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000322773.4 | 3UTR | UACACUGGGAUUGAGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE35602 Colorectal cancer stromal tissue 0.564 1.7e-3 0.489 6.6e-3 25 Click to see details
GSE19350 CNS germ cell tumors -0.373 1.2e-1 -0.350 1.3e-1 12 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.19 1.8e-1 -0.048 4.1e-1 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.194 1.9e-1 0.169 2.2e-1 23 Click to see details
GSE28544 Breast cancer -0.177 2.0e-1 -0.304 7.4e-2 24 Click to see details
GSE19536 Breast cancer -0.078 2.2e-1 -0.020 4.2e-1 100 Click to see details
GSE28260 Renal cortex and medulla 0.212 2.4e-1 0.109 3.6e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.104 2.9e-1 0.120 2.6e-1 32 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.226 3.0e-1 -0.167 3.5e-1 8 Click to see details
GSE26953 Aortic valvular endothelial cells 0.108 3.1e-1 0.240 1.3e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.058 4.0e-1 -0.215 1.8e-1 20 Click to see details
GSE21032 Prostate cancer -0.013 4.5e-1 -0.055 3.1e-1 83 Click to see details
GSE17498 Multiple myeloma 0.019 4.5e-1 -0.224 8.2e-2 40 Click to see details
GSE19783 ER+ ER+ breast cancer 0.025 4.6e-1 0.035 4.4e-1 20 Click to see details
GSE38226 Liver fibrosis 0.02 4.7e-1 -0.077 3.7e-1 21 Click to see details
GSE19783 ER- ER- breast cancer -0.003 4.9e-1 0.037 3.7e-1 79 Click to see details
GSE21687 Ependynoma primary tumors -0.002 4.9e-1 0.053 3.4e-1 64 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.593 0.02 0.685 0.01 12 Click to see details
HNSC -0.887 0.06 -0.800 0.1 4 Click to see details
UCEC -0.689 0.07 -0.657 0.08 6 Click to see details
KIRP 0.577 0.12 0.771 0.04 6 Click to see details
STAD -0.929 0.12 -1.000 0.5 3 Click to see details
THCA 0.191 0.33 0.405 0.16 8 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
LUSC -0.066 0.44 -0.179 0.35 7 Click to see details
101 hsa-miR-513c-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054517 GNG13 G protein subunit gamma 13 3 1
MIRT054520 DR1 down-regulator of transcription 1 3 1
MIRT054523 BTG3 BTG anti-proliferation factor 3 5 3
MIRT106071 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT169580 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT259392 SLC6A8 solute carrier family 6 member 8 2 4
MIRT271674 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT286338 PHF12 PHD finger protein 12 2 2
MIRT334476 RPL27A ribosomal protein L27a 2 4
MIRT336466 SRP9 signal recognition particle 9 2 2
MIRT442119 KCNH5 potassium voltage-gated channel subfamily H member 5 2 2
MIRT462292 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT474680 KLF10 Kruppel like factor 10 2 2
MIRT475558 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT479224 CKS2 CDC28 protein kinase regulatory subunit 2 2 2
MIRT496188 TECPR1 tectonin beta-propeller repeat containing 1 2 2
MIRT506494 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 4
MIRT509596 PEX26 peroxisomal biogenesis factor 26 2 4
MIRT512412 KIAA0391 KIAA0391 2 2
MIRT512440 SFTPB surfactant protein B 2 2
MIRT512582 ZNF223 zinc finger protein 223 2 2
MIRT525991 MAGEL2 MAGE family member L2 2 2
MIRT526428 PARP15 poly(ADP-ribose) polymerase family member 15 2 4
MIRT526773 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT528091 UCHL3 ubiquitin C-terminal hydrolase L3 2 2
MIRT530439 SULT1B1 sulfotransferase family 1B member 1 2 2
MIRT532573 GSS glutathione synthetase 2 2
MIRT533991 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 2
MIRT534783 RAD23B RAD23 homolog B, nucleotide excision repair protein 2 2
MIRT536247 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT536472 KIAA1549L KIAA1549 like 2 2
MIRT538429 COL19A1 collagen type XIX alpha 1 chain 2 2
MIRT539324 AHSA2 activator of HSP90 ATPase homolog 2 2 4
MIRT547013 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 2
MIRT552911 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT553170 UBE2G1 ubiquitin conjugating enzyme E2 G1 2 2
MIRT553463 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT553552 TMEM161B transmembrane protein 161B 2 2
MIRT556254 MAPRE2 microtubule associated protein RP/EB family member 2 2 2
MIRT556875 ITGA2 integrin subunit alpha 2 2 2
MIRT558153 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT560321 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT564023 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT566387 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT569340 EFHC1 EF-hand domain containing 1 2 2
MIRT572596 PAPLN papilin, proteoglycan like sulfated glycoprotein 2 2
MIRT574179 TMPO thymopoietin 2 2
MIRT610593 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT615804 COQ7 coenzyme Q7, hydroxylase 2 2
MIRT616715 FEM1B fem-1 homolog B 2 2
MIRT617932 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT620334 SPAST spastin 2 2
MIRT620670 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620712 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT622710 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT623781 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT624112 DNAH10OS dynein axonemal heavy chain 10 opposite strand 2 2
MIRT626538 EMCN endomucin 2 2
MIRT630146 ZDHHC9 zinc finger DHHC-type containing 9 2 4
MIRT631639 WDR91 WD repeat domain 91 2 4
MIRT635123 RAD51 RAD51 recombinase 2 2
MIRT637462 DEFB105B defensin beta 105B 2 4
MIRT637494 DEFB105A defensin beta 105A 2 4
MIRT641198 TRIB1 tribbles pseudokinase 1 2 4
MIRT643397 PROM1 prominin 1 2 2
MIRT644890 ZBED1 zinc finger BED-type containing 1 2 2
MIRT647245 PTGDR2 prostaglandin D2 receptor 2 2 2
MIRT647529 CCDC121 coiled-coil domain containing 121 2 2
MIRT648396 WRN Werner syndrome RecQ like helicase 2 2
MIRT650122 G6PC glucose-6-phosphatase catalytic subunit 2 2
MIRT652356 TMEM92 transmembrane protein 92 2 2
MIRT653818 SIM2 single-minded family bHLH transcription factor 2 2 2
MIRT653944 SEPSECS Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase 2 2
MIRT657291 HOXB5 homeobox B5 2 2
MIRT657827 GJD3 gap junction protein delta 3 2 2
MIRT658707 EMB embigin 2 2
MIRT658740 ELAVL4 ELAV like RNA binding protein 4 2 2
MIRT660176 BNC2 basonuclin 2 2 2
MIRT661324 TBC1D15 TBC1 domain family member 15 2 2
MIRT662206 PLA2G4E phospholipase A2 group IVE 2 2
MIRT662967 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT663877 CCDC65 coiled-coil domain containing 65 2 2
MIRT671780 RGS17 regulator of G protein signaling 17 2 2
MIRT673645 CYCS cytochrome c, somatic 2 2
MIRT675532 RPL37 ribosomal protein L37 2 2
MIRT676350 KLF8 Kruppel like factor 8 2 2
MIRT678428 PDE4C phosphodiesterase 4C 2 2
MIRT678485 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT690847 PVR poliovirus receptor 2 2
MIRT691992 SGTB small glutamine rich tetratricopeptide repeat containing beta 2 2
MIRT698393 TMED10 transmembrane p24 trafficking protein 10 2 2
MIRT701265 NUP210 nucleoporin 210 2 2
MIRT703554 FKBP14 FK506 binding protein 14 2 2
MIRT711985 EXTL3 exostosin like glycosyltransferase 3 2 2
MIRT712654 PGAP3 post-GPI attachment to proteins 3 2 2
MIRT716760 TRABD2A TraB domain containing 2A 2 2
MIRT717932 ZFP64 ZFP64 zinc finger protein 2 2
MIRT718028 FAM163A family with sequence similarity 163 member A 2 2
MIRT718973 SPTSSA serine palmitoyltransferase small subunit A 2 2
MIRT721651 RPL34 ribosomal protein L34 2 2
MIRT724861 RIMBP2 RIMS binding protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-513c-5p (2-chlorophenyl) 2-[[2-(trifluoromethyl)pyridin-4-yl]amino]pyridine-3-carboxylate 11639785 NSC733467 sensitive
hsa-miR-513c-5p (2e)-n-(3-chloro-1,4-dihydroxynaphthalen-2-yl)-2-(7-hydroxy-2,4-dioxochromen-3-ylidene)-2-[(2-pyridin-1-ium-1-ylacetyl)diazenyl]acetamide;chloride 135483951 NSC649826 sensitive
hsa-miR-513c-5p (2s)-n-[(2r)-1-[(2,4-dimethoxyphenyl)methylamino]-1-oxopropan-2-yl]-n-methyl-1-[(2s)-3-methyl-2-[methyl-[(2s)-3-methyl-2-[[(2s)-3-methyl-2-(octanoylamino)butanoyl]amino]butanoyl]amino]butanoyl]pyrroli NSC704971 sensitive
hsa-miR-513c-5p (2Z,5Z)-5-[(4-chlorophenyl)methylidene]-2-[(E)-(3,5-dimethyl-1-phenylpyrazol-4-yl)methylidenehydrazinylidene]-3-phenyl-1,3-thiazolidin-4-one 9572522 NSC720057 resistant
hsa-miR-513c-5p (3e)-5-methoxy-3-(pyridin-4-ylmethylidene)-1h-indol-2-one 24203974 NSC730294 sensitive
hsa-miR-513c-5p (3R,5R,8R,9S,10S,13R,14S,17R)-17-[(2R)-4-(4,5-dihydro-1H-imidazol-2-yl)butan-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol 391085 NSC689620 sensitive
hsa-miR-513c-5p (3s,8r,9s,10r,13s,14s,16e)-3-hydroxy-10,13-dimethyl-16-[(4-nitrophenyl)methylidene]-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-17-one 5472098 NSC716261 resistant
hsa-miR-513c-5p (3z)-3-[(2-chlorophenyl)methylidene]-1-phenylimidazo[1,5-a]benzimidazole 5472492 NSC719480 resistant
hsa-miR-513c-5p (3Z,5Z)-1,1-dimethyl-3,5-bis[(E)-3-phenylprop-2-enylidene]piperidin-1-ium-4-one 6334460 NSC636679 sensitive
hsa-miR-513c-5p (3z,5z)-3,5-bis[(4-fluorophenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608810 NSC634794 sensitive
hsa-miR-513c-5p (3z,5z)-3,5-bis[(4-methoxyphenyl)methylidene]-1,1-dimethylpiperidin-1-ium-4-one;iodide 54608638 NSC634792 sensitive
hsa-miR-513c-5p (4-butanoyloxythieno[2,3-f][1]benzothiol-8-yl) butanoate 388304 NSC682994 sensitive
hsa-miR-513c-5p (4S)-4-hexadecyl-2,6,6-trimethyl-1,3,6,2lambda5-dioxazaphosphocan-6-ium 2-oxide;bromide 386352 NSC678144 resistant
hsa-miR-513c-5p (4S,4aS,5aS,6S,12aR)-4-(dimethylamino)-1,6,10,11,12a-pentahydroxy-6-methyl-3,12-dioxo-N-[[(7-oxo-2,6-dihydrotriazolo[4,5-d]pyrimidin-5-yl)amino]methyl]-4,4a,5,5a-tetrahydrotetracene-2-carboxamide 135422275 NSC67586 sensitive
hsa-miR-513c-5p (4z,5z)-1-[(e)-(2-hydroxyphenyl)methyleneamino]-3-phenyl-4,5-bis(phenylimino)imidazolidine-2-thione 135509182 NSC671409 resistant
hsa-miR-513c-5p (5E)-3-(4-chlorophenyl)-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470241 NSC699069 sensitive
hsa-miR-513c-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-513c-5p (5z)-5-[(2-chlorophenyl)methylidene]-3-(furan-2-ylmethyl)-2-phenylimidazol-4-one 24204861 NSC733164 sensitive
hsa-miR-513c-5p (6-acetamido-5-imino-7-methyl-8-oxo-2,3-dihydro-1h-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 377193 NSC658420 sensitive
hsa-miR-513c-5p (7,12,13,14-tetraacetyloxy-3,10-dioxo-2,9-dioxatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4,6,8(16),11(15),12-hexaen-6-yl) acetate NSC335995 sensitive
hsa-miR-513c-5p (e)-1-(1,2-dihydroacenaphthylen-5-yl)-3-(4-nitrophenyl)prop-2-en-1-one 6167610 NSC746353 resistant
hsa-miR-513c-5p (e)-1-(2,5-dihydroxyphenyl)ethene-2-isonitrile NSC632129 sensitive
hsa-miR-513c-5p (e)-1,3-diphenyl-2-(piperidin-1-ylmethyl)prop-2-en-1-one 6147837 NSC109154 sensitive
hsa-miR-513c-5p (E)-3-(4-methoxyphenyl)-2-(4-oxo-3H-quinazolin-2-yl)prop-2-enenitrile 135454458 NSC684969 resistant
hsa-miR-513c-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-513c-5p (E)-but-2-enedioic acid;2-[4-tert-butyl-1-[(4-methylphenyl)methyl]cyclohexyl]oxy-N,N-dimethylethanamine 5351426 NSC670225 sensitive
hsa-miR-513c-5p (z)-(5-bromo-2-oxo-1h-indol-3-ylidene)sulfamic acid 135505239 NSC707054 sensitive
hsa-miR-513c-5p (Z)-1-(4-bromophenyl)-2-(morpholin-4-ylmethyl)-3-phenylprop-2-en-1-one;hydrobromide 24193247 NSC150311 sensitive
hsa-miR-513c-5p (Z)-3-(benzenesulfinyl)-N-benzyl-N-tert-butylprop-2-enamide 5470812 NSC705331 sensitive
hsa-miR-513c-5p (z)-4-bromo-4-iodo-3-phenyl-3-buten-2-one 3004479 NSC657561 sensitive
hsa-miR-513c-5p [(10R,13S,16E)-16-[[3-methoxy-4-(2-pyrrolidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203499 NSC728323 sensitive
hsa-miR-513c-5p [(1e,3e)-4-(benzenesulfonyl)buta-1,3-dienyl]sulfinylbenzene 5468034 NSC662784 sensitive
hsa-miR-513c-5p [(1R)-1-[[(2S)-2-amino-3-naphthalen-1-ylpropanoyl]amino]-3-methylbutyl]boronic acid;hydrochloride 387440 NSC681229 sensitive
hsa-miR-513c-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-513c-5p [(3S,8R,9S,10R,13S,14S,16E,17S)-17-acetyloxy-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-1,2,3,4,7,8,9,11,12,14,15,17-dodecahydrocyclopenta[a]phenanthren-3-yl] acetate 24204032 NSC730473 sensitive
hsa-miR-513c-5p [(8R,9S,13S,14S)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] [(8S,9R,13R,14R)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] sulfite;ethyl acetate 389907 NSC686560 sensitive
hsa-miR-513c-5p [(9e,21z)-28-(1,3-dithiolan-2-yl)-2,29,31-trihydroxy-11-methoxy-3,7,12,14,17,17,20,24,32-nonamethyl-6,25-dioxo-8,16,18,33-tetraoxa-26-azapentacyclo[25.3.1.14,7.115,19.05,30]tritriaconta-1(30),2,4,9,21 54610764 NSC244404 sensitive
hsa-miR-513c-5p [(E)-(1-chloro-2-methylpropylidene)amino] N-anilinocarbamate 5494354 NSC682841 sensitive
hsa-miR-513c-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 sensitive
hsa-miR-513c-5p [2-(4-methoxyphenyl)-2-oxoethyl] (2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[[(2R)-2-[(4-bromo-2-fluorobenzoyl)amino]-3-[2-(4-methoxyphenyl)-2-oxoethoxy]-3-oxopropyl]diselanyl]propanoate 45029327 NSC746149 resistant
hsa-miR-513c-5p [2-[(e)-(carbamothioylhydrazono)methyl]-6-methoxy-phenoxy]-hydroxy-palladium; pyridine 135484837 NSC638294 sensitive
hsa-miR-513c-5p [3-(difluoromethyl)-6,7-dimethyl-4-oxido-1-oxoquinoxalin-1-ium-2-yl]-phenylmethanone 54612713 NSC742327 sensitive
hsa-miR-513c-5p [3-methyl-4-(phenylcarbamothioyl)phenyl] n-(4-chlorophenyl)carbamate 5471249 NSC710002 sensitive
hsa-miR-513c-5p [3,4,5-triacetyloxy-6-[6-(4-chlorophenyl)-3-cyano-4-phenyl-2-sulfanylidenepyridin-1-yl]oxan-2-yl]methyl acetate 383439 NSC671806 sensitive
hsa-miR-513c-5p [4-(4-aminophenyl)sulfonylphenyl]-[4-(4-aminophenyl)sulfonylphenyl]imino-oxidoazanium 380146 NSC665549 resistant
hsa-miR-513c-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(2-thienyl)methanone 399019 NSC709440 resistant
hsa-miR-513c-5p [5-acetamido-4-[1-[[1-[(5-amino-1,5-dioxo-1-phenylmethoxypentan-2-yl)amino]-3-methyl-1-oxobutan-2-yl]amino]-1-oxopropan-2-yl]oxy-3-hydroxyoxan-2-yl]methyl 11-[(1-nitro-9-oxo-10h-acridine-4-carbonyl)am 3774228 NSC642600 resistant
hsa-miR-513c-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-513c-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-513c-5p {(1r,3s)-3-[(2-amino-6-chloro-9h-purin-9-yl)methyl]-1,2,2-trimethylcyclopentyl}methanol 395604 NSC700349 sensitive
hsa-miR-513c-5p 1-(1,3-benzodioxol-5-yl)-2-[(dimethylamino)methyl]prop-2-en-1-one 436064 NSC382006 sensitive
hsa-miR-513c-5p 1-(4-chloronaphthalen-1-yl)-2-(dimethylamino)ethanol 4-methylbenzenesulfonate(1:1) 230791 NSC26074 sensitive
hsa-miR-513c-5p 1-(4-ethoxyphenyl)-3-(2-methyl-5-propan-2-ylphenyl)urea 240168 NSC46213 resistant
hsa-miR-513c-5p 1-(4-nitrophenyl)-3-(2-pyridyl)thiourea 3005383 NSC695329 resistant
hsa-miR-513c-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-513c-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-513c-5p 1-[(E)-1-[4-[methyl(phenyl)sulfamoyl]phenyl]ethylideneamino]-3-propylthiourea 5466445 NSC691415 resistant
hsa-miR-513c-5p 1-[2-(3-chlorophenyl)-2-oxoethyl]-2-acetylbenzimidazole 46911792 NSC748533 sensitive
hsa-miR-513c-5p 1-[4-chloro-3-(trifluoromethyl)phenyl]-2-[4-[2-[di(propan-2-yl)amino]ethylamino]-6-methylpyrimidin-2-yl]guanidine 49791547 NSC127328 sensitive
hsa-miR-513c-5p 1-[5-(4-chlorophenyl)-3-[4-(7-chloroquinolin-4-yl)oxy-3-methoxyphenyl]-3,4-dihydropyrazol-2-yl]ethanone 155813083 NSC762545 resistant
hsa-miR-513c-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-ethynyl-6-iodopyrimidine-2,4-dione 45028651 NSC743558 sensitive
hsa-miR-513c-5p 1-benzyl-2H-imidazol-2-ide;gold(1+) 374564 NSC652538 sensitive
hsa-miR-513c-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-513c-5p 1-butoxy-4-(dichloromethylidene)-3,5-dimethyl-1,4-dihydrophosphinine 1-oxide 372646 NSC648100 sensitive
hsa-miR-513c-5p 10-nitrosophenanthren-9-ol 95223 NSC48526 sensitive
hsa-miR-513c-5p 11-(3-methoxyphenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608964 NSC697747 sensitive
hsa-miR-513c-5p 11-(4-nitrophenyl)-2,12,15-triazapentacyclo[11.7.1.03,8.09,21.014,19]henicosa-1,3,5,7,9,11,13(21),14(19),15,17-decaen-20-one 54608965 NSC697748 sensitive
hsa-miR-513c-5p 11-cyanomethylen-11h-indolo[1,2-a]indazole 5472501 NSC719690 resistant
hsa-miR-513c-5p 13-chloro-11,17-diazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,12,14,16-heptaene-8,9-dione 19610848 NSC742544 sensitive
hsa-miR-513c-5p 13-methoxy-6-methyl-2-nitro-6,9,17-triazatetracyclo[8.7.1.05,18.011,16]octadeca-1,3,5(18),10,12,14,16-heptaene 438699 NSC658995 resistant
hsa-miR-513c-5p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-513c-5p 1h-purine, 6-[(1-methyl-4-nitro-1h-imidazol-5-yl)seleno]- 3879067 NSC252628 sensitive
hsa-miR-513c-5p 2',6'-dibromo-2-(methoxymethyl)spiro[7,8-dihydro-6h-thieno[3,2-g]quinoline-5,4'-cyclohexa-2,5-diene]-1',4,9-trione 375900 NSC656211 sensitive
hsa-miR-513c-5p 2',6'-dibromospiro[7,8-dihydro-6h-pyrido[2,3-g]quinoline-9,4'-cyclohexa-2,5-diene]-1',5,10-trione 383051 NSC671095 sensitive
hsa-miR-513c-5p 2-(1-(4-(2-pyridyl)piperazino))naphthazarin 376947 NSC658142 sensitive
hsa-miR-513c-5p 2-(2-amino-5-chloro-6-phenylpyrimidin-4-yl)-4-chlorophenol 359847 NSC621457 resistant
hsa-miR-513c-5p 2-(2-chloro-5-methyl-pyrimidin-4-yl)-2-(1-methylbenzimidazol-2-yl)acetonitrile 395227 NSC699702 resistant
hsa-miR-513c-5p 2-(2-chloroethoxy)naphthazarin 378770 NSC661940 sensitive
hsa-miR-513c-5p 2-(2-naphthyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 388200 NSC682768 resistant
hsa-miR-513c-5p 2-(2,1,3-benzothiadiazol-4-ylsulfonyl)-1-(4-chlorophenyl)guanidine 9572213 NSC707404 sensitive
hsa-miR-513c-5p 2-(2,4-dichlorobenzyl)-3,5,6-trimethyl-2h-indazole-7-carbonitrile 367590 NSC637422 resistant
hsa-miR-513c-5p 2-(3-chlorophenyl)-4-phenyl-5,7-dihydropyrido[3,2-d][1]benzazepin-6-one 389012 NSC684480 resistant
hsa-miR-513c-5p 2-(3-chloropropyloxy)naphthazarin 378771 NSC661941 sensitive
hsa-miR-513c-5p 2-(3-methylbutylsulfanyl)naphthalene-1,4-dione 315743 NSC241494 sensitive
hsa-miR-513c-5p 2-(3-phenyl-4,5-bis(phenylimino)-1,3-thiazolidin-2-ylidene)malononitrile 383253 NSC671367 sensitive
hsa-miR-513c-5p 2-(3,4-dichlorophenyl)-N-methyl-N-[3-[methyl(3-pyrrolidin-1-ylpropyl)amino]propyl]acetamide;oxalic acid 398603 NSC708559 sensitive
hsa-miR-513c-5p 2-(4-aminobutyl)-1,4-dihydroxyanthracene-9,10-dione;hydrochloride 439019 NSC699139 resistant
hsa-miR-513c-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-513c-5p 2-(4-isothiocyanatophenyl)sulfanylacetic acid 345648 NSC403376 sensitive
hsa-miR-513c-5p 2-(4-methylphenyl)-5-(2-naphthyl)-1,3,4-oxadiazole 260000 NSC90810 sensitive
hsa-miR-513c-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-513c-5p 2-(5-nitro-2-furyl)prop-2-enamide 381106 NSC667269 sensitive
hsa-miR-513c-5p 2-(6-ethenyl-4-hydroxy-6-methyl-3-methylidene-2-oxo-4,5,7,7a-tetrahydro-3aH-1-benzofuran-7-yl)prop-2-enal 495207 NSC645991 sensitive
hsa-miR-513c-5p 2-(ethoxymethyl)-4,7-dimethoxy-6-[6-(4-methylpiperazin-1-yl)-1h-benzimidazol-2-yl]-1h-benzimidazole 398957 NSC709341 sensitive
hsa-miR-513c-5p 2-[(2e,6e,10e,14z,18e,22e,26e)-3,7,11,15,19,23,27,31-octamethyldotriaconta-2,6,10,14,18,22,26,30-octaenyl]benzene-1,4-diol 5470495 NSC702326 sensitive
hsa-miR-513c-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-513c-5p 2-[(9-amino-5-methylacridine-4-carbonyl)amino]ethyl-dimethyl-[(3-nitrothiophen-2-yl)methyl]azanium;chloride 391705 NSC691249 resistant
hsa-miR-513c-5p 2-[(dimethylamino)methyl]-1-(4-methoxyphenyl)prop-2-en-1-one;hydrochloride 353911 NSC603553 sensitive
hsa-miR-513c-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-513c-5p 2-[[4-(2-dimethylaminoethylcarbamoyl)acridin-9-yl]amino]-5-guanidino-pentanoic acid 392354 NSC692638 resistant
hsa-miR-513c-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-513c-5p 2-[[amino-[bis(2-bromoethyl)amino]phosphoryl]oxymethyl]naphthalene-1,4-dione 390536 NSC688023 sensitive
hsa-miR-513c-5p 2-[2-[(E)-benzylideneamino]-6-phenylpyrimidin-4-yl]-4-chlorophenol 135509207 NSC678883 resistant
hsa-miR-513c-5p 2-[2-hydroxyethyl-[2-[(7-methoxy-1-nitroacridin-9-yl)amino]ethyl]amino]ethanol 384247 NSC673793 sensitive
hsa-miR-513c-5p 2-[2-hydroxyethyl-[3-[(2-methoxy-6-nitroacridin-9-yl)amino]propyl]amino]ethanol 384257 NSC673803 sensitive
hsa-miR-513c-5p 2-[4-(fluoro)benzylamino]-3-phenyl-5,7-diaminoquinoxaline 24204261 NSC731131 sensitive
hsa-miR-513c-5p 2-[5-(2,2-dimethyl-1,3-dioxolan-4-yl)-2,2-dimethyl-1,3-dioxolan-4-yl]-6-methoxy-3-nitro-2H-chromene 358300 NSC618261 sensitive
hsa-miR-513c-5p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-513c-5p 2-acetamido-6-methyl-8-hydroxy-1,4-naphthaquinone 377214 NSC658450 sensitive
hsa-miR-513c-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-513c-5p 2-amino-3-chloronaphthalene-1,4-dione 17748 NSC642009 sensitive
hsa-miR-513c-5p 2-amino-5,8-dihydroxy-1,4-naphthoquinone 377209 NSC658441 sensitive
hsa-miR-513c-5p 2-amino-6-[4-[[4,6-bis(4-chloroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-4-(4-methoxyphenyl)pyridine-3-carbonitrile 45028694 NSC743853 sensitive
hsa-miR-513c-5p 2-amino-8-fluoro-4,6-dimethyl-3-oxo-1-n,9-n-bis[7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3,10-di(propan-2-yl)-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]phenoxazine-1,9-dicarboxamide 383041 NSC671031 sensitive
hsa-miR-513c-5p 2-amino-n-[4,5-dichloro-2-[[methyl-[(1s,2s)-2-pyrrolidin-1-ylcyclohexyl]amino]methyl]phenyl]acetamide 398349 NSC708073 sensitive
hsa-miR-513c-5p 2-bromo-4-(5-fluoro-1,3-benzothiazol-2-yl)aniline 399248 NSC709925 resistant
hsa-miR-513c-5p 2-butenoic acid, 3-[(1,3-dihydroxy-2-naphthalenyl)thio]-, ethyl ester, (z)- 5358773 NSC278632 sensitive
hsa-miR-513c-5p 2-chloro-1-[4-(2-chloroacetyl)-2,3-dimethyl-2,3-dihydroquinoxalin-1-yl]ethanone 254760 NSC79304 sensitive
hsa-miR-513c-5p 2-chloro-3-amino-5,8-dihydoxy-1,4-naphthoquinone 377211 NSC658443 sensitive
hsa-miR-513c-5p 2-cyclohepta[b]pyrrol-2-yl-5-methyl-1,2-dihydro-3h-pyrazol-3-one 363757 NSC628949 sensitive
hsa-miR-513c-5p 2-ethenyl estradiol 381026 NSC667049 sensitive
hsa-miR-513c-5p 2-hydroxy-5-(2-methoxybenzyl)-5h-benzo[b]carbazole-6,11-dione 403879 NSC719412 resistant
hsa-miR-513c-5p 2-imino-1,3-diphenyl-5-phenyliminoimidazolidine-4-thione 383285 NSC671399 sensitive
hsa-miR-513c-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-513c-5p 2-methoxy-N,N-dimethyl-4-[(E)-2-(3-methyl-1,3-benzothiazol-3-ium-2-yl)ethenyl]aniline;iodide 6518097 NSC662251 sensitive
hsa-miR-513c-5p 2-methyl-4-(4-morpholin-4-ylphenyl)iminobenzo[f][1,3]benzoxazol-9-one 386916 NSC679822 sensitive
hsa-miR-513c-5p 2-methyl-9-[(z)-phenylimino]naphth[2,3-d]oxazol-4-one 373683 NSC650574 sensitive
hsa-miR-513c-5p 2-phenyl-N-[3-[4-[3-[(2-phenylquinoline-4-carbonyl)amino]propyl]piperazin-1-yl]propyl]quinoline-4-carboxamide;hydrochloride 384385 NSC674092 sensitive
hsa-miR-513c-5p 2-tert-butyl-9-(4-fluorophenyl)iminobenzo[f][1,3]benzoxazol-4-one 362345 NSC626030 sensitive
hsa-miR-513c-5p 2,1,3-benzoselanadiazole, nitro-6-(trifluoromethyl)- 362897 NSC627371 sensitive
hsa-miR-513c-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-513c-5p 2,2-dibutyl-8-methoxy-1,3,2-benzodioxastannin-4-one 16683129 NSC628564 sensitive
hsa-miR-513c-5p 2,3-dibromo-4-(5-chloro-2-methoxyanilino)-4-oxobutanoic acid 307450 NSC205555 sensitive
hsa-miR-513c-5p 2,3,9,10-tetramethoxy-6,8-dihydro-5h-isoquinolino[2,1-b]isoquinoline-8-carbonitrile 397863 NSC706486 sensitive
hsa-miR-513c-5p 2,5-bis(1-hydroxyethyl)thieno[3,2-f][1]benzothiole-4,8-dione 391376 NSC690433 sensitive
hsa-miR-513c-5p 2,5,9,12-tetrathiabicyclo[11.4.0]heptadeca-1(13),14,16-triene-15,16-dicarbonitrile 387185 NSC680721 resistant
hsa-miR-513c-5p 2,6-bis(ethylaminoacetylamino)-9,10-anthraquinone 355146 NSC608329 resistant
hsa-miR-513c-5p 2,6-diamino-n-[2-[[4-[2-(2,6-diaminohexanoylamino)ethylamino]-9,10-dioxoanthracen-1-yl]amino]ethyl]hexanamide 438922 NSC684438 resistant
hsa-miR-513c-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-513c-5p 2,6-dimethyl-4-(3-nitrophenyl)-3-n,5-n-bis(4-nitrophenyl)-1,4-dihydropyridine-3,5-dicarboxamide 367764 NSC637703 sensitive
hsa-miR-513c-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-513c-5p 2,7-bis(1-hydroxyethyl)thieno[2,3-f][1]benzothiole-4,8-dione 388026 NSC682451 sensitive
hsa-miR-513c-5p 296cfo5qf6 386891 NSC679749 sensitive
hsa-miR-513c-5p 2h-1-benzopyran-2-one, 4-(2-benzofuranyl)-7-methoxy- 364364 NSC630375 resistant
hsa-miR-513c-5p 3-(2-(2,4-dimethylphenyl)-2-oxoethylidene)-3,4-dihydro-2(1h)-quinoxalinone 135403092 NSC682571 resistant
hsa-miR-513c-5p 3-(2-fluoro-2,2-dinitro-ethoxy)propane-1,2-diol 388365 NSC683260 sensitive
hsa-miR-513c-5p 3-(3,5-dibromo-4-methoxyphenyl)-2-(3-pyridinyl)acrylonitrile 5467796 NSC659319 resistant
hsa-miR-513c-5p 3-(4-chlorophenoxy)-4-[4-(2-dimethylaminoethyloxy)phenyl]-7-methoxy-chromen-2-one 395152 NSC699452 sensitive
hsa-miR-513c-5p 3-(4-fluorophenyl)-3-(4-acetoxy-2-methylphenyl)phthalide 383342 NSC671456 resistant
hsa-miR-513c-5p 3-(4-fluorophenyl)-3-(4-hydroxy-2-methylphenyl)phthalide 387973 NSC682335 resistant
hsa-miR-513c-5p 3-(4-fluorophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388534 NSC683516 sensitive
hsa-miR-513c-5p 3-(4-methoxyphenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388538 NSC683518 sensitive
hsa-miR-513c-5p 3-[(e)-carbazol-9-yliminomethyl]-4-hydroxy-5-methoxybenzaldehyde 135436314 NSC718153 sensitive
hsa-miR-513c-5p 3-[[4-(3,4-dihydroxyphenyl)-1,3-thiazol-2-yl]iminomethyl]-4-hydroxychromen-2-one;hydrochloride 135403636 NSC659390 sensitive
hsa-miR-513c-5p 3-[5-[2-[2-(4,4-dimethyl-1,1-dioxo-1,2,5-thiadiazolidin-2-yl)ethylamino]pyrimidin-4-yl]imidazo[2,1-b][1,3]thiazol-6-yl]phenol 138631879 NSC761584 sensitive
hsa-miR-513c-5p 3-3'-(1h-pyrazole-3,5-diyl)bis(1-methyl-1h-indole) 44433919 NSC740345 resistant
hsa-miR-513c-5p 3-chloro-4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride;ethanesulfonic acid 278058 NSC127157 sensitive
hsa-miR-513c-5p 3-chloroindolo[2,1-b]quinazoline-6,12-dione 396706 NSC703315 sensitive
hsa-miR-513c-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 resistant
hsa-miR-513c-5p 3-methyl-4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-1h-1,2,4-triazol-5-one 9556348 NSC698057 sensitive
hsa-miR-513c-5p 3-methyl-5-[(2,3,4,5,6-pentafluorophenyl)-[2,3,5,6-tetrafluoro-4-[(3-methyl-1,2-oxazol-5-yl)methyl]phenyl]methyl]-1,2-oxazole 380224 NSC665700 sensitive
hsa-miR-513c-5p 3-n,6-n,2,7-tetramethylacridine-3,6-diamine;hydrochloride 54608353 NSC32967 resistant
hsa-miR-513c-5p 3,4-dichlorocoumarin 282447 NSC135925 sensitive
hsa-miR-513c-5p 3,5-bis(methylsulfanyl)dithiol-1-ium-4-olate 362515 NSC626539 sensitive
hsa-miR-513c-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-513c-5p 4-((2,2-dibutyl-1,3,2-dioxastannolan-4-yl)methyl)morpholine NSC633511 sensitive
hsa-miR-513c-5p 4-(2-azidophenothiazin-10-yl)-N,N-dimethylbutan-1-amine;oxalic acid 385933 NSC677395 sensitive
hsa-miR-513c-5p 4-(3-thioxodithiol-4-yl)-5,6-dihydrodithiolo[5,4-b][1,4]thiazine-3-thione 398473 NSC708376 resistant
hsa-miR-513c-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-513c-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 resistant
hsa-miR-513c-5p 4-[(1-benzyl-4-chloro-2,5-dioxopyrrol-3-yl)amino]-N-(2-methoxyphenyl)benzamide 1194947 NSC732826 sensitive
hsa-miR-513c-5p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-513c-5p 4-[(4-methyl-1,2-oxazol-5-yl)amino]naphthalene-1,2-dione 384244 NSC673785 sensitive
hsa-miR-513c-5p 4-[(5-methyl-1,2-oxazol-3-yl)amino]naphthalene-1,2-dione 384243 NSC673784 sensitive
hsa-miR-513c-5p 4-[(6-chloro-4h-1,3-benzodioxin-8-yl)methylsulfanyl]pyrrolo[1,2-a]quinoxaline 331156 NSC321491 resistant
hsa-miR-513c-5p 4-[(E)-(4-nitrophenyl)methylideneamino]-3-phenyl-1H-1,2,4-triazol-5-one 9571512 NSC675223 resistant
hsa-miR-513c-5p 4-[(E)-2-(dimethylamino)ethenyl]benzo[g]quinoline-5,10-dione 5469342 NSC686556 sensitive
hsa-miR-513c-5p 4-[(E)-2-piperidin-1-ylethenyl]benzo[g]quinoline-5,10-dione 5781544 NSC642968 sensitive
hsa-miR-513c-5p 4-[(r)-[(2s,5r)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-n-pentan-3-ylbenzamide;hydrochloride 5471112 NSC708822 sensitive
hsa-miR-513c-5p 4-[2-(3-aminopropylamino)ethyldisulfanyl]butane-1-sulfinic acid;hydrochloride 361203 NSC624166 sensitive
hsa-miR-513c-5p 4-[2-[4-[3-(4-methoxyphenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399071 NSC709482 sensitive
hsa-miR-513c-5p 4-[4-(4-sulfinobutyldisulfanyl)butyldisulfanyl]butane-1-sulfinic acid 361262 NSC624205 sensitive
hsa-miR-513c-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-513c-5p 4-amino-1,3-dibromophenanthridin-6(5h)-one 278033 NSC127128 resistant
hsa-miR-513c-5p 4-benzylidene-1,7-dimorpholin-4-ylheptane-3,5-dione;hydrochloride NSC617824 sensitive
hsa-miR-513c-5p 4-methoxy-2-nitronaphtho[2,1-b]furan 100603 NSC329226 sensitive
hsa-miR-513c-5p 4-methyl-1-oxido-1,2,4-benzotriazin-1-ium-3-imine 360889 NSC623599 sensitive
hsa-miR-513c-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-513c-5p 4-methyl-n'-[7-methyl-8-(3,4,5-trimethoxyphenyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]benzenesulfonohydrazide 381384 NSC667924 sensitive
hsa-miR-513c-5p 4-n-(7-chloroquinolin-4-yl)-1-n-cyclohexylcyclohexane-1,4-diamine NSC3618 sensitive
hsa-miR-513c-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-513c-5p 4,6,6-trimethyl-4-[(e)-4-phenylsulfanylbut-1-enyl]norpinan-2-one 5469503 NSC689222 sensitive
hsa-miR-513c-5p 4,8-dioxothieno[3,2-f][1]benzothiole-2-carboxylic acid 375906 NSC656243 sensitive
hsa-miR-513c-5p 4h,7h-furo[2',3',4':4,5]naphth[2,1-e][1,3]oxazin-4-one, 8-(4-chlorophenyl)-8,9-dihydro- 373969 NSC651001 sensitive
hsa-miR-513c-5p 5-(1,2-benzisothiazol-3-yl)-n-(4-methoxyphenyl)-1,3,4-thiadiazol-2-amine 374732 NSC652924 resistant
hsa-miR-513c-5p 5-(2,4-dichlorobenzyl)-2-hydroxy-5h-benzo[b]carbazole-6,11-dione 403882 NSC719415 resistant
hsa-miR-513c-5p 5-(3-phenyl-3-oxo-1-propynyl)pyrimidine-2,4(1h,3h)-dione 359098 NSC619674 sensitive
hsa-miR-513c-5p 5-(phenyldisulfanyl)pentane-1-sulfinic acid 361236 NSC624191 sensitive
hsa-miR-513c-5p 5-[(E)-3-[4-(diethylamino)phenyl]prop-2-enylidene]-2-sulfanylidene-1,3-diazinane-4,6-dione 6376062 NSC684567 sensitive
hsa-miR-513c-5p 5-amino-10,16-bis[2-(dimethylamino)ethyl]-1,9,10,16-tetrazapentacyclo[9.6.2.02,7.08,19.014,18]nonadeca-2(7),3,5,8,11(19),12,14(18)-heptaene-15,17-dione 399633 NSC710550 resistant
hsa-miR-513c-5p 5-benzyl-4-imino-6-methyl-n-phenyl-7h-pyrrolo[2,3-d]pyrimidin-3-amine 135426658 NSC706031 sensitive
hsa-miR-513c-5p 5-bromo-3h-triazolo[4,5-d]pyrimidin-7-ol 135440019 NSC680827 sensitive
hsa-miR-513c-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-513c-5p 5,6,11,12-tetramethyl-5,5a,6,11,11a,12-hexahydroquinoxalino[2,3-b]quinoxaline 365519 NSC633207 sensitive
hsa-miR-513c-5p 5,6,7-trimethoxy-N-(4H-pyrazolo[1,5-a]indol-2-yl)-1H-indole-2-carboxamide 404173 NSC720326 sensitive
hsa-miR-513c-5p 6-(1,3-benzodioxol-5-yl)-8-(4-chlorophenyl)-8,9-dihydro-7h-pyrimido[4,5-b][1,4]diazepin-4-amine 25110635 NSC743962 resistant
hsa-miR-513c-5p 6-(4-acetylanilino)-9-methoxyindeno[1,2-c]quinolin-11-one 24205210 NSC734628 resistant
hsa-miR-513c-5p 6-[(1-hydroxy-1-phenylpropan-2-yl)amino]quinoline-5,8-dione 386228 NSC677945 sensitive
hsa-miR-513c-5p 6-[3-[4-(3-aminopropoxy)butoxy]propyl]-13-[3-[(2-methoxyphenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 137647086 NSC760980 sensitive
hsa-miR-513c-5p 6-[3-[4-(3-aminopropylamino)butylamino]propyl]-13-[3-[(2-methoxyphenyl)methylamino]propyl]-6,13-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(15),2,4(16),8,10-pentaene-5,7,12,14-tetrone 137655794 NSC757981 sensitive
hsa-miR-513c-5p 6-amino-9-methoxyisoindolo[2,1-a]quinoxalin-3-ol 60147951 NSC753218 sensitive
hsa-miR-513c-5p 6-bromo-2-methyl-3-[4-[(3,4,5-trihydroxyoxan-2-yl)amino]phenyl]quinazolin-4-one 380114 NSC665514 sensitive
hsa-miR-513c-5p 6-bromo-2,10-dithiatetracyclo[10.8.0.04,9.014,19]icosa-1(20),4(9),5,7,12,14,16,18-octaene-3,11-dione 397767 NSC706190 sensitive
hsa-miR-513c-5p 6-bromochroman-2-one 266737 NSC105509 resistant
hsa-miR-513c-5p 6-chloro-1,2,3-benzodithiazol-1-ium;chloride 359816 NSC621376 sensitive
hsa-miR-513c-5p 6-methoxynaphthazarin 377431 NSC658874 sensitive
hsa-miR-513c-5p 6-phenyl-6h-indeno[1,2-c]isoquinoline-5,11-dione 334247 NSC338643 resistant
hsa-miR-513c-5p 6,9-dihydroxybenzo[g]isoquinoline-5,10-dione 431317 NSC291926 sensitive
hsa-miR-513c-5p 6h-indeno[1,2-c]isoquinoline-5,11-dione, 6-methyl- 265730 NSC102067 resistant
hsa-miR-513c-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-513c-5p 7-chloro-6-(2-morpholin-4-ylethylamino)quinoline-5,8-dione 379078 NSC663285 sensitive
hsa-miR-513c-5p 7-chloro-6-n-(2-fluoroethylamino)-5,8-quinolinedione 379079 NSC663286 sensitive
hsa-miR-513c-5p 7-chloro-n-[2-[2-[(7-chloro-1-methylbenzo[g]indole-3-carbonyl)amino]ethyl-methylamino]ethyl]-1-methylbenzo[g]indole-3-carboxamide 397209 NSC704618 resistant
hsa-miR-513c-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-513c-5p 7h-5,6-dithioleno[4,3-d]uracil 388876 NSC684074 sensitive
hsa-miR-513c-5p 8-aminoquinoline-5,6-dione 279596 NSC130785 sensitive
hsa-miR-513c-5p 8-azaguanine 8646 NSC749 sensitive
hsa-miR-513c-5p 8-chloro-10-(4-chlorophenyl)-3-methylbenzo[g]pteridine-2,4-dione 363245 NSC627991 sensitive
hsa-miR-513c-5p 8-chloro-n-[2-(dimethylamino)ethyl]-11h-pyrido[2,3-a]carbazole-5-carboxamide 44139299 NSC741237 sensitive
hsa-miR-513c-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-513c-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-513c-5p 9-amino-7-(3,4,5-trimethoxyphenyl)-6h-benzo[c]chromene-8,10-dicarbonitrile 399086 NSC709502 resistant
hsa-miR-513c-5p 9-amino-N-[3-(2-aminoethylamino)propyl]-5-methylacridine-4-carboxamide;hydrochloride 392737 NSC693543 resistant
hsa-miR-513c-5p 9-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386894 NSC679796 sensitive
hsa-miR-513c-5p 9-hydroxy-5a,5b,8,8,11a-pentamethyl-1-(3-oxoprop-1-en-2-yl)-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysene-3a-carboxylic acid 22149181 NSC750324 sensitive
hsa-miR-513c-5p 9,10-dimethyltricyclo[10.4.0.02,7]hexadeca-1(16),2,4,6,12,14-hexaene-4,5,14,15-tetrol 382047 NSC669349 sensitive
hsa-miR-513c-5p 9,14-dihydroxy-16-methyl-2,11-dioxo-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-17-carbonitrile 405342 NSC722565 sensitive
hsa-miR-513c-5p 9h-quino[4,3,2-de][1,10]phenanthrolin-9-one, 2-phenyl- 4567749 NSC686553 sensitive
hsa-miR-513c-5p Ac-907/25004561 6405305 NSC64798 sensitive
hsa-miR-513c-5p Acetamide, n-(2-mercaptoethyl)-, benzoate (6ci, 7ci) 281604 NSC134459 sensitive
hsa-miR-513c-5p Acetic acid;4-(2-aminocyclohexyl)imino-2-methylbenzo[f][1,3]benzoxazol-9-one 388014 NSC682436 sensitive
hsa-miR-513c-5p Acetoxy-[4-(acetoxymercurio)-2,5-dimethoxy-3-(3-oxobutanoylamino)phenyl]mercury 16683868 NSC635979 sensitive
hsa-miR-513c-5p Acronycine, 2-nitro 342903 NSC380856 sensitive
hsa-miR-513c-5p Actinomycin x4357g methoxime 9573583 NSC237671 sensitive
hsa-miR-513c-5p Ae 200 NSC22709 sensitive
hsa-miR-513c-5p Albb-024793 221765 NSC6777 resistant
hsa-miR-513c-5p Antineoplastic-615538 NSC615538 sensitive
hsa-miR-513c-5p Antineoplastic-655901 375754 NSC655901 sensitive
hsa-miR-513c-5p Antineoplastic-690266 5469577 NSC690266 sensitive
hsa-miR-513c-5p Aquamycin 10971 NSC38643 sensitive
hsa-miR-513c-5p Auranofin 6333901 NSC321521 sensitive
hsa-miR-513c-5p Aza-heterocyclic derivative, 4c 387030 NSC680350 sensitive
hsa-miR-513c-5p B676297k277 3',4'-deoxypsorospermin 3',4'-chlorohydrin 354175 NSC605099 sensitive
hsa-miR-513c-5p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-513c-5p Benzenesulfonamide, m-(4-amino-3-methoxy-1-naphthylazo)- 248466 NSC65537 sensitive
hsa-miR-513c-5p Benzo[1,2-b:4,5-b']dithiophene-4,8-diol, dipropionate 388303 NSC682993 sensitive
hsa-miR-513c-5p Benzo[1,2-b:5,4-b']dithiophene-4,8-dione, 2-acetyl- 388028 NSC682453 sensitive
hsa-miR-513c-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-513c-5p Benzo[g]quinoxaline-5,10-dione, 5,10-dihydro-2,3-dimethyl- 353644 NSC602617 sensitive
hsa-miR-513c-5p Benzyl-(1-methyltetrazol-5-yl)azanide;gold(1+);triphenylphosphanium 6333602 NSC274553 sensitive
hsa-miR-513c-5p Benzyl 4-oxo-4-[[2-oxo-2-propan-2-yloxy-1-[(2,2,5,5-tetramethylcyclopentanecarbonyl)amino]ethyl]amino]-3-(phenylmethoxycarbonylamino)butanoate 383829 NSC672446 resistant
hsa-miR-513c-5p Bis(helenalinyl)glutarate 336831 NSC352330 sensitive
hsa-miR-513c-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-513c-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-513c-5p Bn-2629 393111 NSC694501 sensitive
hsa-miR-513c-5p Bortezomib 387447 NSC681239 approved sensitive
hsa-miR-513c-5p Bulleyanin 338942 NSC363787 sensitive
hsa-miR-513c-5p Butanedioic acid;10-[3-(4-methylpiperazin-1-yl)propyl]-2-(trifluoromethyl)phenothiazine 5351168 NSC46061 sensitive
hsa-miR-513c-5p C8, carbonyl prodigiosine 135540857 NSC742417 sensitive
hsa-miR-513c-5p Caracemide 54747 NSC253272 sensitive
hsa-miR-513c-5p Carbon monoxide;1-[(4-cyanophenyl)iminomethyl]naphthalen-2-olate;iridium 6711631 NSC632882 sensitive
hsa-miR-513c-5p Carquniostatin b 380452 NSC666034 sensitive
hsa-miR-513c-5p Cbmicro_021216 812842 NSC707055 sensitive
hsa-miR-513c-5p Cepharanthine 10206 NSC758965 sensitive
hsa-miR-513c-5p Chapliatrin 5458480 NSC249956 sensitive
hsa-miR-513c-5p Chemdiv3_000672 397122 NSC704435 resistant
hsa-miR-513c-5p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-513c-5p Chinon 95715 NSC30706 sensitive
hsa-miR-513c-5p Chloroplatinum(1+); 2-diphenylphosphanyl-n,n-dimethyl-ethanamine 499568 NSC685470 sensitive
hsa-miR-513c-5p Chonemorphine 54612857 NSC748909 sensitive
hsa-miR-513c-5p Cisplatin 5460033 NSC119875 approved sensitive
hsa-miR-513c-5p Clothixamide maleate 44144400 NSC78714 sensitive
hsa-miR-513c-5p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-513c-5p Coptisine chloride 72321 NSC119754 sensitive
hsa-miR-513c-5p Crotoxin cd NSC636009 sensitive
hsa-miR-513c-5p Cyclopentane; dichloro(dichloroferriooxy)iron; dichloroiron 498236 NSC608972 sensitive
hsa-miR-513c-5p Cytochalasin h 5351303 NSC305222 resistant
hsa-miR-513c-5p D.b.t.c. 12688 NSC2604 sensitive
hsa-miR-513c-5p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-513c-5p Dasatinib 3062316 NSC732517 approved resistant
hsa-miR-513c-5p Destruxin a 122810 NSC361126 sensitive
hsa-miR-513c-5p Destruxin b NSC236580 sensitive
hsa-miR-513c-5p Destruxin e 107863 NSC361127 sensitive
hsa-miR-513c-5p Di-p-tolyliodinium bromide 54601177 NSC8985 sensitive
hsa-miR-513c-5p Dibutyl-bis(4,5-dihydrothiazol-2-ylsulfanyl)stannane 9571331 NSC643864 sensitive
hsa-miR-513c-5p Dibutyl(bis((3-(2-fluorophenyl)acryloyl)oxy))stannane 16683204 NSC643860 sensitive
hsa-miR-513c-5p Dichloro(diphenyl)stannane;1,4,7,10,13,16-hexaoxacyclooctadecane 338856 NSC363143 sensitive
hsa-miR-513c-5p Dichloroallyl lawsone 277767 NSC126771 sensitive
hsa-miR-513c-5p Diethyl 2-((4-(((3-chloro-2-phenyl-6-quinoxalinyl)methyl)amino)benzoyl)amino)pentanedioate 373186 NSC649150 sensitive
hsa-miR-513c-5p Diethyl 2-[[4-(5,7-diamino-3-phenylquinoxalin-2-yl)oxybenzoyl]amino]pentanedioate 405952 NSC723741 sensitive
hsa-miR-513c-5p Diethyl 2-[[4-[(3-ethoxycarbonylquinoxalin-2-yl)amino]benzoyl]amino]pentanedioate 382848 NSC670678 resistant
hsa-miR-513c-5p Diethyl 2-[[4-[[[3-ethoxycarbonyl-7-(trifluoromethyl)quinoxalin-2-yl]amino]methyl]benzoyl]amino]pentanedioate 390810 NSC688812 resistant
hsa-miR-513c-5p Diethyl 2-[[4-[[7-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 389671 NSC686048 resistant
hsa-miR-513c-5p Diethyl 2-[[4-[3-phenyl-6-(trifluoromethyl)quinoxalin-2-yl]oxybenzoyl]amino]pentanedioate 390814 NSC688816 resistant
hsa-miR-513c-5p Diethyl 2-[[4-[8-amino-3-phenyl-6-(trifluoromethyl)quinoxalin-2-yl]oxybenzoyl]amino]pentanedioate 393058 NSC694342 resistant
hsa-miR-513c-5p Diethyl 5,10-dioxobenzo[g]quinoxaline-2,3-dicarboxylate 400766 NSC713197 sensitive
hsa-miR-513c-5p Diethyl p-phenoxybenzalmalonate 370253 NSC643027 sensitive
hsa-miR-513c-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-513c-5p Dihydro-5-azacytidine 5351280 NSC264880 sensitive
hsa-miR-513c-5p Diisopropoxybis(1,4-naphthochinone-2-olato)titanium(iv) 368058 NSC638383 sensitive
hsa-miR-513c-5p Dimethylarsinothious acid, 2,4-pyrimidinediyl ester 294741 NSC163664 sensitive
hsa-miR-513c-5p Diphenyl-bis(8-quinolyloxy)stannane 16683148 NSC628591 sensitive
hsa-miR-513c-5p Discorhabdin b 135409044 NSC656203 sensitive
hsa-miR-513c-5p Discorhabdin i 135409047 NSC656206 sensitive
hsa-miR-513c-5p Elsinochrome c 495866 NSC671197 sensitive
hsa-miR-513c-5p Erb-38 immunotoxin NSC683039 resistant
hsa-miR-513c-5p Eremantholide b 5478094 NSC380721 sensitive
hsa-miR-513c-5p Eriofertin 5458567 NSC283440 sensitive
hsa-miR-513c-5p Ethyl (4s)-4-amino-5-[[(2r)-3-[4-[bis(2-chloroethyl)amino]phenyl]-1-ethoxy-1-oxopropan-2-yl]amino]-5-oxopentanoate;2,2,2-trifluoroacetic acid 388719 NSC683777 resistant
hsa-miR-513c-5p Ethyl (e)-2-cyano-3-[5'-ethyl-6'-(1-hydroxyethyl)-2,2'-spirobi[1,3-dihydroindene]-5-yl]prop-2-enoate 6477478 NSC670289 sensitive
hsa-miR-513c-5p Ethyl (Z)-3-(1,4-dihydroxynaphthalen-2-yl)sulfanylbut-2-enoate 5358772 NSC278631 sensitive
hsa-miR-513c-5p Ethyl 2-[(4,9-dihydroxybenzo[f][1,3]benzothiazol-2-yl)diazenyl]-2-oxoacetate 367754 NSC637693 sensitive
hsa-miR-513c-5p Ethyl 2-[(e)-[2-(2-hydroxy-1h-indol-3-yl)indol-3-ylidene]amino]oxyacetate 135436298 NSC717838 resistant
hsa-miR-513c-5p Ethyl 3-(4-fluoroanilino)quinoxaline-2-carboxylate 387137 NSC680553 resistant
hsa-miR-513c-5p Ethyl 3-[4-[bis(2-chloroethyl)amino]phenyl]-2-[4-(7-chloro-2-oxo-5-phenyl-3h-1,4-benzodiazepin-1-yl)butanoylamino]propanoate 388729 NSC683782 sensitive
hsa-miR-513c-5p Ethyl 5-[(2,6-dichlorophenyl)-(5-ethoxycarbonyl-4-hydroxy-6-morpholin-4-yl-2-oxo-1h-pyridin-3-yl)methyl]-4-hydroxy-2-morpholin-4-yl-6-oxo-1h-pyridine-3-carboxylate 54688724 NSC701639 sensitive
hsa-miR-513c-5p Ethyl 6-chloro-4-phenyl-2-(piperazin-1-ylmethyl)quinoline-3-carboxylate 369623 NSC641536 sensitive
hsa-miR-513c-5p Ethyl n-[(7-chloro-2-methylsulfanyl-4,5-dioxo-3h-pyrano[3,4-e][1,3]oxazin-2-yl)amino]carbamate 396374 NSC702323 sensitive
hsa-miR-513c-5p Ethylsulfanyl[?]one 391210 NSC690043 sensitive
hsa-miR-513c-5p Eu-0000702 399169 NSC709588 resistant
hsa-miR-513c-5p Ex-a776 5356520 NSC59984 sensitive
hsa-miR-513c-5p Fostriecin 6913994 NSC339638 sensitive
hsa-miR-513c-5p From marine animal dolabella auricularia 354399 NSC606195 sensitive
hsa-miR-513c-5p Geldanamycin deriv 5458696 NSC320877 sensitive
hsa-miR-513c-5p Girolline 362388 NSC626159 resistant
hsa-miR-513c-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-513c-5p Go-y103 1352182 NSC677240 sensitive
hsa-miR-513c-5p Gw410563a 10425574 NSC756225 resistant
hsa-miR-513c-5p Gw435821x 44418540 NSC756233 sensitive
hsa-miR-513c-5p Gw678313x 5329875 NSC756304 resistant
hsa-miR-513c-5p Gw811761x 6539382 NSC756375 resistant
hsa-miR-513c-5p Haterumalide na methyl esters 24204452 NSC731928 sensitive
hsa-miR-513c-5p Helenin 72724 NSC93131 sensitive
hsa-miR-513c-5p Herveline o 5459269 NSC676002 sensitive
hsa-miR-513c-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-513c-5p Horminon 99965 NSC294577 sensitive
hsa-miR-513c-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-513c-5p Hydroxymethoxytetrangulol 379539 NSC664214 sensitive
hsa-miR-513c-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-513c-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-513c-5p Hypothemycin 5458809 NSC354462 sensitive
hsa-miR-513c-5p Il4(38-37)-pe38kdel NSC673267 resistant
hsa-miR-513c-5p Imidazole, 1-(4-chlorophenyl)-4-(4-nitrophenyl)- 355940 NSC610744 resistant
hsa-miR-513c-5p Indole-2,3-dione, 5-methyl-, 3-[(o-nitrophenyl)hydrazone] 3632950 NSC117915 resistant
hsa-miR-513c-5p Isodonol 317640 NSC250682 sensitive
hsa-miR-513c-5p J3.547.609a 364763 NSC631522 sensitive
hsa-miR-513c-5p J3.572.907k 396709 NSC703318 sensitive
hsa-miR-513c-5p Jolkinolide b 161954 NSC700087 sensitive
hsa-miR-513c-5p Kh-carb10 56946086 NSC745321 sensitive
hsa-miR-513c-5p Kipca 4055 NSC4170 approved sensitive
hsa-miR-513c-5p Kuc110490n 377410 NSC658853 sensitive
hsa-miR-513c-5p L06tdn89ab 276876 NSC125347 sensitive
hsa-miR-513c-5p Leinamycin 5459203 NSC645777 sensitive
hsa-miR-513c-5p Liatris laevigata lactone #2 5477810 NSC357288 sensitive
hsa-miR-513c-5p Liscunditrin 5458805 NSC354051 sensitive
hsa-miR-513c-5p Lmpk12113341 369954 NSC642321 sensitive
hsa-miR-513c-5p Ls-12493 5468708 NSC674913 sensitive
hsa-miR-513c-5p Ls-162021 6058184 NSC52429 resistant
hsa-miR-513c-5p Ls-28225 16683189 NSC643845 sensitive