| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-452 |
| Genomic Coordinates | chrX: 151959628 - 151959712 |
| Synonyms | MIRN452, hsa-mir-452, MIR452 |
| Description | Homo sapiens miR-452 stem-loop |
| Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations. |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-452-3p | ||||||||||||||||||
| Sequence | 58| CUCAUCUGCAAAGAAGUAAGUG |79 | ||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||
| Experiments | Array-cloned | ||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||
| Putative Targets | |||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | ARHGEF17 | ||||||||||||||||||||
| Synonyms | P164RHOGEF, RHOGEF17, TEM4, p164-RhoGEF | ||||||||||||||||||||
| Description | Rho guanine nucleotide exchange factor 17 | ||||||||||||||||||||
| Transcript | NM_014786 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on ARHGEF17 | |||||||||||||||||||||
| 3'UTR of ARHGEF17 (miRNA target sites are highlighted) |
>ARHGEF17|NM_014786|3'UTR 1 CCCTGTCTGCCGTGGCCCAGGACTCGCCCGCCCACCTGCCTTCAGCCTGCTTGCCTCTCCCTAGCCCACACGCAGACTTT 81 GACCAGGAGTATCCAGCCAGGGGCACACATGTGCCTGCGTGGGCTCTGCCTTGTCTTCGCGGAAGCATTCCTGATGGAAC 161 ACCCACTGGCCAGCCAGGCCATGGCTTCTCCCGACCCTCTGGCTGCCCCGGTGCTTCCAGTCATGATCGGGTGGGGGACA 241 TGTGGGCTGACCAGGACCTCTGACCCTGGAGCTTCTACCAAAGACACAGCTGGGTCTGGACCCCACGGGGCTGGGGAGGG 321 CCATGTGCAATATTTGGAGGGTTTTCTGGAGGGCAGCAGGAAGGCTGGGGAATTCCCCATGTACAGTATTTATGTTTCTT 401 TTTAGATGTGTACCTTCCCAAGCACTTATTTATGCAGTGACCTGGTCACCTGGGGTGGGGGTGATTTGAGGAAATGACAT 481 GAGGAAAAGAAACCTATTCCTGCCCTGGGGACCACCCTGGGACTCTAACCAAGCCTTCCTGGAGGGACCCATGCGCCCCT 561 GAGCCCCATTCCATTCATACAGACACACACGTACGCACACTGCATGTCCAAGGCCCTAAACATTGCCCGTTGACATAAAC 641 TTTCCAGGGCCCCAGCCTGATGGGGCTGCCCTCAGTCCTCTAGATCAAGATGCTGACTATTAGGGGGCAGTGATTGCCAT 721 CTGGGGACCTGTCAGGCTTTGTCATTTCCCAGTTTGTTGGTGGTGCCTTTAGTGGTTCCCTAATTTGGGAACACTGATGG 801 GGCCTTGGACAGGGCTTTCTCTCAGGTAGGAGAAATGGGCCCATGATCTCCTCACAGTCGCCCCCAGTCCTTGGCCCTGC 881 TTCCCTGTGTCTCATGCACTGGCACATATGGTCACCTTGGAGGGCAGACCTAGGAGCCCCTCTGACCACTGAATCCGTCT 961 CCACACCCCTTCTGCCAAGGGAAGCCCCTTCAGGAAGGACCCCCCAAAGCTGAGGGGCTGAATGTAGCCTTTTCAACAGA 1041 GAAGGCTCCCACTTGAGAGCAGCCTCTACCTGACCCCCTGGACCACAGAGAGCCACTCTGACCCTCAGCCCCCTCGCTTC 1121 TTCAGCTAAAACTCCAAAGGTTTGGTTTCAGATGGGGTTTGTTTTGTTCTGTTTGGTTTTGGTTTTGTTTGGGGTGGGTG 1201 GGTCATTGCGGTCTTAGATTATGTTTCTCTTGCTACCAAACAGTCATGTATTAACTCTCTTTGGATGATGAAGTTTAAAG 1281 AGTCAATAAATAGAAACACCAGATGACTGCATTGGTGGCCACAGTGGCCTCCTGTCAGCAACCTCAGGGCTCAGTCTCCC 1361 TGGCCACATGGGCCTTCCGACGTCCACACACTTGGGAAGAAGGGAGGCCTTGGAGACCCAGAAGAGTGCTGGACGGCGAG 1441 GTTGCCACGATTTGCTGTGTTACCTGGGCAGGTGGCTGGGCTGCAGTTTCCTCATCAGGAAAATAAAGGGGTTGTACCAG 1521 TTCAGTGCTTTGTAACCAGGGTTACATGGTAGAATCCCTTGCAGATGACATGTAAATGCAGAAACATGATTCGTAACTTA 1601 AAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | hESCs (WA-09) | ||||||
| Disease | 9828.0 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000263674.3 | 3UTR | GGUAGAAUCCCUUGCAGAUGACAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
87 hsa-miR-452-3p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT150000 | MIDN | midnolin |  |
|
2 | 10 | ||||||
| MIRT330600 | ZWINT | ZW10 interacting kinetochore protein | |
|
2 | 2 | ||||||
| MIRT358701 | SUB1 | SUB1 homolog, transcriptional regulator | |
|
2 | 4 | ||||||
| MIRT362854 | EIF4H | eukaryotic translation initiation factor 4H | |
|
2 | 2 | ||||||
| MIRT447215 | ATXN7 | ataxin 7 | |
|
2 | 2 | ||||||
| MIRT466655 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | |
|
2 | 6 | ||||||
| MIRT483979 | PANK1 | pantothenate kinase 1 | |
|
2 | 8 | ||||||
| MIRT485118 | SF3B3 | splicing factor 3b subunit 3 | |
|
2 | 2 | ||||||
| MIRT488864 | AUTS8 | Autism, susceptibility to, 8 | |
|
2 | 2 | ||||||
| MIRT492293 | SH2B3 | SH2B adaptor protein 3 | |
|
2 | 2 | ||||||
| MIRT492976 | NCK2 | NCK adaptor protein 2 | |
|
2 | 2 | ||||||
| MIRT497410 | LRRC40 | leucine rich repeat containing 40 | |
|
2 | 2 | ||||||
| MIRT511143 | MRPL17 | mitochondrial ribosomal protein L17 | |
|
2 | 6 | ||||||
| MIRT512650 | MAP3K2 | mitogen-activated protein kinase kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT513017 | NSFL1C | NSFL1 cofactor | |
|
2 | 6 | ||||||
| MIRT520445 | TSPAN2 | tetraspanin 2 | |
|
2 | 6 | ||||||
| MIRT527995 | NDNF | neuron derived neurotrophic factor | |
|
2 | 2 | ||||||
| MIRT528667 | PDE4DIP | phosphodiesterase 4D interacting protein | |
|
2 | 2 | ||||||
| MIRT533512 | TRIM71 | tripartite motif containing 71 | |
|
2 | 2 | ||||||
| MIRT537404 | FBXO47 | F-box protein 47 | |
|
2 | 2 | ||||||
| MIRT538161 | DCP2 | decapping mRNA 2 | |
|
2 | 2 | ||||||
| MIRT539124 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | |
|
2 | 2 | ||||||
| MIRT540666 | MIS18A | MIS18 kinetochore protein A | |
|
2 | 4 | ||||||
| MIRT542948 | GDF11 | growth differentiation factor 11 | |
|
2 | 2 | ||||||
| MIRT547534 | MAML3 | mastermind like transcriptional coactivator 3 | |
|
2 | 2 | ||||||
| MIRT559033 | C20orf24 | chromosome 20 open reading frame 24 | |
|
2 | 4 | ||||||
| MIRT559554 | ARF6 | ADP ribosylation factor 6 | |
|
2 | 2 | ||||||
| MIRT570177 | RCBTB1 | RCC1 and BTB domain containing protein 1 | |
|
2 | 2 | ||||||
| MIRT573149 | ITGA9 | integrin subunit alpha 9 | |
|
2 | 2 | ||||||
| MIRT575849 | Rab1 | RAB1A, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT611034 | RRP1B | ribosomal RNA processing 1B | |
|
2 | 2 | ||||||
| MIRT616281 | HMGB1 | high mobility group box 1 | |
|
2 | 2 | ||||||
| MIRT618372 | PRKG2 | protein kinase, cGMP-dependent, type II | |
|
2 | 2 | ||||||
| MIRT619540 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | |
|
2 | 2 | ||||||
| MIRT622303 | SGIP1 | SH3 domain GRB2 like endophilin interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT622590 | PRRG4 | proline rich and Gla domain 4 | |
|
2 | 2 | ||||||
| MIRT624441 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | |
|
2 | 2 | ||||||
| MIRT637089 | KLRD1 | killer cell lectin like receptor D1 | |
|
2 | 2 | ||||||
| MIRT639084 | ADCYAP1 | adenylate cyclase activating polypeptide 1 | |
|
2 | 2 | ||||||
| MIRT639334 | NINJ1 | ninjurin 1 | |
|
2 | 2 | ||||||
| MIRT639798 | EIF3E | eukaryotic translation initiation factor 3 subunit E | |
|
2 | 2 | ||||||
| MIRT640851 | RAB3B | RAB3B, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT641628 | KIAA1244 | ARFGEF family member 3 | |
1 | 1 | |||||||
| MIRT642634 | EPPIN | epididymal peptidase inhibitor | |
|
2 | 2 | ||||||
| MIRT643053 | EPPIN-WFDC6 | EPPIN-WFDC6 readthrough | |
|
2 | 2 | ||||||
| MIRT643416 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | |
|
2 | 2 | ||||||
| MIRT645586 | SAR1A | secretion associated Ras related GTPase 1A | |
|
2 | 2 | ||||||
| MIRT647393 | FAM181B | family with sequence similarity 181 member B | |
|
2 | 2 | ||||||
| MIRT649411 | CDC14B | cell division cycle 14B | |
|
2 | 2 | ||||||
| MIRT649477 | CLDN16 | claudin 16 | |
|
2 | 2 | ||||||
| MIRT651307 | ZDHHC20 | zinc finger DHHC-type containing 20 | |
|
2 | 2 | ||||||
| MIRT651387 | ZBTB16 | zinc finger and BTB domain containing 16 | |
|
2 | 2 | ||||||
| MIRT653411 | SLC7A2 | solute carrier family 7 member 2 | |
|
2 | 2 | ||||||
| MIRT654084 | RSPH4A | radial spoke head 4 homolog A | |
|
2 | 2 | ||||||
| MIRT654613 | PTPRM | protein tyrosine phosphatase, receptor type M | |
|
2 | 2 | ||||||
| MIRT655338 | PCP4L1 | Purkinje cell protein 4 like 1 | |
|
2 | 2 | ||||||
| MIRT656173 | MRPL44 | mitochondrial ribosomal protein L44 | |
|
2 | 2 | ||||||
| MIRT657272 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | |
|
2 | 2 | ||||||
| MIRT657881 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | |
|
2 | 2 | ||||||
| MIRT659875 | CAPRIN1 | cell cycle associated protein 1 | |
|
2 | 2 | ||||||
| MIRT662381 | ICA1L | islet cell autoantigen 1 like | |
|
2 | 4 | ||||||
| MIRT666308 | SLC22A3 | solute carrier family 22 member 3 | |
|
2 | 2 | ||||||
| MIRT667274 | NAV1 | neuron navigator 1 | |
|
2 | 2 | ||||||
| MIRT667614 | LIMCH1 | LIM and calponin homology domains 1 | |
|
2 | 2 | ||||||
| MIRT674242 | NUP62 | nucleoporin 62 | |
|
2 | 4 | ||||||
| MIRT690386 | PARP15 | poly(ADP-ribose) polymerase family member 15 | |
|
2 | 2 | ||||||
| MIRT693402 | NUDT16 | nudix hydrolase 16 | |
|
2 | 2 | ||||||
| MIRT702503 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | |
|
2 | 2 | ||||||
| MIRT708632 | STMN4 | stathmin 4 | |
|
2 | 2 | ||||||
| MIRT708839 | SCAND3 | zinc finger BED-type containing 9 | |
1 | 1 | |||||||
| MIRT709016 | HSBP1 | heat shock factor binding protein 1 | |
|
2 | 2 | ||||||
| MIRT709235 | RANGAP1 | Ran GTPase activating protein 1 | |
|
2 | 2 | ||||||
| MIRT710885 | PARL | presenilin associated rhomboid like | |
|
2 | 2 | ||||||
| MIRT712262 | PPP1CB | protein phosphatase 1 catalytic subunit beta | |
|
2 | 2 | ||||||
| MIRT712573 | ATP2B4 | ATPase plasma membrane Ca2+ transporting 4 | |
|
2 | 2 | ||||||
| MIRT715046 | PRPF38A | pre-mRNA processing factor 38A | |
|
2 | 2 | ||||||
| MIRT718905 | GALR1 | galanin receptor 1 | |
|
2 | 2 | ||||||
| MIRT719368 | FEM1A | fem-1 homolog A | |
|
2 | 2 | ||||||
| MIRT719495 | SEC24B | SEC24 homolog B, COPII coat complex component | |
|
2 | 2 | ||||||
| MIRT719601 | PRKX | protein kinase, X-linked | |
|
2 | 2 | ||||||
| MIRT719891 | RRP36 | ribosomal RNA processing 36 | |
|
2 | 2 | ||||||
| MIRT720063 | ZNF449 | zinc finger protein 449 | |
|
2 | 2 | ||||||
| MIRT721679 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | |
|
2 | 2 | ||||||
| MIRT721724 | VTI1A | vesicle transport through interaction with t-SNAREs 1A | |
|
2 | 2 | ||||||
| MIRT723370 | ZNF470 | zinc finger protein 470 | |
|
2 | 2 | ||||||
| MIRT724941 | TXNL1 | thioredoxin like 1 | |
|
2 | 2 | ||||||
| MIRT725302 | NLRC5 | NLR family CARD domain containing 5 | |
|
2 | 2 | ||||||
| miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|