pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-1246 |
Genomic Coordinates | chr2: 176600980 - 176601052 |
Synonyms | MIRN1246, hsa-mir-1246, MIR1246 |
Description | Homo sapiens miR-1246 stem-loop |
Comment | None |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-1246 | |||||||||
Sequence | 11| AAUGGAUUUUUGGAGCAGG |29 | |||||||||
Evidence | Experimental | |||||||||
Experiments | Illumina | |||||||||
SNPs in miRNA |
|
|||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | BRI3BP | ||||||||||||||||||||
Synonyms | BNAS1, HCCR-1, HCCR-2, HCCRBP-1, HCCRBP-3, KG19 | ||||||||||||||||||||
Description | BRI3 binding protein | ||||||||||||||||||||
Transcript | NM_080626 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on BRI3BP | |||||||||||||||||||||
3'UTR of BRI3BP (miRNA target sites are highlighted) |
>BRI3BP|NM_080626|3'UTR 1 AGGTCAGCCGGCCGGGCGGGTCCACAGTTACCAGCACGCTGTCTCAGAAAACGAAAACGGAGGAAAAAAACCCCAAACCC 81 CAAACAATCTTAATAAACACGACTGAGCAAGAAAGTGGCGCTGTGTAGGGCTATTTCCACCCACCCGGCAGCTCTTAGGA 161 CACATTCCCAGAAGAGCGGAAAGATCATTGACGTGGAACTACACACGAAGTGTAATTAGTGGGGGAAAAAATATTTTTTA 241 AACAAAGGATATAACCATATTTAGTTGTACAGTAAGAGAAATTTATCTGTGCATAGAGCATAAAGTTAATTTTTTCAAGC 321 ATTTAAATACATCTTTTGTAAGGTTTTTTAATAAAGGCAGATTGAGTCAAGTT Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | hESCs (WA-09) | ||||||
Disease | 140707.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293S |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084068. RNA binding protein: AGO2. Condition:CLIP_noemetine_SigmaAb
HITS-CLIP data was present in GSM1084079. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084068 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_noemetine_SigmaAb |
Location of target site | ENST00000341446.8 | 3UTR | AUUUGAUUUGAAUAGUGUGUGUGUGUACAUGGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM1084079 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_hippuristanol_rep2_AbnovaAb |
Location of target site | ENST00000341446.8 | 3UTR | AUUUGAUUUGAAUAGUGUGUGUGUGUACAUGGUGUGUGUGUGUGUGUGC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000341446.8 | 3UTR | UAUAGCAUUUAAUUUGGCACUUAAUAUAAAUCCAUUUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
52 hsa-miR-1246 Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT053774 | DYRK1A | dual specificity tyrosine phosphorylation regulated kinase 1A | 4 | 1 | ||||||||
MIRT196431 | TAOK1 | TAO kinase 1 | 2 | 6 | ||||||||
MIRT444394 | ZNF480 | zinc finger protein 480 | 2 | 2 | ||||||||
MIRT447596 | MSH3 | mutS homolog 3 | 2 | 2 | ||||||||
MIRT454049 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | 2 | 2 | ||||||||
MIRT458257 | ZNF85 | zinc finger protein 85 | 2 | 2 | ||||||||
MIRT461493 | KIAA1009 | centrosomal protein 162 | 1 | 1 | ||||||||
MIRT474057 | LMNB2 | lamin B2 | 2 | 2 | ||||||||
MIRT479231 | CKS2 | CDC28 protein kinase regulatory subunit 2 | 2 | 6 | ||||||||
MIRT485663 | CHD7 | chromodomain helicase DNA binding protein 7 | 2 | 2 | ||||||||
MIRT485735 | CALM2 | calmodulin 2 | 2 | 2 | ||||||||
MIRT498809 | SRRT | serrate, RNA effector molecule | 2 | 8 | ||||||||
MIRT501190 | SKIL | SKI like proto-oncogene | 2 | 2 | ||||||||
MIRT502619 | DGS2 | DiGeorge syndrome/velocardiofacial syndrome complex 2 | 2 | 6 | ||||||||
MIRT502665 | CTC1 | CST telomere replication complex component 1 | 2 | 13 | ||||||||
MIRT512313 | ADCY9 | adenylate cyclase 9 | 2 | 6 | ||||||||
MIRT513756 | PIM1 | Pim-1 proto-oncogene, serine/threonine kinase | 2 | 2 | ||||||||
MIRT514651 | CRADD | CASP2 and RIPK1 domain containing adaptor with death domain | 2 | 2 | ||||||||
MIRT514865 | SHOX2 | short stature homeobox 2 | 2 | 2 | ||||||||
MIRT527109 | ARHGAP15 | Rho GTPase activating protein 15 | 2 | 2 | ||||||||
MIRT527145 | GPATCH11 | G-patch domain containing 11 | 2 | 2 | ||||||||
MIRT528507 | HTR7 | 5-hydroxytryptamine receptor 7 | 2 | 4 | ||||||||
MIRT532109 | RRP8 | ribosomal RNA processing 8 | 2 | 2 | ||||||||
MIRT534601 | RORA | RAR related orphan receptor A | 2 | 2 | ||||||||
MIRT538906 | BRI3BP | BRI3 binding protein | 2 | 4 | ||||||||
MIRT544541 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 2 | ||||||||
MIRT547430 | MED4 | mediator complex subunit 4 | 2 | 2 | ||||||||
MIRT553029 | USP48 | ubiquitin specific peptidase 48 | 2 | 2 | ||||||||
MIRT555136 | PTPRD | protein tyrosine phosphatase, receptor type D | 2 | 2 | ||||||||
MIRT562091 | KIAA0895 | KIAA0895 | 2 | 2 | ||||||||
MIRT562584 | CBX3 | chromobox 3 | 2 | 4 | ||||||||
MIRT563747 | ZNF763 | zinc finger protein 763 | 2 | 2 | ||||||||
MIRT573310 | AKR7A2 | aldo-keto reductase family 7 member A2 | 2 | 2 | ||||||||
MIRT687232 | PLAGL2 | PLAG1 like zinc finger 2 | 2 | 2 | ||||||||
MIRT704465 | CREBRF | CREB3 regulatory factor | 2 | 2 | ||||||||
MIRT718817 | PYGO1 | pygopus family PHD finger 1 | 2 | 2 | ||||||||
MIRT731194 | NFIB | nuclear factor I B | 2 | 1 | ||||||||
MIRT732503 | SPRED2 | sprouty related EVH1 domain containing 2 | 3 | 0 | ||||||||
MIRT733489 | MIF | macrophage migration inhibitory factor | 2 | 0 | ||||||||
MIRT734071 | SRSF1 | serine and arginine rich splicing factor 1 | 2 | 0 | ||||||||
MIRT734733 | AR | androgen receptor | 3 | 0 | ||||||||
MIRT734755 | GLS2 | glutaminase 2 | 2 | 0 | ||||||||
MIRT735248 | CFTR | cystic fibrosis transmembrane conductance regulator | 8 | 1 | ||||||||
MIRT736017 | ELAVL1 | ELAV like RNA binding protein 1 | 2 | 0 | ||||||||
MIRT736329 | DNAH3 | dynein axonemal heavy chain 3 | 2 | 0 | ||||||||
MIRT737381 | CCNG2 | cyclin G2 | 2 | 0 | ||||||||
MIRT755524 | FOXA2 | forkhead box A2 | 3 | 1 | ||||||||
MIRT755713 | DIXDC1 | DIX domain containing 1 | 2 | 1 | ||||||||
MIRT755714 | WNT9A | Wnt family member 9A | 2 | 1 | ||||||||
MIRT755715 | RAC2 | Rac family small GTPase 2 | 2 | 1 | ||||||||
MIRT755716 | FRAT2 | FRAT2, WNT signaling pathway regulator | 2 | 1 | ||||||||
MIRT756132 | ACE2 | angiotensin I converting enzyme 2 | 3 | 1 |
miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|